ID: 928196996

View in Genome Browser
Species Human (GRCh38)
Location 2:29223202-29223224
Sequence TTGTCCTCCTAGGAGGGCTA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 135
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 127}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
928196990_928196996 -7 Left 928196990 2:29223186-29223208 CCCTGAATGTCAAGGCTTGTCCT 0: 1
1: 0
2: 1
3: 13
4: 126
Right 928196996 2:29223202-29223224 TTGTCCTCCTAGGAGGGCTAGGG 0: 1
1: 0
2: 0
3: 7
4: 127
928196988_928196996 6 Left 928196988 2:29223173-29223195 CCAACATACATGGCCCTGAATGT 0: 1
1: 1
2: 1
3: 21
4: 183
Right 928196996 2:29223202-29223224 TTGTCCTCCTAGGAGGGCTAGGG 0: 1
1: 0
2: 0
3: 7
4: 127
928196991_928196996 -8 Left 928196991 2:29223187-29223209 CCTGAATGTCAAGGCTTGTCCTC 0: 1
1: 0
2: 0
3: 4
4: 101
Right 928196996 2:29223202-29223224 TTGTCCTCCTAGGAGGGCTAGGG 0: 1
1: 0
2: 0
3: 7
4: 127

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
928196996 Original CRISPR TTGTCCTCCTAGGAGGGCTA GGG Intronic
901448031 1:9319909-9319931 TGGTCCTCCCAGGAGGTCTGGGG - Intronic
903192800 1:21666299-21666321 TTGTCCTCCCAGCAAGGCTGGGG - Intronic
906479861 1:46192951-46192973 TTGGCCTCCTAGAAGGGGAATGG + Exonic
913991293 1:143614754-143614776 TTGTCCTCCTTGCAGGGATTTGG + Intergenic
915629729 1:157142934-157142956 TTGTCATCCTAAGAGGGCAGAGG + Intergenic
917155341 1:171991682-171991704 ATGACCTCCTAGGAGGGATGAGG - Intronic
917674898 1:177309717-177309739 TGCTCCTTCTGGGAGGGCTAGGG - Intergenic
924565812 1:245197249-245197271 TTGTTCTCCTAGAAGGCCCATGG - Intronic
1063103197 10:2969091-2969113 TTGTCCTCTTAGGAGGCGTGAGG - Intergenic
1066145524 10:32554038-32554060 TTGTGTACCTAGGAGGGTTATGG + Intronic
1067458593 10:46441004-46441026 GTGTCCTGGTAGGAGGGCTTTGG - Intergenic
1067628603 10:47943632-47943654 GTGTCCTGGTAGGAGGGCTTTGG + Intergenic
1069150523 10:64953956-64953978 TTGTGCACCTAGGAGGATTATGG + Intergenic
1070556448 10:77531608-77531630 TTGTTTTCCTTGGAGGGCTGAGG - Intronic
1074406036 10:113181043-113181065 GTGTCCTCCTGGGAGGGCCTGGG + Intergenic
1074575380 10:114663901-114663923 TTTTCCTCCTGGGAGAGCCACGG - Intronic
1075512502 10:123083872-123083894 TTGTCCTCATGGGAGTGCCACGG + Intergenic
1075733563 10:124650772-124650794 TTGGCCTCCTAGCAGGGCTGGGG - Intronic
1075917172 10:126178385-126178407 ATGTCCTCCAATGAGGACTAAGG - Intronic
1077148973 11:1060050-1060072 TTTTCCTCCTAGGAGAGCTGTGG - Intergenic
1082903895 11:58285368-58285390 TTGTGTTCCTAGGAGGATTATGG - Intergenic
1083710443 11:64545175-64545197 CTGTCCTCCTAGGAAGGCTCAGG + Intergenic
1084207474 11:67604386-67604408 TAGTCCTCCTAGGAGCCCTTTGG - Exonic
