ID: 928200391

View in Genome Browser
Species Human (GRCh38)
Location 2:29244235-29244257
Sequence GGGCCTTGCCCAGGATCCCA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 435
Summary {0: 1, 1: 0, 2: 3, 3: 53, 4: 378}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
928200391_928200397 17 Left 928200391 2:29244235-29244257 CCGTGGGATCCTGGGCAAGGCCC 0: 1
1: 0
2: 3
3: 53
4: 378
Right 928200397 2:29244275-29244297 GTTTCCTCATTTGTGAAATCAGG 0: 1
1: 18
2: 393
3: 2019
4: 6457
928200391_928200399 21 Left 928200391 2:29244235-29244257 CCGTGGGATCCTGGGCAAGGCCC 0: 1
1: 0
2: 3
3: 53
4: 378
Right 928200399 2:29244279-29244301 CCTCATTTGTGAAATCAGGATGG 0: 1
1: 1
2: 8
3: 77
4: 435
928200391_928200400 26 Left 928200391 2:29244235-29244257 CCGTGGGATCCTGGGCAAGGCCC 0: 1
1: 0
2: 3
3: 53
4: 378
Right 928200400 2:29244284-29244306 TTTGTGAAATCAGGATGGTGAGG 0: 1
1: 0
2: 2
3: 19
4: 256

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
928200391 Original CRISPR GGGCCTTGCCCAGGATCCCA CGG (reversed) Intronic
900193259 1:1360300-1360322 GTTCCTTGCCCAGGGCCCCATGG - Intronic
900409351 1:2505842-2505864 GGGCCTGGCGCAGGCTCCGACGG - Intergenic
901800356 1:11704829-11704851 GGCCAGGGCCCAGGATCCCAGGG + Intronic
902329891 1:15726109-15726131 GGGCCATGTCCAGGCTGCCAGGG + Intronic
902479486 1:16704233-16704255 GTGGCTTGGCCAAGATCCCACGG - Intergenic
902559387 1:17267485-17267507 GGGGCTTGTCCAGGGTCACAGGG + Intronic
903143757 1:21356405-21356427 GGGACTTGCCCAAGACCACAGGG - Intergenic
903180731 1:21603581-21603603 GGGACTGGGCCAGGGTCCCAGGG + Intronic
903418938 1:23204503-23204525 GTGACTTGCCCAAGATCACATGG + Intergenic
903839090 1:26225525-26225547 GGACTTTGCCCAAGACCCCAGGG - Intergenic
903982762 1:27201626-27201648 GGACCTTGTCCAGGATACCAAGG - Intergenic
904528109 1:31149781-31149803 GGCTCTTGCCCATAATCCCAGGG - Intergenic
905036013 1:34918746-34918768 GGGCCCTGGCCAGGGTCCTAGGG - Intronic
905770270 1:40633265-40633287 GGGACGTGCCCAGGGCCCCAGGG - Intronic
906318696 1:44803842-44803864 TGGCCCTGCCCTGGCTCCCAGGG - Intronic
906415950 1:45621629-45621651 GGGCCTCACCCAGGATCATAGGG + Exonic
906539485 1:46574242-46574264 GTGACTTGCCCAAGATCACATGG + Intronic
906584746 1:46966285-46966307 CTGCCTTGCCAAGGATCCCAGGG + Intergenic
906805349 1:48775349-48775371 GAGACTTGCCCAGGGTCTCATGG - Intronic
907490245 1:54804864-54804886 GTGACTTGCTCAAGATCCCACGG + Intergenic
909428158 1:75552139-75552161 GTGGCTTGCCCAAGATCACAGGG - Intronic
911143740 1:94532879-94532901 GGGCCCTGCCCAGAGTCACAGGG + Intronic
914843035 1:151264100-151264122 GGTCCTAGCTCAGGATTCCAGGG - Intronic
915634085 1:157174276-157174298 GGGCCTTTCCCAGGTTCAAAAGG + Intergenic
915964300 1:160293114-160293136 GTGCCTAGCCCAGGGTCCCCGGG - Intronic
916217395 1:162409161-162409183 AGACCTTGGCCAGGATCTCAGGG - Intronic
917188552 1:172388788-172388810 GGGCCCCGCCCAGTGTCCCAAGG + Exonic
918031570 1:180818430-180818452 GTTCCTTGCCCAGGATCACAAGG - Intronic
919785182 1:201254165-201254187 GGGCCTTGCCCTGAGTCCCACGG + Intergenic
920052696 1:203173223-203173245 GGGCCTTCCCCAGGGAACCAGGG - Intronic
920302668 1:204998381-204998403 GGGACTTGCCCAGGAGACAAAGG - Intronic
921384387 1:214553810-214553832 GTGCCTTGATCAGGGTCCCAAGG - Intergenic
921927279 1:220721890-220721912 TGGCCTTGGCCAGGGCCCCACGG - Intergenic
922719109 1:227891340-227891362 CGGCCTTGCCCAGCCTCCCACGG - Intergenic
922820224 1:228479478-228479500 GGGACATCCCCAGGCTCCCAGGG + Intergenic
1062835897 10:635518-635540 GGCCCTCGCCCAGGCCCCCATGG - Intronic
1063522145 10:6750743-6750765 GGGCTTAGCCCAGGAGTCCATGG + Intergenic
1064186751 10:13168465-13168487 GGGGCTTGTTCAGGATCACATGG - Intronic
1065060838 10:21899261-21899283 CTGCCTTGCCAGGGATCCCAGGG - Intronic
1066476207 10:35749617-35749639 GGGCCTTGCCCAGCAGCTGAGGG - Intergenic
1066653406 10:37679988-37680010 GGGGTTTGCCCAGGAGACCAGGG - Intergenic
1067037774 10:42932527-42932549 GGGGTTTGCCCAGGAGACCAGGG - Intergenic
