ID: 928200138

View in Genome Browser
Species Human (GRCh38)
Location 2:29242649-29242671
Sequence CTGTGTGACCTGAGGCAACA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 264
Summary {0: 1, 1: 0, 2: 3, 3: 27, 4: 233}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
928200134_928200138 -9 Left 928200134 2:29242635-29242657 CCCCGTTCTTCTGGCTGTGTGAC 0: 1
1: 0
2: 2
3: 25
4: 268
Right 928200138 2:29242649-29242671 CTGTGTGACCTGAGGCAACATGG 0: 1
1: 0
2: 3
3: 27
4: 233
928200132_928200138 14 Left 928200132 2:29242612-29242634 CCAAGTCATCTGCTGGTTCTTGT 0: 1
1: 0
2: 2
3: 14
4: 171
Right 928200138 2:29242649-29242671 CTGTGTGACCTGAGGCAACATGG 0: 1
1: 0
2: 3
3: 27
4: 233
928200129_928200138 23 Left 928200129 2:29242603-29242625 CCCAGGGCTCCAAGTCATCTGCT 0: 1
1: 0
2: 0
3: 3
4: 175
Right 928200138 2:29242649-29242671 CTGTGTGACCTGAGGCAACATGG 0: 1
1: 0
2: 3
3: 27
4: 233
928200130_928200138 22 Left 928200130 2:29242604-29242626 CCAGGGCTCCAAGTCATCTGCTG 0: 1
1: 0
2: 1
3: 18
4: 244
Right 928200138 2:29242649-29242671 CTGTGTGACCTGAGGCAACATGG 0: 1
1: 0
2: 3
3: 27
4: 233
928200135_928200138 -10 Left 928200135 2:29242636-29242658 CCCGTTCTTCTGGCTGTGTGACC 0: 1
1: 0
2: 0
3: 37
4: 261
Right 928200138 2:29242649-29242671 CTGTGTGACCTGAGGCAACATGG 0: 1
1: 0
2: 3
3: 27
4: 233

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
928200138 Original CRISPR CTGTGTGACCTGAGGCAACA TGG Intronic
900207599 1:1438267-1438289 CTGGGTGACCTGGGGCCACTAGG - Intronic
900317735 1:2067777-2067799 CTGTGTGACCAGATACAGCAAGG - Intronic
902395245 1:16128910-16128932 CTGTGTGACCTCAGGCAAGCCGG + Intronic
903541445 1:24098630-24098652 CTGAGTGACCAGGGGCAAAAAGG - Intronic
903731796 1:25501877-25501899 CTGGGTGACATGATGCAAAAGGG + Intergenic
904330957 1:29757549-29757571 CTGCGTGACCAGAGGCTCCAGGG + Intergenic
904406104 1:30289159-30289181 CTATGGGTCCAGAGGCAACAGGG - Intergenic
904412545 1:30333128-30333150 TTGTGTGACCTGGGGCAAGTCGG + Intergenic
906019600 1:42615692-42615714 CTGTGTGACTTTTAGCAACAAGG + Intronic
906233963 1:44191907-44191929 CTGTGCTACCAGATGCAACAAGG + Intergenic
909342775 1:74550271-74550293 CTGTGTGACCTGTGCAAACATGG + Intergenic
910434416 1:87190730-87190752 TTGTGTGACCTTAAGCAACAGGG + Intergenic
911711703 1:101081051-101081073 CTGTTTGGCCTGAGCCAACATGG + Intergenic
912934135 1:113988044-113988066 CTTTATGCCCTGAGGCCACAGGG + Intergenic
913370196 1:118090275-118090297 CTGTGTGACCTGATGTAACATGG - Intronic
913443010 1:118919142-118919164 CTGTGTTACCTGGGAAAACAAGG + Intronic
916426856 1:164689000-164689022 CTGCGTGGCCTGCGGCACCAAGG - Intronic
916923690 1:169495290-169495312 CTGTCTGATGTGAGGAAACAAGG - Intergenic
919777684 1:201205014-201205036 CAGTGTGACCTAAGGCAGCAAGG - Intronic
919927961 1:202202265-202202287 ATGTGTGCCCTGAGGGAAAAAGG - Intronic
