ID: 928194752

View in Genome Browser
Species Human (GRCh38)
Location 2:29207139-29207161
Sequence CAGGGATACCTGGAGGATGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 350
Summary {0: 1, 1: 0, 2: 2, 3: 31, 4: 316}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
928194744_928194752 1 Left 928194744 2:29207115-29207137 CCCAGGAGCACCACCTTATGGCT 0: 1
1: 0
2: 0
3: 8
4: 119
Right 928194752 2:29207139-29207161 CAGGGATACCTGGAGGATGATGG 0: 1
1: 0
2: 2
3: 31
4: 316
928194742_928194752 8 Left 928194742 2:29207108-29207130 CCTTTGGCCCAGGAGCACCACCT 0: 1
1: 0
2: 0
3: 25
4: 195
Right 928194752 2:29207139-29207161 CAGGGATACCTGGAGGATGATGG 0: 1
1: 0
2: 2
3: 31
4: 316
928194738_928194752 28 Left 928194738 2:29207088-29207110 CCCGGCTTAGAGTATAGAGTCCT 0: 1
1: 0
2: 0
3: 5
4: 93
Right 928194752 2:29207139-29207161 CAGGGATACCTGGAGGATGATGG 0: 1
1: 0
2: 2
3: 31
4: 316
928194745_928194752 0 Left 928194745 2:29207116-29207138 CCAGGAGCACCACCTTATGGCTG 0: 1
1: 0
2: 0
3: 6
4: 102
Right 928194752 2:29207139-29207161 CAGGGATACCTGGAGGATGATGG 0: 1
1: 0
2: 2
3: 31
4: 316
928194748_928194752 -9 Left 928194748 2:29207125-29207147 CCACCTTATGGCTGCAGGGATAC 0: 1
1: 0
2: 0
3: 3
4: 82
Right 928194752 2:29207139-29207161 CAGGGATACCTGGAGGATGATGG 0: 1
1: 0
2: 2
3: 31
4: 316
928194739_928194752 27 Left 928194739 2:29207089-29207111 CCGGCTTAGAGTATAGAGTCCTT 0: 1
1: 0
2: 1
3: 7
4: 91
Right 928194752 2:29207139-29207161 CAGGGATACCTGGAGGATGATGG 0: 1
1: 0
2: 2
3: 31
4: 316

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
928194752 Original CRISPR CAGGGATACCTGGAGGATGA TGG Intronic
900152221 1:1183669-1183691 GAGGGCTGCCTGGAGGAGGAGGG - Intronic
900412464 1:2519031-2519053 CAGGGAGGCCTGGAGGGTGGGGG - Intronic
900727200 1:4224503-4224525 CAGGGAGTCCTGGAGGATCCAGG + Intergenic
901356052 1:8650300-8650322 CAGGGATACTTTGAGGATAAAGG - Intronic
901468866 1:9441680-9441702 AAGGGACACCTGGAGGAAGCAGG + Intergenic
901883886 1:12209461-12209483 CCAGGAGACCTGGAGGATGAAGG - Intergenic
902155622 1:14483283-14483305 CAGGGTTGCATGGAGGAGGAGGG - Intergenic
902187368 1:14735422-14735444 CAGGGCTGCCTGGAAGAAGAAGG - Intronic
902632069 1:17710903-17710925 CATGGAAACCTGGAGGTTCAGGG - Intergenic
902839340 1:19065346-19065368 CAGGGTAACCGGGAGGAGGACGG + Intergenic
903114462 1:21167300-21167322 CAGGGATTCATGCGGGATGAGGG - Intronic
904724369 1:32535764-32535786 GAGGAATAAGTGGAGGATGAAGG - Intronic
905208062 1:36354230-36354252 CTGGGATTCCTGGAGGAAGTGGG + Intronic
905845337 1:41225988-41226010 CAGGGATACCAGGAGGTTCAAGG - Intronic
906205157 1:43982584-43982606 CAGAGGGACCTGGAGGATGCAGG + Intronic
907909252 1:58812875-58812897 CAGGGAAAAGAGGAGGATGATGG - Intergenic
908805074 1:67922117-67922139 CAGGGAAACCAAGAGGTTGATGG + Intergenic
910505255 1:87943195-87943217 CAGTGAAACCTAAAGGATGAGGG + Intergenic
912269222 1:108192524-108192546 CAGGAAGGCCTGGAGGATGTAGG - Intronic
913319943 1:117581185-117581207 CAGGGAAGACTGGAGAATGAAGG + Intergenic
915167441 1:153956239-153956261 CAGGGAAGCCTGGAGAAGGAGGG + Intronic
918213663 1:182374307-182374329 TAGGGATTCCTGCAGGATGCTGG + Intergenic
919422149 1:197383163-197383185 CAGGGATATGTGTGGGATGAAGG - Intronic
919797008 1:201326961-201326983 CAGGGCTACCTAGAGGACCAGGG + Intronic