1067296598 10:44978356-44978378 TGGCCTTGCCAAAGGTCCCATGG - Intronic
1069211075 10:65760691-65760713 GGGCCAGGCCCAGGGTCCCCAGG - Intergenic
1070439525 10:76429768-76429790 GGCCCCTGCCCAGGCCCCCATGG - Intronic
1070567804 10:77616912-77616934 GTGGCTTGCCCAAGATCCAAAGG + Intronic
1072404158 10:95133897-95133919 GGGGTGTGTCCAGGATCCCAAGG - Intergenic
1074165031 10:110867540-110867562 GTACCTTGCTCAGCATCCCAGGG + Intergenic
1074183323 10:111081707-111081729 GCGACTTGCTCAGGATCCCAAGG + Intergenic
1074979772 10:118610131-118610153 GGGGCTTCCCAAGGAGCCCAGGG + Intergenic
1075050266 10:119178444-119178466 GGCGCTTGCCCAAGATCACAGGG + Intronic
1075737995 10:124675819-124675841 GGGCCTTGCCCAAAGTCACATGG - Intronic
1076083028 10:127600526-127600548 AGCCCTTGCTCAGGCTCCCATGG - Intergenic
1076391945 10:130110137-130110159 GAGACTTGCACAAGATCCCAGGG - Intergenic
1076628866 10:131840673-131840695 GGGCTGTGCCCAGGACACCAGGG + Intergenic
1077106472 11:844558-844580 GGGCCAGGCCCAGGCTCCCCAGG - Exonic
1077284293 11:1758933-1758955 GGGCCTTTCCCAGGACTCGAGGG - Intronic
1077878593 11:6328781-6328803 GGGGCTTGGCCATGATTCCATGG + Intergenic
1077894345 11:6442683-6442705 TGGCATTGCCCAGGCTGCCAAGG - Intergenic
1079356636 11:19735365-19735387 AGGCCCTGCCTAGGATGCCAAGG - Intronic
1080152274 11:29066955-29066977 GTGCCTTGCCACTGATCCCACGG + Intergenic
1080396676 11:31896533-31896555 GTGCCTTGTCCAGGGCCCCAGGG + Intronic
1081613394 11:44576861-44576883 GGGAGTTGCCCAGGATCCCGTGG + Intronic
1081933236 11:46887091-46887113 GAAACTTGCCCAGGATCCCATGG + Intronic
1083365370 11:62138841-62138863 GGGTCTTGACCTGGAACCCAAGG - Intronic
1083609383 11:63997929-63997951 GGGACTTGCCCAGGGTCCCAGGG + Exonic
1083736543 11:64684909-64684931 TGGGCTTGCCCAGGAGCCAAGGG + Intronic
1083741819 11:64715291-64715313 GGGACTTGCCCAAGGTCACACGG + Intronic
1083805315 11:65070105-65070127 GGGCCCTTCGCAGGACCCCACGG - Intronic
1084269724 11:68022482-68022504 GGCTCTAGGCCAGGATCCCAAGG - Intronic
1085108748 11:73868710-73868732 TGGCCATTCCCAGGATTCCATGG - Intergenic
1085158884 11:74322787-74322809 GGGCTCTGCCCAGGCACCCAGGG + Intergenic
1085385123 11:76153163-76153185 GGGCCTTGCCCTGGGGCACAGGG - Intergenic
1085525743 11:77162503-77162525 TGGCCTGGCCCAGAACCCCATGG - Intronic
1086931150 11:92694640-92694662 GCTCCTTGCCCAGGGTCACATGG - Intronic
1088625986 11:111731182-111731204 GGCCCTTGCCCAGGCTACCTGGG - Intronic
1088694530 11:112355509-112355531 GTGACTTGCCCAGGGCCCCAGGG + Intergenic
1089175777 11:116547854-116547876 GGGGCTTGGCCAGGGACCCAGGG - Intergenic
1089462782 11:118662535-118662557 AGGCCTGGCCCAGGAGCTCAGGG + Intronic
1089466797 11:118690808-118690830 AGGCCTGGCCCAGGAGCTCAGGG - Intergenic
1089633025 11:119795122-119795144 GGGCCCTTTCCAGGGTCCCATGG - Intergenic
1090292218 11:125555272-125555294 GGACCTTGCCTGGGATACCAAGG - Intergenic
1090412757 11:126520363-126520385 GAGCCCTGGCCAGGAGCCCATGG + Intronic
1090415990 11:126540859-126540881 GGGGCTTAGCCAGGGTCCCATGG - Intronic
1090802265 11:130180286-130180308 GGTCCCTCCCCAGGATTCCAAGG + Intronic
1091684659 12:2553139-2553161 GTGCTTTGGCCAAGATCCCAGGG - Intronic
1091797832 12:3307408-3307430 AGGCCTGGGCCAGGATCACATGG - Intergenic
1091950703 12:4590819-4590841 GTGACTTGCCCAGGAGCACATGG - Intronic
1092887611 12:12938697-12938719 GGGACTTGCCCAGTATAACATGG - Intergenic
1095303519 12:40614357-40614379 CTGCCTTGCCAGGGATCCCAGGG + Intergenic
1098146743 12:67505199-67505221 GTCTCTTGCCCAAGATCCCACGG + Intergenic
1098954099 12:76670653-76670675 GGAACTTGCCCAAGATCACAGGG - Intergenic
1100461192 12:94800838-94800860 GCGACTTGCCCGAGATCCCATGG - Intergenic
1101253965 12:102959176-102959198 TGGCCTTGCCCAGGTCTCCAAGG + Intronic
1101952452 12:109187221-109187243 GGGCCCTGCCCAGGATGCCCTGG + Intronic
1101985462 12:109442623-109442645 GTGACCTGCCCAGGATCTCACGG - Intronic
1102565477 12:113794701-113794723 GGGCCTTGGCCAGAGTTCCATGG + Intergenic
1102716341 12:114976247-114976269 GGGGCTTGCTCAGGGTCACATGG + Intergenic