920084308 1:203403903-203403925 CTGGGAGCCCTGAGGCTACAGGG - Intergenic
921539997 1:216402464-216402486 CTTTGCCACCTGAGACAACAAGG + Intronic
924520611 1:244802998-244803020 CTCTGGGACCTGAGGCGGCAGGG - Intergenic
1063073082 10:2686457-2686479 CTGTGTGTCTAGATGCAACATGG + Intergenic
1066233429 10:33461102-33461124 ATGTGTGACCTGATGCCACGTGG - Intergenic
1066696551 10:38084240-38084262 GTGAGTGACCTGAGTGAACAAGG + Intergenic
1067699118 10:48555920-48555942 CTCTGGCTCCTGAGGCAACATGG + Intronic
1067976350 10:51029862-51029884 CTGTGTAACCTGGGGCAAGTAGG + Intronic
1069685457 10:70315436-70315458 CTGTGTGACTTTCAGCAACAAGG - Intronic
1071491664 10:86140532-86140554 CTGTGTGACAGGAGCCATCATGG + Intronic
1072627852 10:97125332-97125354 CTGTGTGAGCCTGGGCAACATGG + Intronic
1073510548 10:104039991-104040013 CTGGGGGACCTGAGGGAAAAAGG + Exonic
1074533095 10:114310435-114310457 CTGGATGACCTGAGGCAAGAGGG + Exonic
1077083800 11:737411-737433 CAGTGAGACCAGAGGGAACACGG - Intergenic
1077365633 11:2160419-2160441 CTGGGTGACCTGGGGTCACAGGG - Intronic
1077793111 11:5462355-5462377 CTGTGTGAACTCAGGGAAGAGGG + Intronic
1078464028 11:11537193-11537215 CTGTGTGACTTTAGGCAAGCTGG - Intronic
1079021742 11:16914814-16914836 CTGTGTGATTTGAGGCAAGTTGG - Intronic
1081589337 11:44410093-44410115 CTGTGTGACCTGGGTCATGATGG + Intergenic
1083789908 11:64977771-64977793 ATGGGGGACCTGAGGCAAGAAGG - Intergenic
1085052426 11:73386762-73386784 CTAGGTGACCTGAGCCCACAGGG - Intronic
1085296359 11:75433932-75433954 GGGTGTGACCTGAGGGAAAAGGG - Intergenic
1086203132 11:84227328-84227350 CTGTGTGATCAGAGGGAATAAGG + Intronic
1089637663 11:119826510-119826532 CTGGGTGCCCAGAGGCAACATGG + Intergenic
1089784196 11:120896285-120896307 CTCTGTGACCTCAGGCAAGTTGG + Intronic
1095733749 12:45534524-45534546 CTCTGTGACCTCAGGCAAAGGGG + Intergenic
1095905382 12:47371934-47371956 CTTTGTCATCTGAGGCCACATGG - Intergenic
1096997893 12:55850620-55850642 CTGTTTGACCTGGGGTAAGAGGG + Intergenic
1099921601 12:88964511-88964533 CTGTGTGTCCAGGGGCAAGAAGG - Intergenic
1100613958 12:96216303-96216325 CTGTGTGACCTCAGCAAAGAGGG - Intronic
1101001325 12:100361116-100361138 CTGCATGACCTCAGGCAACTTGG + Intronic
1101590152 12:106118278-106118300 CTTTGTGACCTGTGGAAACTTGG - Intronic
1101737285 12:107472493-107472515 CTGTGTGACCTTAGGCAATTTGG + Intronic
1102462448 12:113108273-113108295 CTGCGTAAACTGAGGCAGCAAGG + Intronic
1104391181 12:128391716-128391738 CTGTGTGACCTAAAGCAAGGAGG - Intronic
1104657038 12:130581223-130581245 CTGTGTGACCTGGGACCACGGGG - Intronic
1109603052 13:64657989-64658011 CTGTGTGACCTCAGGATTCATGG + Intergenic
1109997941 13:70154342-70154364 CTTTATGACCTGAGGTAAGATGG - Intergenic
1110072238 13:71191649-71191671 CTGTGTGACCTGATTCTACCTGG - Intergenic
1113034946 13:106038308-106038330 CTTTGAGCCCTGAGGCAGCAGGG - Intergenic
1113549506 13:111181665-111181687 ATCTGTGCCCTGAGGCATCATGG + Intronic