920310850 1:205047385-205047407 CAGACCTTCCTGGAGGATGATGG + Intronic
920377320 1:205516145-205516167 CAGGGTCAGCTGGAGGATGAAGG + Intronic
920387619 1:205579936-205579958 CGGGCTTACCTGGAGGAAGACGG - Exonic
920848592 1:209613248-209613270 CAGGGAGACCTGGAAGCTGGTGG - Exonic
921739054 1:218662948-218662970 CAGGGATTTCATGAGGATGATGG - Intergenic
922342892 1:224671557-224671579 CAGGGCTACCTGGTTGAAGAGGG - Intronic
922775978 1:228214356-228214378 CAGTGCTGCCTGGAGGATGTGGG + Exonic
923357375 1:233172699-233172721 CAGGAGTACCTGGAGGAAGCAGG - Intronic
923942328 1:238842102-238842124 CAGAGATACCTAGAGGATGAAGG - Intergenic
924708240 1:246515115-246515137 CCTGGAGACTTGGAGGATGAAGG - Intergenic
1062768204 10:81049-81071 GAGGGCTTCCTGGAGGAGGAGGG - Intergenic
1063192032 10:3704550-3704572 CAGAGGTACCTTGAGGAAGAAGG + Intergenic
1064063274 10:12157999-12158021 CAGGGCCGACTGGAGGATGATGG - Exonic
1064256116 10:13743975-13743997 CAGGGTTACATGGAGGAAAAAGG + Intronic
1065564030 10:26991123-26991145 CAGGGATCCCTGGAGGAAGGAGG + Intergenic
1065983653 10:30928903-30928925 CAGTGATATCAGGAGGTTGAAGG - Intronic
1066224184 10:33366224-33366246 AAGGGAGACATGGAGGGTGAGGG - Intergenic
1066745911 10:38604199-38604221 CAGGGAGGGCTGGAGGGTGATGG - Intergenic
1067030358 10:42875476-42875498 CAGGGAAGGCTGGAGGAAGAGGG - Intergenic
1067343739 10:45423453-45423475 CAGGGCTTCCTGGAGGAGGCAGG - Intronic
1067711337 10:48653553-48653575 CAGGGATAGCTGGAAGCAGAAGG + Intronic
1068901471 10:62274063-62274085 CATGGATACATGGATGATGCCGG + Intergenic
1069647091 10:70008283-70008305 CAGGGATAACTGGACCATGGGGG - Intergenic
1070413957 10:76171640-76171662 CAGGGATTCCTGGAGGCTGTGGG + Intronic
1070760209 10:79019552-79019574 CAGGTACACTTGGAGGATAAAGG + Intergenic
1074564392 10:114564152-114564174 CAGGGATGCCTGGAGGAGTTTGG - Intronic
1075798061 10:125135098-125135120 CAGTGATACCTGGATCAAGAAGG - Intronic
1076064589 10:127439409-127439431 CAGAGAGACCTGGAGGAAGGTGG + Intronic
1076864803 10:133161288-133161310 CTCGGATCCCTGGAGGGTGAGGG - Intronic
1076980763 11:203527-203549 CAGGAAAACATGGGGGATGAAGG + Exonic
1077140919 11:1024515-1024537 CAGGGAGACCTCCAGGATGCAGG - Intronic
1078455279 11:11470090-11470112 CAGGGACACTTGGATGAGGATGG + Intronic
1081540109 11:44028571-44028593 CAGGGATGACTAGAGGATGCTGG - Intergenic
1082975715 11:59069930-59069952 TAGGCAAACCTGGCGGATGAAGG + Intergenic
1082980096 11:59113345-59113367 TAGGCAAACCTGGTGGATGAAGG + Intronic
1083304591 11:61755824-61755846 CAGGGAGCCTTGGAGGATGGAGG + Intronic
1083779183 11:64909359-64909381 CATAGATACCTGGAGGGGGATGG + Exonic
1085046527 11:73356827-73356849 CAGGGAGACCTGCAGGTAGAGGG - Intronic
1085835567 11:79952501-79952523 GAGTGAAACCTGGAGGATAAAGG - Intergenic
1085837274 11:79970598-79970620 CAGGGATACTGGGAAGATTAAGG + Intergenic
1088494208 11:110417418-110417440 CAGGGATCCCTGGAGGAGAGAGG - Intergenic
1089220110 11:116863629-116863651 CAGGCATCCCTGGAGGAGCATGG - Intronic
1091156966 11:133383075-133383097 CAGGGTGACCAGGAGGATGTTGG - Intronic
1091684652 12:2553121-2553143 CAGGGCTAGCTGGAGGTTGGTGG - Intronic
1091891377 12:4057330-4057352 CAAGGCTCCCTGGTGGATGAGGG + Intergenic
1092218431 12:6697866-6697888 CAGGGAAACCTGGAGGTTTCTGG - Intronic