1103165115 12:118763712-118763734 GAGACTTGCCCAGGGTCACATGG + Intergenic
1103933423 12:124462630-124462652 GGGCCTGGCCCAGGATGCTGAGG + Intronic
1104044877 12:125154640-125154662 GGAACTTGCCCAAGATCCCATGG + Intergenic
1104582085 12:130018393-130018415 GGGCCTTGCCCTGGAGCTAATGG + Intergenic
1105290613 13:19050809-19050831 GGGCCTTGCACAGGAGCCAGTGG - Intergenic
1107567680 13:41622744-41622766 GGGCCTTGCCCAGAATTACAGGG - Intronic
1107888152 13:44891615-44891637 CGGCCTAGCCCAGGGTCCCACGG + Intergenic
1113993188 14:16045191-16045213 GGGCCTTGGGCAGGCTCACAAGG - Intergenic
1115868973 14:37778794-37778816 TGGCCTCTCCCAGGACCCCAGGG - Intronic
1115884901 14:37960194-37960216 GGGTCTTGCCTAGGATCACATGG + Intronic
1117457597 14:55913473-55913495 GTGACTTGCCCAAGATCTCACGG + Intergenic
1117985418 14:61381773-61381795 GAGTCTTGCCCAGGCTCCCAGGG + Intronic
1119478794 14:74947106-74947128 GTACCTTGCCCTGGCTCCCAAGG - Intronic
1120386137 14:83848257-83848279 GGAACATGCCCAGGAGCCCAGGG + Intergenic
1121423709 14:93833420-93833442 GGGCCCTGCACAGGCCCCCATGG - Intergenic
1121507143 14:94485973-94485995 GGGCTGAGCCCAGGAGCCCAGGG - Intergenic
1121540808 14:94724842-94724864 GGAACTTGCCCAGGGTCCCATGG + Intergenic
1122421068 14:101577770-101577792 GGACCTTCCCCAGGAGCACAAGG + Intergenic
1122814879 14:104307453-104307475 GGGCCGTGACCAGGCTCCCCAGG + Intergenic
1122820596 14:104342930-104342952 GGTCCAAGCCCAGGACCCCATGG - Intergenic
1122919726 14:104875030-104875052 GGGCCTTCCCCAGCACCCCTGGG - Intronic
1123203786 14:106692430-106692452 GGGCATTGCTCAGGATCACCAGG - Intergenic
1123208815 14:106738937-106738959 GGGCATTGCTCAGGATCACCAGG - Intergenic
1124019168 15:25903834-25903856 GGTCCTGGCCAAGTATCCCATGG + Intergenic
1124371508 15:29107075-29107097 GGCCCTTGCCCAGGGCCACATGG - Intronic
1124396991 15:29310633-29310655 GGGCCAAGCCCAGGAGCACAAGG + Intronic
1124713012 15:32030682-32030704 GGGATGTGCCCGGGATCCCACGG - Exonic
1125423669 15:39529110-39529132 GGGCTCTGCACAGGAACCCAGGG + Intergenic
1125518151 15:40334387-40334409 GGGCCTGGCCCTGCAGCCCAGGG - Exonic
1126100027 15:45113293-45113315 GGGTGTTCCCCAGGATCCCTGGG - Intronic
1128262612 15:66243123-66243145 GTGCCTTGCCCAGAGTGCCACGG - Intronic
1128316281 15:66661452-66661474 AGGCCTAGACCAGGAGCCCAAGG + Intronic
1128481704 15:68045677-68045699 GGGACTTTCCCAGGACCCCAAGG - Intergenic
1128683774 15:69669065-69669087 GTTCCATGCCCAGGAGCCCAGGG + Intergenic
1129508255 15:76101149-76101171 GTGACTTTCCCAGGATCACATGG + Intronic
1129516182 15:76159124-76159146 AGCCCTTCCCCAGTATCCCAGGG + Intronic
1130067255 15:80615102-80615124 GTGCCTTTTCCAGGATGCCAGGG + Intergenic
1131029909 15:89177808-89177830 GGGCCTACCCCAGGATCCAAGGG + Intronic
1132153853 15:99481445-99481467 GTGCCTTGCCCAGGATCAAATGG + Intergenic
1132405826 15:101541449-101541471 GGGCGTGGCCCAAGACCCCAAGG + Intergenic
1132463619 16:67646-67668 GGTCCTTGGCCTGGATCCCTGGG + Intronic
1135001907 16:18783830-18783852 GTGACTTGCCCAAGATCTCATGG + Intronic
1135176075 16:20230460-20230482 GTGACTGGCCCAAGATCCCATGG - Intergenic
1136016012 16:27401777-27401799 GAACCTTGCCCAAGGTCCCACGG - Intergenic
1136186384 16:28591116-28591138 GGGGCTTGCCAAGGCTGCCAGGG - Intronic
1136188872 16:28603832-28603854 GGGGCTTGCCAAGGCTGCCAGGG - Intergenic
1136382337 16:29901368-29901390 GGTCCTTCCCCGGGATCCCCAGG - Exonic
1136500291 16:30666717-30666739 CTGCCTTGCCCAAGGTCCCATGG - Intronic
1136540747 16:30926523-30926545 GGGCCGTGCTCTGGAGCCCAGGG - Intronic
1136912550 16:34156913-34156935 GGGCCTTGGGCAGGTTCACAAGG - Intergenic
1137456422 16:48621391-48621413 GTGCCTTGCCCACAGTCCCATGG + Intergenic
1137557731 16:49483411-49483433 GGGGCTTGCCCAGAGTCACAGGG + Intergenic
1137790637 16:51171870-51171892 GGGACTTGCTCAGGATCACATGG - Intergenic
1138147748 16:54627595-54627617 GTGGCTTCCCCAGGATGCCAGGG - Intergenic
1139214424 16:65113383-65113405 AGGACTTGCCCAAGATCCCACGG - Intronic