1085851181 11:80122131-80122153 TTTTCCTCCTAGGATTTCTAAGG - Intergenic
1089417497 11:118304600-118304622 TTGGCCTTCTAGGAAGGCTGTGG + Exonic
1093172553 12:15875968-15875990 TTGTATACCTAGGAGGGTTATGG - Intronic
1093488749 12:19681398-19681420 TTGTGTTCCTAGGAGGATTATGG + Intronic
1095187225 12:39214888-39214910 CTGATCTCCTGGGAGGGCTATGG - Intergenic
1096155459 12:49339162-49339184 TTGTCTTCCTCGGGGGGCTGAGG + Intergenic
1097107772 12:56635355-56635377 ATGGGCTCCTAGGAGGCCTAGGG + Intronic
1098001310 12:65946690-65946712 TTGTATTCTTAGGAGGGCTGAGG + Intronic
1101635282 12:106535488-106535510 TTGTGCACCTAGGAGGATTATGG + Intronic
1105314438 13:19244239-19244261 TTGTGTTCCTAGGAGGATTATGG - Intergenic
1107184816 13:37505780-37505802 TTGTCTACCTAGGAGGATTATGG - Intergenic
1107589552 13:41888083-41888105 TTTTCCTACTAAGAAGGCTAAGG - Intronic
1108911129 13:55552613-55552635 GTGTCCTCATAGGAAGGCAAAGG - Intergenic
1109215271 13:59582810-59582832 TTCTGCTTCTAGGAGGGCCAAGG - Intergenic
1110817948 13:79882333-79882355 TTGTCCTCCTCGCAGGGCGTGGG + Intergenic
1113576209 13:111396874-111396896 CTGTGCTCCTAGGAACGCTAAGG + Intergenic
1119862252 14:77944600-77944622 TTGGCCTTCTCAGAGGGCTATGG + Intergenic
1124233129 15:27964227-27964249 TTGTCCTCATAGGAGGAATATGG - Intronic
1124419122 15:29504070-29504092 CTGTACTCCTAGTAGGGCCAAGG - Intronic
1126558145 15:50013301-50013323 ATGTCCCCCTAGAAGAGCTATGG - Intronic
1127260523 15:57323581-57323603 TTTTCCTGCTGGGAGGGCTCAGG - Intergenic
1129879352 15:78996689-78996711 TGGTCCTCCCAGGAGGCCTTAGG - Intronic
1131229664 15:90650772-90650794 TTGGCCTCCAAGGTGGGATAGGG - Intergenic
1132210301 15:100017085-100017107 TTGTGTACCTAGGAGGGTTATGG + Intronic
1133613310 16:7453344-7453366 TTGTCCTCATAGTTGAGCTAGGG + Intronic
1133635569 16:7661857-7661879 TTGTCCTCCACTGTGGGCTATGG - Intronic
1136691189 16:32031701-32031723 TTGTCTTTCTAGGAAGTCTATGG - Intergenic
1136791777 16:32975262-32975284 TTGTCTTTCTAGGAAGTCTATGG - Intergenic
1136878040 16:33878668-33878690 TTGTCTTTCTAGGAAGTCTATGG + Intergenic
1137782602 16:51110376-51110398 TTGTCCCACTAAGAGGGCTCAGG - Intergenic
1142149850 16:88507840-88507862 GTATCCTCCCAGGAGGGCTGTGG - Intronic
1203093987 16_KI270728v1_random:1236722-1236744 TTGTCTTTCTAGGAAGTCTATGG - Intergenic
1143642179 17:8205383-8205405 TCTTCCTCCTGGGAGGGATAAGG + Exonic
1147564498 17:41528063-41528085 TCGTCCTCCTCGGGGGCCTACGG - Exonic
1148442621 17:47719649-47719671 TTGGCTTCCTAGGATGACTAAGG + Intergenic
1148664322 17:49362762-49362784 TTGTTCTCCTTGGAGGGCAGTGG + Intergenic