1115961025 14:38836276-38836298 CTGTGTGTCCTGAGGCTGGACGG + Intergenic
1117949217 14:61064208-61064230 CTGGCTGACCTGAAGCCACATGG - Intronic
1117997327 14:61490026-61490048 CTGTGTGCCCAGGGGTAACATGG - Intronic
1119180806 14:72604158-72604180 CTGTGTGTCATGTGGCAACTAGG + Intergenic
1124021974 15:25933582-25933604 ATGTGTTAACTGAGGCCACATGG + Intergenic
1125065430 15:35479199-35479221 CTGTGTGACCAGAGGAAAACTGG + Intronic
1126705832 15:51404051-51404073 CTGTGCTAGCAGAGGCAACAGGG - Intronic
1126799634 15:52287340-52287362 CTGTGTAGCCCGTGGCAACAAGG - Intronic
1127405816 15:58644685-58644707 CTGTGTGTCCTGAGCCATCAGGG - Intronic
1127690916 15:61396452-61396474 GCGTGTGACCTCAGGCAGCACGG + Intergenic
1128803974 15:70517137-70517159 CTGTGTGACTTGGAGCAATAAGG + Intergenic
1129968538 15:79757813-79757835 CTGGGGGACCAGAGGCAGCACGG + Intergenic
1130628131 15:85537309-85537331 CTGTATTACCTCAGGCATCATGG - Intronic
1130854153 15:87826195-87826217 CTCTGTGATGTGAGGCAAGATGG + Intergenic
1132522961 16:399881-399903 CTGTGTGCCCTGGGAGAACACGG - Intronic
1132565368 16:620004-620026 CTGTGAGAACTGGAGCAACATGG + Intronic
1132669661 16:1097360-1097382 CTGTGTCACCACAGCCAACAGGG - Intergenic
1133468628 16:6052303-6052325 CTGCGTGACCTTGGGCAAAATGG - Intronic
1134191061 16:12121533-12121555 CTGAGTCACCTTAGGCTACAGGG + Intronic
1135105495 16:19645765-19645787 CTGGGTGACCTGAGTCAGGAGGG + Intronic
1137248961 16:46729358-46729380 CTGTGGGGCCTGGGGCAAGAAGG - Intronic
1138270699 16:55693896-55693918 CTCTGAGACCAGAGGAAACATGG - Intronic
1138655344 16:58488123-58488145 CTGTGTGACCTTGGCCAACTGGG - Intronic
1138865219 16:60810041-60810063 ATGTGTGAACTGTGGCAAGAGGG + Intergenic
1139592240 16:67939776-67939798 CTGTGTGCAGTGAGGCAAGATGG - Exonic
1141028604 16:80569659-80569681 GTCTGTGACCTGAGCCATCATGG - Intergenic
1141113480 16:81289085-81289107 GTGTGTGACCTTGGGCAAAAAGG - Intronic
1142238905 16:88936176-88936198 ATGTGTGACCTGGGGCCACCAGG + Intronic
1143275085 17:5704331-5704353 CTGTGTGACCCTGGACAACATGG - Intergenic
1143978492 17:10847481-10847503 CTTTGTGCCCTGAGGCAGTATGG - Intergenic
1145266575 17:21382663-21382685 CTGTCTTTTCTGAGGCAACATGG - Intronic
1147911769 17:43860300-43860322 CTATGTGAGCTATGGCAACAGGG - Intronic
1149426355 17:56558241-56558263 CTGTGCCAGCTGAGGCTACAGGG + Intergenic
1153952129 18:10066736-10066758 CTGTGTGACTTTAGACTACACGG - Intergenic
1155560746 18:27073548-27073570 CAGTGTGACCAGAGGGAAGATGG + Intronic
1156712274 18:39961474-39961496 CTGTGTGACCTGAAAATACAAGG - Intergenic
1158013660 18:52758711-52758733 TTGAGTGACCTGAGGCAATGTGG - Intronic
1159465621 18:68779346-68779368 CTATGTGGCCTTAAGCAACATGG - Intronic
1162153268 19:8660178-8660200 CTGTGTGACCCTAGGCAAGTCGG + Intergenic
1162795828 19:13087168-13087190 CTGTGTGTCCTGAAGCCAGAAGG + Intronic