1139465452 16:67151537-67151559 GTGACTTGCCCAGGATCCAAAGG + Intergenic
1140530326 16:75660279-75660301 GGGCCTGCCACAGGAACCCAAGG - Intronic
1140969056 16:79995354-79995376 AGGCCTTGCCAAGGAGCCAAAGG - Intergenic
1140995292 16:80253053-80253075 GAGACTTGCCCAAGATCACACGG - Intergenic
1141240844 16:82263810-82263832 CTGCCAAGCCCAGGATCCCAGGG + Intergenic
1141687482 16:85578585-85578607 CTGACTTGCCCAGCATCCCAGGG + Intergenic
1142249176 16:88983308-88983330 GGGGCTGCCCCAGGGTCCCAAGG - Intergenic
1142346559 16:89557807-89557829 TGGGCTTGCCCTGGATCACAGGG + Intergenic
1142614104 17:1125110-1125132 GGGCCTGGCCCACGATGCCCAGG + Intronic
1142968731 17:3597027-3597049 GGGCCGGGCCCGGGACCCCACGG - Exonic
1143400674 17:6640272-6640294 GGGCCTTGCCCAGGCTGCGCCGG - Intronic
1144772976 17:17770000-17770022 GGGCCCTGCCCAGGGTGACAGGG + Intronic
1144960579 17:19042051-19042073 AGGACTTGCCCACGGTCCCAAGG + Intronic
1144974581 17:19132473-19132495 AGGACTTGCCCATGGTCCCAAGG - Intronic
1146662661 17:34674962-34674984 TGGCCTTCCCCAGGTCCCCAGGG + Intergenic
1147161261 17:38570717-38570739 GGGCCTGCCCCAGGGTCCCAAGG + Intronic
1148233558 17:45952319-45952341 GGTCCTTGGCTAGGATGCCAGGG + Intronic
1149362585 17:55910942-55910964 GGGGCTTTCCCAGGACCCCCAGG + Intergenic
1149421014 17:56510954-56510976 TGGTCTGGCCCAGGAGCCCAAGG + Intronic
1150006966 17:61475992-61476014 GGGACTTGCCCACGTTCCCACGG + Intronic
1151546935 17:74799033-74799055 GGGCAGTGCCCTTGATCCCAGGG - Intronic
1151702917 17:75752889-75752911 AGGCCTGGCCCAGGAGCCCTGGG + Intronic
1152079586 17:78178432-78178454 GGGCCTTCCTCAGGATGGCACGG + Intronic
1152588634 17:81200267-81200289 GGGTCTGGCCCAGAATCCCAGGG - Intronic
1152626454 17:81390064-81390086 GAGCCTCCCCCAGGATCCCTGGG + Intergenic
1152781884 17:82230404-82230426 GGGCCCTGCCCAAGGTCACATGG - Intronic
1152813701 17:82394632-82394654 GGCCTTTGCCCCGGCTCCCAGGG + Intronic
1156247814 18:35319353-35319375 GGGCCTTGCCTAGAATCTAATGG - Intergenic
1156461976 18:37326327-37326349 AGGCCATGGCCAGGGTCCCAGGG - Intronic
1159133638 18:64310044-64310066 GGCAGTTGCCCAGCATCCCAGGG + Intergenic
1160141142 18:76324337-76324359 GCGCCAAGCCCAGGACCCCATGG + Intergenic
1160511416 18:79455554-79455576 GGGCCCTGCCCTGGTTCGCAGGG + Intronic
1160565283 18:79783174-79783196 GGGCCTTGTCCAGTATCACTGGG + Intergenic
1161045561 19:2132597-2132619 GGGCCGTGGCCAGGATGCCCTGG + Intronic
1161431123 19:4233041-4233063 GGGCCTGACCCGGGACCCCAAGG - Intronic
1161495568 19:4584207-4584229 GGGCTTTGCTCAGAATCCCACGG - Intergenic
1161979024 19:7620977-7620999 GGGCCTGGCCCGGCATGCCATGG - Exonic
1162490277 19:10987433-10987455 GGGCCAGCCCCAGGCTCCCAAGG - Intronic
1162582511 19:11539733-11539755 TGGCTTTTCCCAGGGTCCCATGG + Intronic
1162775249 19:12975298-12975320 GGGGCTTGCCCATGGTGCCAGGG - Intergenic
1163126132 19:15245204-15245226 GGGACTTGTCCAGGGTCACATGG + Intronic
1163202143 19:15777194-15777216 GGGGCTGTCCCAGGATCCGAAGG + Intergenic
1163450888 19:17376872-17376894 GGGGCTTGCTCAGGGTCCCCAGG + Intronic
1163554811 19:17985791-17985813 GCCCCTTGCCCTGGATCCAAAGG - Intronic
1163578609 19:18124749-18124771 GGGCCTGGCCAAGGACCCCCTGG + Exonic
1165741115 19:38205913-38205935 GTGACTTGCCCAGGGTCCCTCGG + Intronic
1165900600 19:39167600-39167622 GGGCCTGGCCAAGGCTCCCAGGG - Intronic
1165901516 19:39171552-39171574 GGGCCTTGCCCAGGGGCCCCAGG - Intronic
1167117862 19:47498492-47498514 CTGACTTGCCCAGGATCACAGGG + Intronic
1167440270 19:49504409-49504431 GGGCCTGTCACAGGAGCCCAAGG - Intergenic
1167513306 19:49908451-49908473 GCGCATGGCCCAGGATCTCAAGG - Exonic
1168160520 19:54507630-54507652 GGGCCTTGCTCAGGGTCACGTGG - Intronic
1202713525 1_KI270714v1_random:30139-30161 GTGGCTTGGCCAAGATCCCACGG - Intergenic
925451889 2:3976078-3976100 GGGCTTTGCCTGGGATGCCAGGG + Intergenic
926707517 2:15847160-15847182 GGGCCTAGCCCAGCAGACCAGGG - Intergenic
927885790 2:26717736-26717758 GGGCCCTGCCCAGGACCCCCAGG + Intronic
928200391 2:29244235-29244257 GGGCCTTGCCCAGGATCCCACGG - Intronic