1092409492 12:8242969-8242991 CCGGGAGACCTGGAGGAAGCCGG + Intergenic
1093304395 12:17495233-17495255 TTGGGATACCTTGAGTATGAAGG - Intergenic
1093843296 12:23933216-23933238 CAGGGTTAGCTGGAGCAGGATGG - Intronic
1095170421 12:39028330-39028352 CAGGGATAAATGGATGATGCAGG + Intergenic
1095981166 12:47975560-47975582 CAGGGGGACCTGGAGGACCAGGG + Exonic
1096110921 12:49028797-49028819 TAGGGGTACCTCGAGGCTGAGGG - Intronic
1097054697 12:56242609-56242631 CAGGGGCAGCTAGAGGATGAGGG - Exonic
1097067160 12:56329106-56329128 CATGGATACCAAGAAGATGATGG + Intronic
1098774260 12:74591234-74591256 CATGGATACTTGGAAGTTGAAGG + Intergenic
1098911340 12:76212130-76212152 CTGGGAGACCAGGAGGATAAGGG - Intergenic
1101785977 12:107884011-107884033 CAGGGATAACGGAAGGAGGAAGG - Intergenic
1102218806 12:111180454-111180476 CAGGGACAGCTGGCGGCTGAAGG - Intronic
1102687025 12:114732682-114732704 CAGGGAGACCTGCAGAATTAGGG + Intergenic
1103772949 12:123342762-123342784 CAGGGATTCTTGGAGGCTGAAGG - Intronic
1104645655 12:130495471-130495493 CAGGGTGACCTGGAGGGAGAGGG - Intronic
1105202223 13:18190556-18190578 CTGGGACACCTGGATGATGAAGG - Intergenic
1110718707 13:78737532-78737554 CAGGGAAACCAGCAGGATCACGG + Intergenic
1113065626 13:106371549-106371571 ATGGGACACCTGGAGGATAATGG + Intergenic
1113091280 13:106619398-106619420 AAGGGATCCCGGGAGGAGGAAGG - Intergenic
1113628587 13:111864695-111864717 CATGGAAGCCTGGAGGATGCGGG + Intergenic
1113772165 13:112917235-112917257 CTGGGAGACCTGTAGGATGCGGG - Intronic
1115719089 14:36139993-36140015 CATGGATTCTTGGAGGGTGATGG - Intergenic
1116750970 14:48883050-48883072 GATGGATATCTGGAGGATGGTGG - Intergenic
1117858518 14:60062758-60062780 CAGGGATGCCAGGAAGATGGGGG - Intronic
1117879872 14:60302813-60302835 CAGGGATTCACTGAGGATGAGGG - Intergenic
1118780529 14:69004842-69004864 CAGGGAGAGCTGGGGGAAGAGGG - Intergenic
1118973151 14:70654242-70654264 CAGAGAGAGCTGGGGGATGAGGG - Intronic
1119757845 14:77131400-77131422 CAGGGAGACCTACAGGATGTTGG - Exonic
1120056240 14:79927448-79927470 CTGGGATGCCTTGAGGAAGAAGG - Intergenic
1124558724 15:30751019-30751041 CATGAAAAGCTGGAGGATGAAGG - Intronic
1124904910 15:33859134-33859156 CAGGGATTCCTGCAGCAGGAAGG - Intronic
1125203287 15:37121821-37121843 CATGGATAGCTGGAGGCAGATGG + Intergenic
1125798801 15:42425948-42425970 CAGGGTTGGCTGGGGGATGAAGG - Intronic
1127370345 15:58332985-58333007 CAGGGATCCCTGCAGGTAGAGGG - Intronic
1129168829 15:73795643-73795665 GAGGGCTTCCTGGAGGAGGAAGG + Intergenic
1131325032 15:91434764-91434786 CAGGAATACCTGGAGGAATCAGG + Intergenic
1131986012 15:98043558-98043580 CAGGGAAGCCTGGATGGTGATGG - Intergenic
1132143775 15:99414975-99414997 CAAGGAAACCTGGAGGAGGTGGG - Intergenic
1132457104 16:30025-30047 GAGGGCTTCCTGGAGGAGGAGGG - Intergenic
1132605721 16:792952-792974 CAGGGAGACCTGGTGGAGAAGGG - Exonic
1135222580 16:20625514-20625536 ATGCGATACCTGGAGGATGAAGG + Exonic
1136156813 16:28388620-28388642 CAGCGCTACCTGGAGGAGAAGGG - Exonic
1136206273 16:28726661-28726683 CAGCGCTACCTGGAGGAGAAGGG + Exonic
1138077711 16:54058646-54058668 CAGTTATACCTGCAGGAGGATGG - Intronic
1138350238 16:56342429-56342451 CATGGATTCCTGGAGGCTGAGGG + Intronic
1139532273 16:67548199-67548221 CAGGGGTCCCTGGAGGAGGCCGG + Intergenic