1163311078 19:16514902-16514924 CTGTGTGACCTCAGACTAAAGGG + Intronic
1163528579 19:17836169-17836191 CTGTATGAACAGAGGCAGCAGGG - Intronic
1165358093 19:35316450-35316472 CTGTGTGACTTAAGGTCACAGGG + Intergenic
1165719956 19:38072110-38072132 CTGTCTGACTTGAGGTAAGAAGG + Intronic
1166152419 19:40883719-40883741 CTGTGTGACCTCACTCAAGAGGG - Intronic
1167339107 19:48904333-48904355 GCCTGTGTCCTGAGGCAACAAGG - Exonic
925166593 2:1719418-1719440 CTGTGTGCCTTGAGGGTACATGG + Intronic
925464794 2:4097440-4097462 CTGTTTGACCTCAGGCAAGCTGG + Intergenic
927265220 2:21139680-21139702 CTGTGGGACCTGAGTCATCCTGG + Exonic
927416892 2:22889404-22889426 GTGTGTGACCTGTGCAAACAAGG - Intergenic
927918142 2:26949637-26949659 ATGTGTGACCCGTGGCACCAGGG + Exonic
928200138 2:29242649-29242671 CTGTGTGACCTGAGGCAACATGG + Intronic
928885505 2:36143707-36143729 CTGTGAGACTGGGGGCAACAGGG - Intergenic
930593660 2:53358581-53358603 CTGTGTGAACTGAGACTTCAAGG - Intergenic
930948342 2:57105292-57105314 CTGTGAGAGCAGAGGCCACAGGG + Intergenic
931224115 2:60314676-60314698 CAGAGAGACCCGAGGCAACATGG - Intergenic
931994789 2:67829595-67829617 CTGTGTGACCTTGGGCAGGAAGG - Intergenic
932186833 2:69704550-69704572 CTGTGTCAGCTGGAGCAACAGGG + Intronic
932309985 2:70732022-70732044 CTGTGGGACCTGATGCCCCAAGG + Intronic
933024479 2:77237825-77237847 ACTTGTGCCCTGAGGCAACAGGG - Intronic
934050922 2:88210185-88210207 CACTGTGACCTGTGGCAGCAGGG + Intergenic
934513598 2:94969068-94969090 CTGTTTGACATCAGGCAACAAGG - Intergenic
934967881 2:98738619-98738641 CGGTGTGAACAGAGGCATCATGG + Intergenic
935638847 2:105271569-105271591 CTGTGTGACCTGTGGCAAGCGGG + Intronic
936154479 2:110039427-110039449 CTGTGTGTCCTGTTTCAACAAGG + Intergenic
936190203 2:110331987-110332009 CTGTGTGTCCTGTTTCAACAAGG - Intergenic
937066515 2:119022124-119022146 CTGTGTGACTTCAGGCAAGCTGG - Intergenic
937211330 2:120273690-120273712 CTGTAAGACCAGAGGCAAGATGG + Intronic
937813128 2:126220914-126220936 CTGTGAGACCTCAGGCACTAGGG + Intergenic
938065682 2:128280855-128280877 GTGTGTGTCCTGAGGCAAGAGGG - Intronic
938174492 2:129112345-129112367 CAGGGTGGCCTGAGGCAAGATGG + Intergenic
939539135 2:143472098-143472120 TTGTGTGTCCTAAGGCTACATGG + Intronic
940105235 2:150091857-150091879 CTATGTAACCTGAGTCTACATGG - Intergenic
941288691 2:163647557-163647579 CTGTGTGATCTGAGGCCAGGTGG - Intronic
942214815 2:173708441-173708463 CTGTGTGACCTTAGACAATTTGG - Intergenic
942849872 2:180471918-180471940 CTGTGTCACCTGAAGCACCAGGG + Intergenic
943114366 2:183648234-183648256 CTGTGTCATCTGAGTCAACCAGG - Intergenic
943247350 2:185473078-185473100 CAGAGGGGCCTGAGGCAACAGGG - Intergenic
943472690 2:188314476-188314498 CTGTGTGACCTTGGGCAAGTGGG - Intronic
943744923 2:191452265-191452287 CTGTGAGGCCTGAGGAAAGAAGG + Intergenic
946365378 2:219245714-219245736 CTGTGTGTCCTGAGGCCGTAAGG + Intronic