929874349 2:45784210-45784232 TGGCCTTGGCCAGGATCCCAAGG + Intronic
930268225 2:49224859-49224881 GGCCCTTGGCCACCATCCCAGGG + Intergenic
930769376 2:55116429-55116451 GAAACTTACCCAGGATCCCATGG - Intergenic
932086553 2:68767631-68767653 GGACCTTGCTCAGAATCCCTAGG + Intronic
932460111 2:71876459-71876481 GGGCCTTGTACAGGCCCCCAGGG - Intergenic
934717675 2:96552908-96552930 GTGACTTGCCCAGGTTCCCCTGG + Intergenic
934761567 2:96859628-96859650 GGGCCTCCCCCACAATCCCAGGG - Intergenic
935177362 2:100661620-100661642 GGGGCTTCCACAGGATCACATGG + Intergenic
936479072 2:112868464-112868486 TGGCTTTTCCCAGGTTCCCATGG + Intergenic
936970210 2:118169692-118169714 AGGCATTGCCCAGTACCCCATGG - Intergenic
938538513 2:132265675-132265697 GGGCCTTGGGCAGGCTCACAAGG + Intergenic
939402505 2:141712475-141712497 GTGGCTTGCTCAGGATCCCACGG - Intronic
941493273 2:166169029-166169051 GGACCTTGTTCAGGATCACATGG - Intergenic
942418472 2:175783106-175783128 GGGCCTTGACAAGGTCCCCATGG + Intergenic
944635883 2:201675713-201675735 AAGCCTTGCCCTGGAGCCCAGGG - Intronic
945509519 2:210683538-210683560 GGGCTTTGCTCAGGATTCTAAGG - Intergenic
946202155 2:218076679-218076701 GGGCATTGCTCCTGATCCCAGGG + Intronic
946336277 2:219038745-219038767 GGGCTTTGCCTGGGAGCCCAGGG + Intronic
946866276 2:224043852-224043874 TGGCCTTGGCCACCATCCCAAGG + Intergenic
948756134 2:240160704-240160726 GGACCGTGCACAGGATCACAAGG - Intergenic
1168925695 20:1577344-1577366 GGGCCTTGTCCATGGTCACAGGG - Intronic
1168929577 20:1610370-1610392 GGGCCTTGTCCATGGTCACAGGG - Intronic
1168939466 20:1696428-1696450 GGGCCTTGCCCAAGGTCACAGGG - Intergenic
1168961727 20:1874630-1874652 GTGACTTGCCCAGCATCACATGG - Intergenic
1170509445 20:17061361-17061383 GTGCCTTGGCCAAGATCCCAAGG + Intergenic
1171151090 20:22826997-22827019 GGGTGTGGCCCCGGATCCCATGG + Intergenic
1171811837 20:29750666-29750688 GGGCCTTGGGCAGGCTCACAAGG + Intergenic
1172630621 20:36375917-36375939 TGGCTTTGCCCAGGAGCTCAAGG + Intronic
1172774197 20:37397763-37397785 GGGCCTGGCCAAGGATGCCTGGG + Exonic
1172880734 20:38198403-38198425 GGGACTTGCCTAGAGTCCCACGG - Intergenic
1174269138 20:49354338-49354360 GTGCCTTGCCCAAGGTCACATGG + Intergenic
1174391779 20:50222230-50222252 AGGTCTTTCCCAGGATCACAGGG + Intergenic
1174419986 20:50393320-50393342 GTCACTTGCCCAGGATCCCCTGG + Intergenic
1174449153 20:50609203-50609225 GGGAATTGGCCAGAATCCCAGGG - Intronic
1175108691 20:56631065-56631087 GGGGCTTGCCCAGGGTCGGAAGG - Intronic
1176553053 21:8238453-8238475 GGGCCTTGGGCAGGCTCACAAGG - Intergenic
1176571975 21:8421477-8421499 GGGCCTTGGGCAGGCTCACAAGG - Intergenic
1176579884 21:8466060-8466082 GGGCCTTGGGCAGGCTCACAAGG - Intergenic
1178298360 21:31429698-31429720 GTGCCTGACCCAGGAGCCCAAGG - Intronic
1178680401 21:34669215-34669237 GGGCCTTGCGCAGGACCCGCAGG - Intergenic
1178851364 21:36215219-36215241 GTGGCTTGCCCAGGATCCCAAGG - Intronic
1179570157 21:42273838-42273860 GTGCCTTGGTCAGGATACCAAGG + Intronic
1179655984 21:42845011-42845033 GGGCCCAGCCCAGGGTCACACGG + Intronic
1179831622 21:44000585-44000607 GGGCCTTGGCAAGCCTCCCACGG + Intergenic
1180211631 21:46298286-46298308 GGGCCTGGCCCGTGTTCCCAAGG - Intergenic
1180314080 22:11262322-11262344 GGGCCTTGGGCAGGCTCACAAGG + Intergenic
1181936912 22:26445601-26445623 GGGACTTGCCCAAGGTCCCGAGG - Intronic
1182097996 22:27638824-27638846 GGGACTTGCCCAAGATCACAGGG + Intergenic
1182164881 22:28163128-28163150 GGGCATTGCTGAGGATCTCAAGG - Exonic
1183082513 22:35465509-35465531 GGGCTGTGGCCAGGAGCCCAGGG + Intergenic
1183125921 22:35782017-35782039 GTGACTTGCCCAAGATCACATGG + Intronic
1183272262 22:36869554-36869576 GAGCCCTGCAGAGGATCCCATGG - Intronic
1183386361 22:37517817-37517839 GGGGCTTGCCCAGGGCCCCACGG - Intronic
1183487610 22:38097820-38097842 TGGCCTTACCCAGAATCCCCGGG - Intronic
1183617675 22:38955175-38955197 GGACCTTCCCCAGGATCCTATGG + Intronic
1184189790 22:42887042-42887064 GGGCCTTTGCCAGAATCCCAGGG - Intronic