1140811195 16:78579802-78579824 CGGTGATACCTGGAACATGATGG + Intronic
1140869969 16:79097134-79097156 CAGGAATACATGTAGGGTGAAGG + Intronic
1141511404 16:84514486-84514508 TGGGGACACCTGAAGGATGAGGG - Intronic
1141811460 16:86378976-86378998 CAGGGTTACATGGAAGATGCAGG - Intergenic
1141927088 16:87177078-87177100 CAGGGAAACATGGAAGGTGAAGG - Intronic
1142183313 16:88682113-88682135 CATGGGCACCTGGAGGATGCCGG - Intronic
1142573790 17:892957-892979 CAGGAATACCTGGAGGGCAAGGG + Intronic
1142619170 17:1154169-1154191 CAGGGACACCAGGATCATGAAGG - Intronic
1143167185 17:4902639-4902661 CAGGGTGACCTTGAGGCTGATGG + Exonic
1143604818 17:7976757-7976779 CAGGGACTCCTGCAGGAGGAAGG + Intergenic
1143940332 17:10534237-10534259 CAGGGTTTCCTGGAGGCAGAGGG - Intronic
1144013800 17:11174687-11174709 CAGGGATCCCTGGATTTTGAGGG + Intergenic
1144415462 17:15042319-15042341 CAGGGGTTCCTGGAGGATCATGG - Intergenic
1145760634 17:27423541-27423563 CCTGGAGACTTGGAGGATGAAGG + Intergenic
1145798403 17:27668754-27668776 CCTGGAGACTTGGAGGATGAAGG - Intergenic
1146160685 17:30557857-30557879 CCTGGAGACTTGGAGGATGAAGG + Exonic
1146423518 17:32712979-32713001 CATGGATACCAGGAGGTAGAGGG + Intronic
1146647255 17:34583475-34583497 CAGGCAGCCCTGGAGGAGGAGGG - Intronic
1146843705 17:36170958-36170980 CCTGGAGACTTGGAGGATGAAGG - Intronic
1146856012 17:36258892-36258914 CCTGGAGACTTGGAGGATGAAGG - Intronic
1146864608 17:36329483-36329505 CCTGGAGACTTGGAGGATGAAGG + Intronic
1146871918 17:36382803-36382825 CCTGGAGACTTGGAGGATGAAGG - Intronic
1146879279 17:36433888-36433910 CCTGGAGACTTGGAGGATGAAGG - Intronic
1146883209 17:36455033-36455055 CCTGGAGACTTGGAGGATGAAGG - Intergenic
1147067468 17:37930071-37930093 CCTGGAGACTTGGAGGATGAAGG + Intronic
1147074804 17:37983427-37983449 CCTGGAGACTTGGAGGATGAAGG - Intronic
1147078999 17:38009632-38009654 CCTGGAGACTTGGAGGATGAAGG + Intronic
1147086327 17:38062973-38062995 CCTGGAGACTTGGAGGATGAAGG - Intronic
1147094936 17:38133567-38133589 CCTGGAGACTTGGAGGATGAAGG + Intergenic
1147102273 17:38186936-38186958 CCTGGAGACTTGGAGGATGAAGG - Intergenic
1148243359 17:46014311-46014333 CAGGGCTACCTGGTTTATGATGG - Exonic
1148792919 17:50183685-50183707 CATGGATACTGGGAGGGTGAGGG - Exonic
1148891746 17:50812544-50812566 CAGGGTTTCCTGGAGGGTGATGG + Intergenic
1149206443 17:54253603-54253625 CGGGGACATCTGGAGGCTGAGGG - Intergenic
1149846861 17:60013443-60013465 CCTGGAGACTTGGAGGATGAAGG - Intergenic
1150085209 17:62270020-62270042 CCTGGAGACTTGGAGGATGAAGG - Intergenic
1151883142 17:76906589-76906611 CAGTAAGACATGGAGGATGAAGG + Intronic
1151943520 17:77306975-77306997 CAGGGTTACCTGGGGGAGTAGGG + Intronic
1152961093 18:80546-80568 GAGGGCTTCCTGGAGGAGGAGGG - Intergenic
1156012765 18:32513259-32513281 CAGGAATACCTGGAGGTGCAGGG - Intergenic
1156291015 18:35748514-35748536 CAGGAAGACCTGCAGGATGATGG + Intergenic
1156293922 18:35773289-35773311 TGGGGACACCTGGAGGATGGAGG - Intergenic
1157935477 18:51867398-51867420 TAGGGATACGTGGAAGAGGAGGG - Intergenic
1159954200 18:74507819-74507841 CAGGGAGCCCTGGAGGGTGGGGG + Intronic
1160408589 18:78659777-78659799 CAGGGACAGCTGGGGGATGGTGG - Intergenic
1160725164 19:614619-614641 CAGGGAGGCCTGGAGGAGGTTGG + Intronic
1160752676 19:741781-741803 CAGGGACCCCAGGAGGAGGAGGG + Intronic