1150606071 17:66692067-66692089 TCCTCCTCCTGGGAGGGCTGTGG + Intronic
1151418461 17:73982157-73982179 TTGTCTCCCTAGGAGGCCTCCGG + Intergenic
1151485258 17:74395015-74395037 TGGTCCCCCTGGGAGGGATAGGG - Intergenic
1152540436 17:80971862-80971884 TTGTCCTCCCTGGAGGGCCCTGG - Intergenic
1154316007 18:13303840-13303862 TTCTCCTAGTAAGAGGGCTAAGG + Intronic
1158829748 18:61264086-61264108 TTGTGTACCTAGGAGGGTTATGG - Intergenic
1161478303 19:4498302-4498324 TTCTCCTCCACGGAGGGCTCTGG - Exonic
1165138212 19:33684153-33684175 TGGTGCTCCTAGTAGGGCTATGG + Intronic
925252627 2:2453002-2453024 TTGTACTCCTAGGATGACTTTGG - Intergenic
926224537 2:10957694-10957716 TTTCCCTCCTAAGAGGGCTCTGG + Intergenic
926857167 2:17269757-17269779 GTGTCCCCCTAAGAGGGCTTAGG + Intergenic
927802295 2:26112272-26112294 CTGACCTCCTAGGAGGGGAAGGG - Intronic
927825868 2:26309963-26309985 ATGTCCTCTGAGGAGGGCCATGG + Exonic
928196996 2:29223202-29223224 TTGTCCTCCTAGGAGGGCTAGGG + Intronic
931993007 2:67809735-67809757 TTGTGTACCTAGGAGGGTTATGG - Intergenic
932100669 2:68896660-68896682 TTGTGTACCTAGGAGGACTATGG + Intergenic
947745767 2:232506588-232506610 TGGCCCTCCCTGGAGGGCTAGGG - Intergenic
947760969 2:232603584-232603606 TTGTCATCCGAGGAGAGCGAGGG - Intergenic
1169401309 20:5282910-5282932 TTGTGTTCCTAGGAGGATTATGG - Intergenic
1170431087 20:16277636-16277658 TTCACATCCTGGGAGGGCTACGG - Intronic
1172115546 20:32571586-32571608 TAGGCCTCCTAGGAGGGGCAAGG - Intronic
1185247546 22:49781156-49781178 TTGGCCTCCTAGGAGGTCACTGG - Intronic
1185341335 22:50292612-50292634 CTGTCCTCCCAGGAGGGCAGGGG + Intronic
949297610 3:2544272-2544294 ATGTTCTCCAAGGAGGACTAAGG - Intronic
949604055 3:5634409-5634431 TTGTGTACCTAGGAGGGTTATGG + Intergenic
949814247 3:8041064-8041086 TTGTGTACCTAGGAGGGTTATGG - Intergenic
950739752 3:15040856-15040878 TTGTCCTCCTAGGAGGCCACAGG + Intronic
953962961 3:47281257-47281279 GTGTCCTCCTGGAAGGGCTGTGG - Intronic
954103816 3:48398393-48398415 TTGTCCTCCTCTGAGGCCTCAGG + Intronic
956263103 3:67366682-67366704 TTGTCATCCTATGAGTGCTCAGG - Intronic
958262992 3:91404189-91404211 TTGTGCACCTAGGAGGATTATGG + Intergenic
960575549 3:119226076-119226098 TTGGCCTCCTTGGATGGCCAAGG + Intronic
962865319 3:139443667-139443689 ATTTCCTCCTAGTAGGGCTTTGG - Intergenic
963122559 3:141788500-141788522 CTGTCCTCAGTGGAGGGCTAGGG + Intronic
965347931 3:167575272-167575294 CTGTCCTCCAAGAAGGGCTGTGG + Intronic
967399930 3:189049419-189049441 TTGTGTACCTAGGAGGACTATGG - Intronic
971158024 4:24103962-24103984 TTTTCCTCCTAGGAAGATTAAGG + Intergenic
973782395 4:54300705-54300727 TTGTGCACCTAGGAGGATTATGG - Intergenic