1184449986 22:44577056-44577078 GGGACTTGCTCAGGGTCACACGG - Intergenic
1184684913 22:46091886-46091908 GGGGCTGGCCCAAGATCACACGG - Intronic
1184768968 22:46587011-46587033 GGGCTTTGTCCAGCATCACAGGG - Intronic
1185420060 22:50730268-50730290 GGAACCTGCCCAGGATCCCCTGG + Intergenic
1203258051 22_KI270733v1_random:155495-155517 GGGCCTTGGGCAGGCTCACAAGG - Intergenic
949517706 3:4822075-4822097 GTGACTTGCCCAGGGTCACACGG - Intronic
949609860 3:5693000-5693022 GTGCATTGCAAAGGATCCCATGG + Intergenic
949693010 3:6662317-6662339 GGGCCAGGCCCAGGGTCCCTGGG - Intergenic
950094685 3:10321998-10322020 GGGACTTACTCAGGACCCCAGGG - Intergenic
950473115 3:13198688-13198710 GTGCCTTGCCCATGGTCACATGG - Intergenic
952744339 3:36763658-36763680 GTGCCTTGCCCAGGGTCACACGG - Intergenic
953250250 3:41239264-41239286 GGGGCATGCCCAGGACCTCATGG + Exonic
953388913 3:42523278-42523300 AGGCCTTGACCACAATCCCAGGG + Intronic
953871731 3:46632870-46632892 GGGCCAAGCCCAGCCTCCCACGG - Intergenic
954656397 3:52196916-52196938 GGGCACTGCCCAGGATCTCTTGG + Intergenic
954713050 3:52514385-52514407 GGGCCTCCCCCAGGACCACATGG - Exonic
961345630 3:126261410-126261432 GGGCCTTGCCTGGGAGCCCCTGG - Intergenic
961463707 3:127068882-127068904 GGGCTCAGCCCAGGGTCCCATGG + Intergenic
961986452 3:131139912-131139934 AGGCCCTGCCCAGGCTCTCATGG - Intronic
967412859 3:189184175-189184197 GGAGCTTGCCCAGGGTCACACGG - Intronic
968048240 3:195635664-195635686 GGGCCTGGCCCAGGAGCCGGTGG - Intergenic
968099164 3:195953956-195953978 GGGCCTGGCCCAGGAGCCGGTGG + Intergenic
968306369 3:197654257-197654279 GGGCCTGGCCCAGGAGCCGGTGG + Intergenic
968458055 4:708481-708503 GGGGCTGGCCCAGGGTCTCATGG - Intronic
968945482 4:3661354-3661376 GGGCCTGCCCCAGGATCTCACGG + Intergenic
969210081 4:5680600-5680622 GTGATTTGCCCAGTATCCCATGG - Intronic
969415339 4:7054136-7054158 AGGCCTTCCCCAGGTTCCCGTGG - Exonic
969417348 4:7069159-7069181 GTGCCCTCCCCGGGATCCCAGGG + Intergenic
969417361 4:7069191-7069213 ATGCCCTCCCCAGGATCCCAGGG + Intergenic
969676357 4:8616511-8616533 GGGCCTACCCCAGGGCCCCACGG - Intronic
969842112 4:9890345-9890367 GTGTCTTGCCCAAGATCACACGG + Intronic
969845628 4:9918020-9918042 AGGCATTGCCCAAGGTCCCAGGG - Intronic
971361683 4:25943875-25943897 GGGACTTACCCAAGATCCCATGG - Intergenic
972600204 4:40565414-40565436 GCCCCTTCCCCAGGAACCCAAGG - Intronic
972993574 4:44852088-44852110 GGGTCTGGCCCAGGGTCCCTGGG + Intergenic
973607553 4:52602571-52602593 GTGACTTGCCCAAGATCACAAGG - Intronic
973809618 4:54557344-54557366 GGGACTTGCCTAGGGTTCCATGG + Intergenic
976564182 4:86534660-86534682 GGGCCTGCCTCAGTATCCCAAGG - Intronic
977838612 4:101674301-101674323 GGGCCCTCCGCAGCATCCCAGGG - Intronic
979608601 4:122666461-122666483 GGGTCTTGCCCAGGAGCTCTGGG - Intergenic
982096320 4:151926688-151926710 CTGCATTGCCCAGGCTCCCATGG + Intergenic
983288610 4:165771717-165771739 GGGTCTTGCCCTGTTTCCCAAGG + Intergenic
983337814 4:166419044-166419066 GGACATTGTCCAGGATGCCAAGG + Intergenic
983431817 4:167660074-167660096 TGGGCTGGCCCAGGGTCCCAGGG - Intergenic
984102217 4:175499739-175499761 GGGACCTGCCCAGGCCCCCAAGG + Intergenic
984699578 4:182809879-182809901 TGTCCCTGCCCAGGATCCCTGGG - Intergenic
985504731 5:272157-272179 GGGCCTAGCCCAGGAGCCGGTGG - Intronic
985743383 5:1633439-1633461 GGGCCTAGCCCAGGAGCCGGTGG + Intergenic
985866508 5:2518507-2518529 GTACCTTTCCCAGGACCCCAAGG + Intergenic
985870944 5:2556449-2556471 AGGCATGGCCAAGGATCCCATGG + Intergenic
986265771 5:6189217-6189239 GTGACTTGCCCAAGATCCTAAGG + Intergenic
987379699 5:17273792-17273814 CAGCCTTGCCCTGGACCCCAAGG - Intronic
988093314 5:26569564-26569586 GGGGCCTTCCCAGGTTCCCAAGG + Intergenic
990271498 5:54146448-54146470 GCGCCCTGCCCAATATCCCATGG + Intronic
992029772 5:72709437-72709459 CAGCCCTGCCCAGGATCACAGGG + Intergenic
992117608 5:73555920-73555942 GTGTCTTGCCCAGGGTCACATGG - Intronic
994017967 5:94990377-94990399 GAGCCTGGGCCAAGATCCCAGGG - Intronic