1160786129 19:900882-900904 CTTCGCTACCTGGAGGATGAGGG - Exonic
1160889736 19:1370938-1370960 GAGACCTACCTGGAGGATGAGGG + Exonic
1161058276 19:2201287-2201309 GAGGAATACAGGGAGGATGACGG - Intronic
1161356402 19:3821526-3821548 CAGGGATGCCAGGAGGATCTTGG + Intronic
1161527114 19:4763162-4763184 CCTGGTTCCCTGGAGGATGAGGG + Intergenic
1162717209 19:12641641-12641663 CAGGCATACAGGGAGGATGAAGG - Intergenic
1165531541 19:36406358-36406380 TAGGGATATTTGGGGGATGACGG - Intronic
1165622796 19:37262545-37262567 CAGGGATTCCAGGAGGATCCAGG - Intergenic
1165634490 19:37329175-37329197 CAGGGATTCCAGGAGGATCCAGG - Intronic
1166219844 19:41357308-41357330 CAGGGAGACATTGAGGATCAAGG - Intronic
1166643391 19:44513143-44513165 CAGGGATACAGGGAGGGGGATGG - Intronic
1167323390 19:48810115-48810137 CTGGGATACCTGGGGTATGTGGG - Intronic
1167446213 19:49539105-49539127 CAGGGTTTCCTGGAGGAGAAAGG - Exonic
1168200659 19:54813111-54813133 TGGCGATACCTGGAGGAAGATGG - Intronic
1168256169 19:55166522-55166544 CCGGGATATTTGGAGGATAAAGG - Exonic
924985266 2:264485-264507 GAGGGGTACCTGGAGGAGGAAGG - Intronic
925333239 2:3074882-3074904 GAGGGACACCTGGAGGCTGAGGG - Intergenic
925579439 2:5395759-5395781 CAGGGAGCTCTGGAGCATGAAGG + Intergenic
925728038 2:6893411-6893433 CAGGGAAGCCTTCAGGATGAAGG + Intronic
926691239 2:15735499-15735521 CAGGGATAGAAGGAGGCTGAAGG - Intronic
926973033 2:18485688-18485710 CAGGGAAACCTGGGGAAGGAGGG - Intergenic
928117916 2:28560992-28561014 CAGGAATAACAGGAGGATGAGGG - Intronic
928194752 2:29207139-29207161 CAGGGATACCTGGAGGATGATGG + Intronic
928454314 2:31405400-31405422 CAGGGAGCCCTGGAGGGTGGGGG - Intronic
930534101 2:52626127-52626149 CAGGGAAACCTGGAACATGGAGG + Intergenic
930595421 2:53381645-53381667 CAGGGGTAGCTGTAGGAAGAAGG - Intergenic
931469659 2:62525875-62525897 CAGCCATATCTTGAGGATGAGGG - Intergenic
935217856 2:100988812-100988834 CAGGGGGACCTGGAGGAGCAGGG - Intronic
935217897 2:100988923-100988945 CAGGGAGGCCTGGAGGAGCAGGG - Intronic
935374693 2:102382942-102382964 CAGGGAAACTTGGAGTTTGAAGG - Intronic
937005511 2:118509099-118509121 GAGGGATAGCTGAAGGATGTGGG + Intergenic
937912506 2:127082317-127082339 CAGGGGCCCCTGGAGCATGAGGG - Intronic
938805402 2:134802525-134802547 CAGGCATATCTGTAGGATGAGGG - Intergenic
939111872 2:138018152-138018174 CAAGGATACCTGGAGTAAAATGG - Intergenic
939318672 2:140586574-140586596 CAGTGTCACCTAGAGGATGATGG - Intronic
941655731 2:168143150-168143172 CAGGAATAACTGGAGGATATGGG + Intronic
942088069 2:172462061-172462083 CAGCTTTACCTTGAGGATGAAGG + Intronic
944685537 2:202114198-202114220 CTTGGATACAGGGAGGATGAGGG - Intronic
944911349 2:204313471-204313493 CAGGGAAACTTGGAGGGTGGCGG - Intergenic
946373097 2:219292389-219292411 CAGGGATATCAGGAGTATGCAGG - Intronic
946440278 2:219689282-219689304 CAGGGAGCCCTGGAGCCTGAGGG - Intergenic
948499181 2:238379159-238379181 CAAGGTTACCTGGAGGCTGCTGG + Intronic
948729172 2:239952527-239952549 CAGGGGTACCTGGAAGCTGTTGG - Intronic
1171424831 20:25042860-25042882 GAGGGGTGTCTGGAGGATGAGGG - Intronic
1172175049 20:32967022-32967044 CAGGGATTCCTGGAGAAAGGTGG + Intergenic
1173010951 20:39181500-39181522 CAGGGAGACCTGGATGAGGGTGG + Intergenic
1173704452 20:45099720-45099742 CAGGGATGACTGGAGGATTAAGG + Intronic