947788338 2:232845105-232845127 CTGTGTGACCTTGGGCAAGAGGG + Intronic
948040238 2:234895879-234895901 CAGCCTGACCTGAGTCAACATGG + Intergenic
948672342 2:239576526-239576548 CTGAGTGACCTGGGGAAACAGGG - Intergenic
1171089623 20:22271619-22271641 ATGTGTGTCTTGAGACAACATGG + Intergenic
1171215062 20:23346343-23346365 CTGTGTGAGCTCAGGCTAAATGG - Intergenic
1171387494 20:24780087-24780109 CTGTGTGTCATGAGGCATCAGGG + Intergenic
1172944787 20:38678789-38678811 CTGTGTGACCACAGGATACAGGG + Intergenic
1174051155 20:47768534-47768556 CTGTGTGAACAGAGGCCTCAGGG + Intronic
1174385865 20:50188465-50188487 CTGTGTGACCTTAGGCAAAATGG - Intergenic
1175966713 20:62663491-62663513 CGGTGTGAGCAGAGGCGACATGG + Intronic
1178503313 21:33143551-33143573 CTGTGTGACCTTGGGCAAAGAGG - Intergenic
1180010058 21:45043613-45043635 CTCTGAGACCTGGGGGAACAGGG + Intergenic
1180021459 21:45130713-45130735 CAGTGCGACCTGTGGCTACACGG - Intronic
1180166083 21:46030226-46030248 CACTGTCACCTGAGGGAACATGG + Intergenic
1182042310 22:27247898-27247920 CTGTGAGTCCTGAAACAACATGG - Intergenic
1182060546 22:27394078-27394100 CATTGTGACCTCAGGCAATATGG - Intergenic
1182151610 22:28031154-28031176 CTGTGTGCCCTGATGACACACGG + Intronic
1182795190 22:32986671-32986693 CTGTTTGACCTCAGGCAAAATGG + Intronic
1183214848 22:36472960-36472982 CTGGGTGTCCTGAGCCGACATGG - Intronic
1183427008 22:37745657-37745679 CTGTGTGACCTCGGGCAAATCGG + Intronic
1184174562 22:42780440-42780462 ATGTGTCCCCTGGGGCAACATGG - Intergenic
1184567477 22:45300739-45300761 CTGTGTGATCTGGGGCAAGGAGG + Intergenic
949290665 3:2461844-2461866 CTGTGTGACCCTAAGCAACTTGG - Intronic
949847849 3:8390100-8390122 CTCTGTTAACTGAGGGAACAGGG + Intergenic
950298463 3:11852572-11852594 CTGTGTGACCTGGTGCAAGTTGG + Intergenic
950372339 3:12541778-12541800 CTCTGTGAGCTGAGGCTACACGG + Intronic
950677195 3:14561447-14561469 CTGTGTGACCTTTGACAACAGGG - Intergenic
951081602 3:18456390-18456412 CTGTGTGAACTGAGGAGGCAGGG - Intergenic
951712038 3:25592898-25592920 CCGTGTGATCAGAGGCATCATGG + Intronic
952282259 3:31935181-31935203 CTGTGTCACCTTTGGCAACAGGG + Intronic
954234382 3:49244978-49245000 CTACCTGCCCTGAGGCAACATGG - Intronic
955388771 3:58503036-58503058 CTGTGTGCCCTGGGGCAAGCAGG + Intergenic
955878491 3:63519501-63519523 TTAGGTGAGCTGAGGCAACAAGG - Intronic
957552905 3:81730090-81730112 CTGTGTTACATGACACAACAGGG + Intronic
957602938 3:82361291-82361313 CTTTGGGATTTGAGGCAACATGG + Intergenic
957967299 3:87338895-87338917 CTGTGTGACCCAAGGCAAATTGG - Intergenic
960978692 3:123201839-123201861 CTGGGTGAGCTGAGGGAACGGGG + Intronic
961125583 3:124414777-124414799 CTGAGGAACCTGAGCCAACAAGG - Intronic
962568280 3:136686347-136686369 ATGTGGGACCAGAGACAACAAGG - Intronic
962850993 3:139308294-139308316 CTGTGTGTCCTCAGGCTGCAAGG - Intronic
966139389 3:176737842-176737864 CTGTGTTAACTGTGGCACCATGG + Intergenic