994616877 5:102114959-102114981 CTGCCTTGCCGGGGATCCCAGGG - Intergenic
996763085 5:127005469-127005491 GGGACTTACCCAGGATCACGTGG - Intronic
997668115 5:135648576-135648598 GGGACCTGCCCAGGCTCACATGG - Intergenic
997690242 5:135823245-135823267 GGGGCTTGCTCAGGATCAAAGGG + Intergenic
998151493 5:139759961-139759983 AGGCCTTGCCCAAGGTCACATGG + Intergenic
998393441 5:141802933-141802955 GGGCCTTGCTGAGGGGCCCAAGG - Intergenic
998822515 5:146069410-146069432 GGGCCTTGCCTGGGACCTCAAGG + Intronic
999309572 5:150543266-150543288 AGGGTTTGCCCAGGGTCCCAAGG + Intronic
999730103 5:154470559-154470581 GGGACTTGCCCAGCATCTCAGGG - Intergenic
1001403144 5:171458365-171458387 GGGCCTGTCCCAGGATGTCAGGG + Intergenic
1001590026 5:172858799-172858821 GGGCCCTGCCCAAGATTCCAAGG + Intronic
1001754417 5:174157349-174157371 GGTCCTTGGACAGGATGCCAGGG + Intronic
1001960569 5:175878285-175878307 GGGCCTTGCTGAAGGTCCCATGG + Intronic
1003485340 6:6571072-6571094 GAGCCGAGCCCAGGATACCAGGG - Intergenic
1003513412 6:6800082-6800104 AGGCCTGGCCCAGGAGCCCAAGG + Intergenic
1004179968 6:13372569-13372591 GCCCCTTGCCCAGACTCCCAGGG - Intronic
1004290641 6:14363835-14363857 GTGACTTGCCCAGGAAGCCAAGG - Intergenic
1005267313 6:24125981-24126003 GGGCCCTGCCGAGGCTCCCCAGG - Intergenic
1005750773 6:28880424-28880446 AGGCTTTGCTCAGGAACCCAGGG - Intergenic
1006438745 6:34040496-34040518 GGGCATGGCCCAGGATACCCAGG + Intronic
1006502389 6:34466829-34466851 GGGCAGTGCCCAGCAGCCCATGG - Intronic
1006577459 6:35056890-35056912 GGGCTTTCCCCAGGATCTCAGGG + Intronic
1006803556 6:36774632-36774654 GGGAAGTGCCCAGGATTCCAGGG - Intronic
1007072987 6:39049774-39049796 GTCCCTAGCCCAGGATCCCAGGG - Intronic
1007374789 6:41449172-41449194 GGGACTTGTCCAGTATCACATGG + Intergenic
1007400451 6:41599747-41599769 GGGCCTGGGCCGGGAGCCCAGGG + Exonic
1007629570 6:43265276-43265298 AGGCCTTGCCTGGGATCACATGG + Intronic
1007701250 6:43767849-43767871 GGGCTTTGCCCAGGGATCCAGGG - Intergenic
1007927532 6:45662544-45662566 GGGGCTTGCCCGAGGTCCCATGG + Intronic
1014153321 6:118084096-118084118 GTGACTTGCCCAGGGTCACATGG + Intronic
1015881877 6:137878543-137878565 GGGGCACGCCCAGAATCCCATGG + Exonic
1016369807 6:143361819-143361841 GGGGTTATCCCAGGATCCCATGG + Intergenic
1016911374 6:149202542-149202564 GTGCCTTTCCCAGTTTCCCAGGG + Intergenic
1017011005 6:150063956-150063978 GGGCCTAGCCAGGAATCCCATGG + Intronic
1017211812 6:151865464-151865486 GGGCTTCACCCAGGATCGCATGG + Intronic
1018969815 6:168519304-168519326 GCACCTGGCCCAGGAGCCCAGGG - Intronic
1019523958 7:1472476-1472498 GGCCACTGCCCAGGCTCCCAAGG + Intronic
1020280701 7:6648630-6648652 AGGCCTTGCCCAAGGTCCTATGG + Intronic
1021496184 7:21276857-21276879 GAGACTTGCCCGAGATCCCAAGG + Intergenic
1021602837 7:22381226-22381248 GGGCCTTGGTCTGGACCCCAAGG - Intergenic
1023986671 7:45101119-45101141 GGGCCTCTCCCAGGAGCCCAGGG - Intronic
1024064688 7:45722408-45722430 GGGCCTCGCCTTGGCTCCCAGGG - Exonic
1024230701 7:47361232-47361254 GGGCCCAGCCCAAGACCCCAAGG + Intronic
1025250975 7:57351162-57351184 GTCACTTGCCCAGGATCCCCTGG - Intergenic
1026315597 7:69224674-69224696 GGGTCTGCTCCAGGATCCCAAGG + Intergenic
1026832245 7:73617379-73617401 CTGCCATGCCCAGAATCCCAGGG + Intronic
1027352735 7:77328056-77328078 GTGACTTGCCCAGGAGCACATGG + Intronic
1028872699 7:95786703-95786725 GGACCTTGCTCAGAAACCCAAGG + Intronic
1029645815 7:101855190-101855212 GGGCCTGGGCCAGGCTCCAAGGG - Intronic
1030188398 7:106786591-106786613 GTAATTTGCCCAGGATCCCACGG + Intergenic
1031890248 7:127286109-127286131 GGGCTTTGCCCAGGGTCATACGG - Intergenic
1031996526 7:128235592-128235614 GGACCCTGCCCAGGTACCCAGGG - Intergenic
1033157650 7:138970750-138970772 GGGCTTTGCCCAAGTTCCCCTGG + Intronic
1034672979 7:152871616-152871638 CAGCCTTCCCCAGGGTCCCAGGG + Intergenic
1035557952 8:580380-580402 GGGCCTTGCCCAGGAACGTGGGG - Intergenic
1037167172 8:15845260-15845282 GTGCCTTGCGCAGGGTCACATGG - Intergenic
1037468243 8:19182076-19182098 GGGCCTTTCCCAAGACCCCAGGG - Intergenic