1173795746 20:45858037-45858059 GAGGGCTGCCTGGAGGAGGAGGG + Intronic
1173968568 20:47132696-47132718 CATGGATACCTTGTGAATGATGG + Intronic
1174078887 20:47957168-47957190 CAGGGGCACCTGGAGGCTGCTGG - Intergenic
1174280333 20:49434524-49434546 CAGGGAGCCCAGGAAGATGATGG - Intronic
1174286271 20:49475936-49475958 CAGGGTTGTCTGAAGGATGAAGG - Intronic
1176167683 20:63682592-63682614 CTCGGGTGCCTGGAGGATGAGGG + Intronic
1176715723 21:10347452-10347474 CTGGGACACCTGGATGATGAAGG + Intergenic
1177267806 21:18807204-18807226 CAGTGATATCGGGAGGATCAAGG - Intergenic
1179086475 21:38222725-38222747 CAGGGATTCCTGGAGGAAAGAGG + Intronic
1180602617 22:17032501-17032523 CTGGGACACCTGGATGATGAAGG - Intergenic
1183422960 22:37723057-37723079 CAGTGAGACCTGTAGGAGGAGGG + Intronic
1184450490 22:44579677-44579699 CAGGGCTTCCTGGAGGAGGTGGG - Intergenic
1184684800 22:46091415-46091437 GAGGGCTTCCTGGAGGAAGAGGG - Intronic
1184684836 22:46091559-46091581 GAGGGCTTCCTGGAGGAAGAGGG - Intronic
1184684845 22:46091595-46091617 GAGGGCTTCCTGGAGGAAGAGGG - Intronic
1185295276 22:50049950-50049972 CAGGGAGGCCAGGAGGGTGATGG + Intronic
949495713 3:4629806-4629828 GAGGGCTTCCTGGAGGAAGAAGG + Intronic
950510778 3:13425130-13425152 CAGGCATCACTAGAGGATGATGG + Intergenic
951578308 3:24135668-24135690 CAGGGATATCTGAAGGCTGCAGG - Intronic
952164409 3:30731227-30731249 CCTGGGTACCTGGAGGACGAAGG - Intronic
952710646 3:36428969-36428991 TAGGGAGACCTTGAGGATGGCGG + Intronic
952808991 3:37384842-37384864 CAAGGATCCCTGCAGGATGAGGG - Intergenic
952958449 3:38575246-38575268 CAGGGACGGCTGGAGGAGGAGGG - Intronic
952998619 3:38909339-38909361 CAGGAATCCCTGGAGTATTAGGG - Intronic
954111414 3:48435429-48435451 CAGAGAGACCTGGAGGATGTAGG - Intronic
954720166 3:52554748-52554770 CAGGCACACCTGGCGGAAGATGG + Exonic
955737702 3:62057322-62057344 CAGTGTAAACTGGAGGATGAAGG - Intronic
956162810 3:66372782-66372804 CAGAGATACCTTCAGGCTGAGGG - Intronic
957230820 3:77511644-77511666 CAGTGGTCACTGGAGGATGAAGG + Intronic
957949097 3:87101302-87101324 CATGCTTACCTGGAGGATGTTGG - Intergenic
958085534 3:88801358-88801380 CAGGGCCTCCTGGAGGGTGAGGG - Intergenic
958803049 3:98778475-98778497 CAAGGAGAGCTTGAGGATGAGGG + Intronic
960025020 3:112998864-112998886 CAGGAATATCTGGTGGATTAAGG + Intronic
960963690 3:123090137-123090159 CAGGGATGCCTGGAGGATGCAGG - Intronic
963049333 3:141128084-141128106 CAGGGAAACCTGGAGGCCGCAGG - Intronic
964374802 3:156039067-156039089 CAGAGATTCCTGGAGGCTCATGG + Intronic
964419539 3:156486688-156486710 CAGGGCCTCCTGGAGGATGAAGG + Intronic
965278675 3:166720604-166720626 TAGGGATTCCTCAAGGATGAGGG + Intergenic
965537720 3:169841268-169841290 CAGGGCTGCCAGGAGGAAGAAGG - Intronic
965827568 3:172746120-172746142 CAGGGAGACCAAGAGGAGGAAGG + Intergenic
967119963 3:186374031-186374053 CAGACATACCTGGAGGGTGAGGG + Intergenic
968422468 4:497278-497300 CAGGGATCCCTGGAGGAACAAGG + Intronic
968469081 4:769640-769662 GAAGGACACCTGGAGGGTGAGGG - Exonic
971449155 4:26784033-26784055 CAGGGCTTCCAGGAGGATGGAGG - Intergenic
977252061 4:94700573-94700595 CATGGGTCCCTGGAGGATGGAGG - Intergenic
977528894 4:98176426-98176448 CAGTGATATCTGGAGGAAAATGG + Intergenic
978324737 4:107539576-107539598 CAGGGATGGGTTGAGGATGAGGG + Intergenic