966643068 3:182211764-182211786 GTGTGTGACCTTAGGCAAGCTGG + Intergenic
969316026 4:6381724-6381746 CTGAGTGACCTGAAGAAACATGG - Intronic
970676622 4:18457777-18457799 CTGTGTGACCTGGGGCAAATGGG - Intergenic
973583597 4:52369667-52369689 CTGTTTGAGCTGTGGCCACATGG - Intergenic
976911616 4:90313767-90313789 TTGTGAAACCTGAGGCCACATGG - Intronic
977647354 4:99428535-99428557 TTGTGGGACATGAGGCAACTGGG - Exonic
979269814 4:118746465-118746487 TTGTGTGACCTGGGGCAAATTGG - Intronic
988624157 5:32853007-32853029 CTTTGTGACCTGAGGAAATGTGG - Intergenic
989135381 5:38149305-38149327 CTGTGTGATCTTAGGCAACAAGG - Intergenic
993049674 5:82912176-82912198 CTGTGTGTGGTGAGGCAACTGGG - Intergenic
994763371 5:103884694-103884716 CTATGTGACCAGAGGCATCTCGG + Intergenic
994796169 5:104302508-104302530 CTGTGTGAACAGAGGAAGCATGG - Intergenic
996511154 5:124317546-124317568 CTCAGTGACCTGAGGCACCCTGG + Intergenic
1000292680 5:159885324-159885346 CAGTTTCACCTGAGGCTACATGG - Intergenic
1000942829 5:167383430-167383452 CTGTGGGACTTGAGAAAACATGG - Intronic
1001348001 5:170925322-170925344 CTGTGTGACTTAACGCAAGATGG - Intronic
1002428832 5:179191529-179191551 CAGTGTGACCTAAGGAAAGAGGG + Intronic
1003772827 6:9326049-9326071 CTGTATTACATGATGCAACATGG - Intergenic
1004740654 6:18457213-18457235 CTGGGTCACTCGAGGCAACAGGG - Exonic
1005228540 6:23671845-23671867 ATCTGTGTCCTGAGGCTACAAGG + Intergenic
1006454283 6:34123086-34123108 CTGTGTGACCTTGGGTAACGTGG - Intronic
1006934974 6:37710992-37711014 TTGTGTGGCCTGAGACACCAGGG - Intergenic
1007694782 6:43725266-43725288 CTCAGTAACCTGATGCAACAGGG + Intergenic
1007734261 6:43970850-43970872 CTTTGTGACCTGAGTCCACTGGG + Intergenic
1009681761 6:66902675-66902697 CTGTATGACCATAGGCAGCACGG - Intergenic
1009935184 6:70225370-70225392 CTGTGTCAACTGAGGTGACAGGG - Intronic
1012491142 6:99783664-99783686 CTGTGTGGCCTGAGGCCTGAAGG + Intergenic
1013360520 6:109390023-109390045 CAGTGTGACCTGAGGAACCTGGG + Intergenic
1016507009 6:144793866-144793888 ATGTGTGACCAGAGGCAGCTGGG + Exonic
1019257227 7:60153-60175 CTGAGGGACCTGAGTCAACAAGG + Intergenic
1020041363 7:5005125-5005147 CTGTGTCAGCTGGAGCAACAGGG + Intronic
1020600075 7:10263482-10263504 CAATGTGACTTGAGTCAACATGG + Intergenic
1024867297 7:53918786-53918808 CTGTGTCACCTGTGGGATCAGGG - Intergenic
1027950093 7:84804300-84804322 CTGAGTGAAATGAGACAACAAGG + Intergenic
1029612379 7:101633929-101633951 CTGTGTGTCCTTGGGCCACAGGG - Intergenic
1033260351 7:139838790-139838812 CTCTGTGAACTGGGGCATCAGGG + Intronic
1033511595 7:142065214-142065236 CTGCGTGACTGGAGGGAACATGG - Intronic
1035204951 7:157289277-157289299 CTGTGTGAACTGAGGGAAGTCGG - Intergenic
1037453807 8:19043739-19043761 CTGTGTCATCTGTGGCAAAAGGG - Intronic
1037643291 8:20768329-20768351 CTGTGTTATCTGAGTCAATAGGG - Intergenic