1037758848 8:21728718-21728740 GGGACTTGCCCAAGGTCACATGG - Intronic
1039080350 8:33728084-33728106 TGACCTTGCCCTGGATCACACGG + Intergenic
1040549600 8:48428010-48428032 CGGCCTTGCGCAGGAGCCCTGGG - Intergenic
1042315533 8:67422456-67422478 AGGCCTTGCTCAGAATCCTATGG + Exonic
1042566070 8:70113484-70113506 AGGCCTGGCCCTGGTTCCCAGGG - Exonic
1045214204 8:100130368-100130390 GGGCCTGGCCCAGGGTCCCTGGG - Intronic
1047309204 8:123677614-123677636 GGGCCTGGCACAGAATTCCATGG + Intergenic
1047494448 8:125399554-125399576 GGGACCTGCCCAGGGTCACACGG - Intergenic
1048073666 8:131044848-131044870 GTACCTTGCCCAGGATCTCGTGG + Intergenic
1049239594 8:141530470-141530492 GTGACTTGCCCAGGGTCCCACGG + Intergenic
1049255351 8:141610760-141610782 GGGCTCTGCTCAGGGTCCCATGG - Intergenic
1049431377 8:142566862-142566884 CGGCCTTGGCCAGGCTGCCAGGG - Intergenic
1052252856 9:26420303-26420325 GCTACTTGCCCAGGATCCCATGG + Intergenic
1053428351 9:38025778-38025800 GGGTCTTGCCCAGGGTCACCTGG + Intronic
1055058052 9:72041566-72041588 GGTCCTTGCCCAAGGTCACATGG + Intergenic
1055424339 9:76178440-76178462 GTGGCTTGCCCAGTATCACATGG - Intronic
1059220966 9:112618362-112618384 GGGCATTGCACAGGCTTCCATGG + Intronic
1059311154 9:113389862-113389884 GGCCCTTGCCAGGTATCCCAGGG + Intronic
1059428761 9:114237466-114237488 GTGACTTGCCCAGGGTCCCATGG + Intronic
1060451773 9:123749472-123749494 GTGACTTGCCCAAGATCTCAAGG - Intronic
1060519970 9:124288752-124288774 GGGACTGGCCCAGGCTCACATGG + Intronic
1060992220 9:127855743-127855765 GGGCCTTGTCCAAGGTCTCATGG - Intergenic
1061159796 9:128886978-128887000 GACCCTGGCCCAGGATTCCAGGG - Intronic
1061196411 9:129109525-129109547 GGGACTTGCCCAGAGTCCCCTGG - Intronic
1061209000 9:129179946-129179968 GAGACTTGCCCAAGATCACATGG + Intergenic
1061221463 9:129254385-129254407 GGGTCTTGCCCAGGGGACCATGG + Intergenic
1061369565 9:130190873-130190895 GGGCCTTGGGGAGGATCCCAAGG + Intronic
1061498594 9:130989839-130989861 GGGACTTACCGAGGGTCCCAGGG - Intergenic
1061825680 9:133256897-133256919 TGGCCTGGCCCAGAGTCCCAGGG + Intronic
1061885406 9:133588763-133588785 GGACCTTGCCCAGGGTCACCGGG + Intergenic
1062353673 9:136151973-136151995 GGGCCTTTCCCAATATCCCAGGG - Intergenic
1062395662 9:136351657-136351679 AGGCCTTGGCCAGGGCCCCAGGG + Intronic
1062431880 9:136529994-136530016 GGGCCCTGCCCTGGCTCCCAGGG + Intronic
1062492088 9:136810241-136810263 GGACCTTGCCCAGGACCCTCGGG - Intronic
1062634900 9:137485674-137485696 GGGCCTGGCCCAGGCTTCCCAGG - Intronic
1062721440 9:138046357-138046379 GTGCCCTGTCCAGGCTCCCAGGG - Intronic
1203474245 Un_GL000220v1:137518-137540 GGGCCTTGGGCAGGCTCACAAGG - Intergenic
1203362392 Un_KI270442v1:228441-228463 GGGCCTTGGGCAGGCTCACAAGG + Intergenic
1186507291 X:10103293-10103315 GGGCCTTGCCCAGGCTGCTAAGG - Intronic
1186620474 X:11235365-11235387 GGGCCTGGCCCAGGGCCCCCCGG - Intronic
1190844868 X:54182664-54182686 GGTCCTTGCCCAGGCCCCCCGGG + Exonic
1191209791 X:57872409-57872431 CTGCCTTGCCAAGCATCCCAGGG + Intergenic
1192351696 X:70361312-70361334 GGGCCTTGCCCCAAATGCCATGG + Intronic
1193038228 X:76976802-76976824 GTGACTTGCCCAAGATCACATGG + Intergenic
1194235973 X:91383473-91383495 GGGCCTGACCAAGGATTCCATGG + Intergenic
1195682559 X:107559803-107559825 GGCCCTGGCCCAGAAGCCCAGGG - Intronic
1197573386 X:128177980-128178002 GATCCTTGCCAAGGATCTCAGGG - Intergenic
1198857469 X:141033312-141033334 GGGCTGGGCCCAGGATCCCCTGG + Intergenic
1198905227 X:141554059-141554081 GGGCTGGGCCCAGGATCCCCTGG - Intergenic
1199348144 X:146766687-146766709 GGGCCTTGCCCTTGATCTAAAGG - Intergenic
1199643919 X:149886955-149886977 GGGCATTTCCCAGGATAACATGG + Intergenic
1199896527 X:152132177-152132199 GGGCATTTCCCAGAATCACATGG - Intergenic
1200109653 X:153733864-153733886 GGGCCTGGCCCGGGAAACCAGGG - Intronic
1202183286 Y:22157610-22157632 GGGCCTTGCAGAGGCTCTCAGGG + Intergenic
1202208073 Y:22428791-22428813 GGGCCTTGCAGAGGCTCTCAGGG - Intergenic