978729859 4:112013096-112013118 CTGGGACACCTGTAGGAAGAAGG + Intergenic
979211855 4:118114240-118114262 TAGGGAAAACTGAAGGATGAAGG - Intronic
981051252 4:140311597-140311619 CAGGCTTACCAGGAGGAAGAGGG - Intronic
984944878 4:184963025-184963047 CAGGGAAAACTGAAGGAGGATGG - Intergenic
987016429 5:13824811-13824833 CAGGATTACCTGAAGGAGGAAGG + Intronic
988294074 5:29331951-29331973 CAGGAAAAGCTGGAGGAGGATGG + Intergenic
989584187 5:43061722-43061744 CTGGGATACCTGCAGCTTGAAGG - Intergenic
990119443 5:52431937-52431959 AAGGGGATCCTGGAGGATGAGGG - Intergenic
990970644 5:61502197-61502219 CAGGGATGCCAGGAGCAGGAAGG + Intronic
991396499 5:66209608-66209630 CTGGGCTACCTGGAGGAAGTTGG + Intergenic
992491356 5:77247620-77247642 CAGGGATCTCATGAGGATGAAGG - Intronic
995547995 5:113252075-113252097 CAGGGATAAATGGAGGAATAGGG - Intronic
996000465 5:118355924-118355946 CTTGGATACCTGGAGGCTTATGG - Intergenic
997699316 5:135885354-135885376 CAGGGAAGCCTGGAGGGTGTTGG - Intronic
998514056 5:142736998-142737020 CTGGGAAACCTGGAGGGTGGAGG - Intergenic
1000052064 5:157572043-157572065 CAGGGTTGCCTTGAGCATGAAGG - Intronic
1001079997 5:168660696-168660718 CAGGGAGACCTGGGGGAAGAAGG + Intergenic
1001360125 5:171075540-171075562 CAGGGAGGCTTGGAGAATGATGG + Intronic
1002310399 5:178310407-178310429 CAGGGAGTCCTGGAGGAAAAGGG - Intronic
1002829714 6:808702-808724 CATGTATCCCTGAAGGATGAAGG - Intergenic
1003400392 6:5785864-5785886 CAGGGATCCCTGGAGGCCAAGGG - Intergenic
1005196004 6:23284793-23284815 CACAGATACCTGGAGGAGGCTGG + Intergenic
1005441484 6:25873800-25873822 CTGGGTGACCTGGAGGAAGAGGG - Intronic
1007095312 6:39209311-39209333 CTGGCATACCTGGATGGTGAGGG - Intronic
1007628974 6:43262299-43262321 CAGGCAGGCCTGGAGGGTGATGG + Intronic
1007978869 6:46130090-46130112 AAGGGGGACCTGGAGGAAGAGGG - Exonic
1009404896 6:63300139-63300161 CAGGCAAAGCTGGAGGAGGAAGG - Intronic
1010758686 6:79697504-79697526 CTGGCATACCTGTAGGAAGAAGG + Intronic
1011179082 6:84598877-84598899 CAGGGACACCTGGTGAAAGATGG - Intergenic
1012523651 6:100151043-100151065 GAGGAAAACCTGGAGGATGCTGG + Intergenic
1015752391 6:136573593-136573615 AAGGGATTCATGGAGGCTGAAGG + Intronic
1015828005 6:137336425-137336447 CAGGGGTTCGCGGAGGATGAGGG - Intergenic
1016003540 6:139066841-139066863 CAGGGATCCCAGGAGGTTTAAGG - Intergenic
1016747882 6:147600263-147600285 CAGAGATACCTGGGAGACGAGGG - Intronic
1017111382 6:150936300-150936322 CAGGGATATCTGGAAGGAGAAGG + Intronic
1018839003 6:167505836-167505858 AATGGCAACCTGGAGGATGAAGG - Intergenic
1019485046 7:1285563-1285585 CAGGGACAACTGGGGGAGGAGGG - Intergenic
1019777251 7:2919192-2919214 AAGGGCTTCCTGGAGGAGGAGGG + Intronic
1022764328 7:33393775-33393797 GAGGGCTAACTGCAGGATGATGG - Intronic
1022970709 7:35514239-35514261 CAGGGAGACCTGGAAGCAGAAGG - Intergenic
1027249469 7:76389989-76390011 GAGGGCTTCCTGGAGGAGGAAGG + Exonic
1029198010 7:98819908-98819930 CTGGGAGACCTGGAGGATTTGGG + Intergenic
1030168387 7:106577168-106577190 CAGGGATACCTTGAGGTAGCAGG - Intergenic
1032246799 7:130220230-130220252 CAGGGCACACTGGAGGATGAGGG - Intergenic
1032804191 7:135339314-135339336 CATGGAGACCTGGAGGGTGCTGG - Intergenic
1033116136 7:138627142-138627164 CTGTGATAGCTGGAGGAAGATGG + Intronic
1035400852 7:158564620-158564642 CAGGTATTCCTGGGGCATGAAGG - Intronic