981745295 4:148046900-148046922 GTGTCCTCCTTGGAAGGGTAAGG - Exonic
982630547 4:157824374-157824396 TTATGCACCTAGGAGGACTATGG - Intergenic
985480487 5:107433-107455 TCTTCCTCCTAGGAAGGCCAGGG - Intergenic
985531383 5:435779-435801 TTATTCTCCTAGGATGGCAATGG - Exonic
986179499 5:5380342-5380364 TTGGCCTCCTCTGAGGGCTTTGG + Intergenic
990776233 5:59308964-59308986 TTGTGCACCTAGGAGGATTATGG + Intronic
994140863 5:96339718-96339740 TTGTCCTTGGAGGAGAGCTAAGG + Intergenic
994192758 5:96886519-96886541 ATGACCTCCTAGGGGGGCAATGG - Intronic
996678426 5:126202849-126202871 TTATTCTCCTAGGAGGTTTATGG - Intergenic
1008992416 6:57618698-57618720 TTGTGCACCTAGGAGGATTATGG - Intronic
1010057610 6:71584887-71584909 TCGTCCTCCTTGGGGGGCTACGG + Intergenic
1011893319 6:92194129-92194151 TTGTCTACCTAGGAGGATTATGG + Intergenic
1014061650 6:117078832-117078854 TTGTCCTCATGGGACTGCTAAGG - Intergenic
1015493205 6:133852519-133852541 GTGTGCTCCTGGGAAGGCTAAGG + Intergenic
1019428004 7:986459-986481 TGGTCCTCCCTTGAGGGCTAAGG + Intronic
1019769573 7:2875250-2875272 TTGTCCTCCTGGAAGCTCTAGGG + Intergenic
1020153305 7:5700833-5700855 TTGTCCTACTGGGAGGGCACTGG - Intronic
1020289775 7:6714556-6714578 TTGTCCTCCTAGGATGGGGTGGG - Intergenic
1023093737 7:36640045-36640067 GTGTCCTCCCGGGAGGTCTAGGG + Intronic
1023525810 7:41101673-41101695 TTGACCTCCTAGTAGTGCCAGGG + Intergenic
1023840847 7:44096719-44096741 ATATCCTCCCAGGAGGGCTGAGG + Intergenic
1023983928 7:45084585-45084607 ATGCCCTCCTGGGAGGGCTGAGG + Exonic
1025943490 7:66089597-66089619 TTGTCCTCCTGGGAGGCACATGG - Exonic
1035085588 7:156254799-156254821 GTGTCCTCACAGGATGGCTATGG - Intergenic
1038237074 8:25769471-25769493 TTGTGTTCCTAGGAGGATTATGG - Intergenic
1040068700 8:43171140-43171162 TTGTTCTTCTACCAGGGCTATGG - Intronic
1045672415 8:104571020-104571042 TTGTCATTCTAGAAGGGATATGG - Intronic
1050155639 9:2663917-2663939 TTGCCTTGGTAGGAGGGCTAGGG + Intergenic
1060411577 9:123403759-123403781 TTGGCCTCCTTGCAGGGCTGTGG + Intronic
1060807529 9:126587022-126587044 TGGGCCCCCCAGGAGGGCTAGGG + Intergenic
1062037439 9:134389053-134389075 TGGTCCTCCAAGGAGGGGTTTGG + Intronic
1187748372 X:22433615-22433637 TTGTGTACCTAGGAGGACTATGG - Intergenic
1188083298 X:25872517-25872539 CTGTGCTACTATGAGGGCTAAGG - Intergenic
1189413585 X:40794508-40794530 TTGTGTTCCTAGGAGGATTATGG - Intergenic
1190449692 X:50566121-50566143 ATGTTCTACTAGGAGGGCAAAGG + Intergenic
1192629962 X:72769681-72769703 TTGTTCTCCTAGGGTGGGTATGG - Intergenic
1192651748 X:72951123-72951145 TTGTTCTCCTAGGGTGGGTATGG + Intergenic
1195019486 X:100812479-100812501 TTGTGCACCTAGGAGGATTATGG + Intergenic