1039006092 8:33038770-33038792 CTGTCTAACCTTAGCCAACAGGG + Intergenic
1039839694 8:41284916-41284938 GTGTCTGACCTGAGGGAAGAAGG - Intronic
1040697753 8:50022749-50022771 CAGTGGGAACAGAGGCAACATGG - Intronic
1040834418 8:51717647-51717669 GTGTGTGACCAGAGACCACAGGG + Intronic
1041159055 8:55018583-55018605 CAGTGTGAGCGGAGGCCACATGG + Intergenic
1042003864 8:64158737-64158759 CTGTGTGACTTTTGGCAACAAGG - Intergenic
1043980071 8:86627752-86627774 TTGTGTGCCCTGAGGCAGGATGG + Intronic
1044083963 8:87920801-87920823 CTGTGTAACGTGGGGCAACTGGG + Intergenic
1044834696 8:96284956-96284978 CTCTGTGCCCTGAGGCCACCAGG + Intronic
1045835182 8:106512184-106512206 CTGTGTGACCTTGGGCAATTGGG - Intronic
1047171798 8:122500895-122500917 ATGTGTGAGCAGGGGCAACAGGG - Intergenic
1048344218 8:133565022-133565044 CTGTGTGGCCTTAGGCAAGGGGG + Intronic
1049905460 9:212735-212757 CAGTATGATCTGAGGCAAGATGG + Intergenic
1050022073 9:1294548-1294570 CTGCCTGCTCTGAGGCAACAGGG - Intergenic
1050719682 9:8572412-8572434 CTTTCTGACCTGAGTCCACAGGG + Intronic
1052017829 9:23490104-23490126 ATTTGTCAACTGAGGCAACATGG + Intergenic
1055630062 9:78214677-78214699 CCTTGTGAGCTGTGGCAACAAGG + Intergenic
1056607521 9:88098734-88098756 CTGGGTGTCCTGAGGAAACCTGG - Intergenic
1057328395 9:94088613-94088635 CTGTGTGATCTTAGGCAAACAGG - Intronic
1057780286 9:98044307-98044329 CTGGGTGACCGGGGGCCACATGG - Intergenic
1060640562 9:125234977-125234999 CTGTGTACCCTGGGGCAATAGGG - Exonic
1060970119 9:127733020-127733042 CTGTGTTTCCTCAGGCAGCATGG - Intronic
1061077290 9:128349363-128349385 CTGTGGGAACTGAGGCTCCAAGG - Intronic
1061679770 9:132237255-132237277 CTGTGTGATTTGAGGCCAGAGGG + Intronic
1185608558 X:1380745-1380767 CTCAGTGACCTGAGGCACCAGGG + Intronic
1187125269 X:16448630-16448652 CTGTGTGACCTTGGGCAAGGTGG + Intergenic
1187720362 X:22144051-22144073 CTATGGGACCTCAGGCAAGATGG + Intronic
1187722081 X:22161634-22161656 CTATGTTACCTGTGGTAACATGG + Intronic
1188031187 X:25266040-25266062 CTGTGAGGCCTGAGGCAAAAGGG - Intergenic
1189586279 X:42465365-42465387 CTGTGTGAGTTAAGGCAAAATGG + Intergenic
1189698748 X:43694290-43694312 CTGTGGGTCCGGAGGCTACAGGG + Intronic
1190248176 X:48704525-48704547 CTGTTTGAGCTGATGCCACAAGG + Intronic
1190642418 X:52493546-52493568 ATGAGAGACCTGAGGTAACAAGG - Intergenic
1190645255 X:52519321-52519343 ATGAGAGACCTGAGGTAACAAGG + Intronic
1193836071 X:86345673-86345695 CTGTGTGACTTGAGGCTGCATGG - Intronic
1196174630 X:112627356-112627378 GCGTGTGACCTGAGCCAAGATGG - Intergenic
1196570414 X:117260378-117260400 CAGTGTGTCTTGAGGCAGCATGG - Intergenic
1199575133 X:149306634-149306656 CTGTGTCACCAGAGGGCACATGG + Intergenic
1200213418 X:154356885-154356907 CTGCGTGGGCTGAGGGAACAAGG - Intronic
1200246702 X:154530365-154530387 TGGTGAGACCTGTGGCAACAGGG - Intergenic
1200845134 Y:7824471-7824493 CTGTTTGGACTCAGGCAACAGGG - Intergenic