1035814612 8:2526125-2526147 CAGGGATCTCAGAAGGATGAAGG + Intergenic
1035912258 8:3580385-3580407 CAGGGATACCTGGGGGGAGGCGG + Intronic
1036849880 8:12194096-12194118 CCGGGAGACCTGGAGGAAGCCGG + Exonic
1036871244 8:12436369-12436391 CCGGGAGACCTGGAGGAAGCCGG + Intergenic
1037331549 8:17748365-17748387 CATGGACACCTGAAGGATGGTGG - Intronic
1038012387 8:23485381-23485403 GAAGGGTACCTGGAGAATGATGG - Intergenic
1040672124 8:49704424-49704446 CAGGGTGACCTGGGGGATGGTGG - Intergenic
1042880244 8:73479928-73479950 CAGGGAAACCAGTAGGAAGACGG - Intronic
1044951015 8:97435272-97435294 CATGGGAACCTGGAGGTTGAAGG + Intergenic
1045175801 8:99723603-99723625 CAAGGAGATCTGGAGTATGATGG + Intronic
1045720155 8:105099863-105099885 CAGGGAGACCTTGAAGAAGAGGG + Intronic
1048172662 8:132122591-132122613 CAGTGCTATCTGGAGGATGAAGG + Exonic
1048392902 8:133985046-133985068 GATGGACACCTGGAGGATGTGGG + Intergenic
1048582950 8:135745506-135745528 CAGGGAAAGATGGAGGATTAGGG + Intergenic
1049191063 8:141287872-141287894 CAGGGGCACCTGGAGGAAGACGG + Intronic
1049324830 8:142016451-142016473 CAGAGAGGCCTGGAGGAGGACGG - Intergenic
1049352197 8:142170343-142170365 GAGGGCTTCCTGGAGGAGGAGGG + Intergenic
1052816559 9:33106646-33106668 CAGGGCTTCCTGGAGCATCACGG - Intronic
1056820925 9:89841618-89841640 CACAGCTACCTGGAGGCTGACGG - Intergenic
1057174367 9:92985221-92985243 TAGGGAAACCTGGAGGAGGCTGG + Intronic
1057291277 9:93808956-93808978 CAGGGGTCCCTAGAGGATCAGGG + Intergenic
1060555421 9:124505119-124505141 CTGGGGGGCCTGGAGGATGAGGG - Intronic
1061498614 9:130989914-130989936 CAGGGCTGCCTGGAGGATGGCGG + Intergenic
1061865750 9:133491050-133491072 GAGGAAAAGCTGGAGGATGAGGG + Intergenic
1062415656 9:136448317-136448339 CAGAGACACCAGGAGGATGGAGG + Intronic
1062415665 9:136448355-136448377 CAGAGACACCAGGAGGATGGAGG + Intronic
1062415676 9:136448392-136448414 CAGAGACACCAGGAGGATGGAGG + Intronic
1062415687 9:136448429-136448451 CAGAGACACCAGGAGGATGGAGG + Intronic
1062415695 9:136448466-136448488 CAGAGACACCAGGAGGATGGAGG + Intronic
1062415706 9:136448504-136448526 CAGAGACACCAGGAGGATGGAGG + Intronic
1062415740 9:136448650-136448672 CAGAGACACCAGGAGGATGGAGG + Intronic
1062415758 9:136448724-136448746 CAGAGACACCAGGAGGATGGAGG + Intronic
1062415769 9:136448762-136448784 CAGAGACACCAGGAGGATGGAGG + Intronic
1062415778 9:136448800-136448822 CAGAGACACCAGGAGGATGGAGG + Intronic
1062415786 9:136448836-136448858 CAGAGACACCAGGAGGATGGAGG + Intronic
1062737068 9:138143440-138143462 GAGGGCTTCCTGGAGGAGGAGGG + Intergenic
1186490822 X:9970602-9970624 CAGAGATTCCTGTAGGAAGAAGG - Intergenic
1188558343 X:31438086-31438108 AAGGGAAACGTGGAGGATGAAGG - Intronic
1190727451 X:53198880-53198902 TACCGATACCTGGAGGAAGAGGG + Exonic
1195275119 X:103274355-103274377 GAGGGACAACTGGAAGATGAGGG - Exonic
1195308691 X:103609233-103609255 GAGGGACAACTGGAAGATGAGGG + Exonic
1195453207 X:105038701-105038723 CAGGGCTTACTTGAGGATGAAGG - Intronic
1197035300 X:121866754-121866776 TAGGGACACCAGGAGGATCATGG + Intergenic
1198302055 X:135343032-135343054 GGGGGAAATCTGGAGGATGAAGG + Exonic
1199977592 X:152903595-152903617 CAGAGACAACTGCAGGATGAGGG + Intergenic
1200399255 X:156009701-156009723 GAGGGCTTCCTGGAGGAGGAGGG + Intronic