ID: 928200515

View in Genome Browser
Species Human (GRCh38)
Location 2:29245073-29245095
Sequence CTCACTGCCCTGCACACAGT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 986
Summary {0: 1, 1: 11, 2: 22, 3: 125, 4: 827}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
928200512_928200515 3 Left 928200512 2:29245047-29245069 CCCTTCACACAGTTGGGGCTGTA 0: 1
1: 0
2: 2
3: 13
4: 167
Right 928200515 2:29245073-29245095 CTCACTGCCCTGCACACAGTAGG 0: 1
1: 11
2: 22
3: 125
4: 827
928200508_928200515 16 Left 928200508 2:29245034-29245056 CCATGGGACAGTGCCCTTCACAC 0: 1
1: 0
2: 0
3: 36
4: 235
Right 928200515 2:29245073-29245095 CTCACTGCCCTGCACACAGTAGG 0: 1
1: 11
2: 22
3: 125
4: 827
928200513_928200515 2 Left 928200513 2:29245048-29245070 CCTTCACACAGTTGGGGCTGTAT 0: 1
1: 0
2: 0
3: 17
4: 114
Right 928200515 2:29245073-29245095 CTCACTGCCCTGCACACAGTAGG 0: 1
1: 11
2: 22
3: 125
4: 827

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
928200515 Original CRISPR CTCACTGCCCTGCACACAGT AGG Intronic
900210427 1:1453007-1453029 CACCCCGCCCAGCACACAGTAGG + Intronic
900215490 1:1479427-1479449 CACACTCCCCTGCACACATGGGG + Intronic
900216364 1:1483983-1484005 CACCCCGCCCAGCACACAGTAGG - Intronic
900302910 1:1986827-1986849 CTCATTGGCCTGAACACAGCAGG + Intronic
900332439 1:2142734-2142756 GACAGTGCCCAGCACACAGTGGG - Intronic
900419389 1:2549152-2549174 CCCACTGCCCAGCATATAGTGGG + Intergenic
900419409 1:2549222-2549244 CTCACTGCCAGGCATACAGCAGG + Intergenic
900425827 1:2578163-2578185 CTCACTGCCCAGCATATAGTGGG - Intergenic
900470972 1:2854802-2854824 CCCAGTGCCCTGCACACCGTGGG - Intergenic
900471632 1:2857819-2857841 CCCAGTGCCCTGCACACCGTGGG + Intergenic
900602835 1:3510354-3510376 CCCACAGCCCTGCACGCAGCAGG + Intronic
900602855 1:3510462-3510484 CCCACAGCCCTGCACGCAGCAGG + Intronic
900602861 1:3510498-3510520 CCCACAGCCCTGCACGCAGCAGG + Intronic
900602875 1:3510570-3510592 CCCACAGCCCTGCACGCAGCAGG + Intronic
900602882 1:3510609-3510631 ACCACAGCCCTGCACACAGCAGG + Intronic
901689902 1:10965988-10966010 CTCAGGGCCTGGCACACAGTAGG - Intronic
902032730 1:13434523-13434545 CTCACTGCCCTGCACAAACCTGG - Intergenic
902108450 1:14057839-14057861 CTCAGTGCCTGGCACATAGTAGG + Intergenic
902728708 1:18354228-18354250 CTCTGTGCCCTGCACACACTGGG - Intronic
902780660 1:18702822-18702844 CTCAGTGCTTGGCACACAGTAGG - Intronic
903003777 1:20284954-20284976 CACAGGGCCCCGCACACAGTAGG - Intergenic
903181120 1:21605376-21605398 CTCACTTCCTGACACACAGTAGG + Intronic
903181155 1:21605649-21605671 CCCACAGCCCGACACACAGTAGG + Intronic
903271522 1:22191522-22191544 CCCACTGTCTGGCACACAGTAGG - Intergenic
903363112 1:22789495-22789517 CGCTGTGCCCTGTACACAGTAGG - Intronic
903384337 1:22916724-22916746 CCGGCTGCTCTGCACACAGTTGG + Intergenic
903396063 1:23002709-23002731 CTTACTGCCCTAGACACAGAGGG - Intergenic
903610713 1:24609982-24610004 TTCTCTGCCTGGCACACAGTAGG - Intergenic
904258044 1:29269456-29269478 CACAGTGCCCAGCACAAAGTGGG - Intronic
904560927 1:31396846-31396868 CACAGGGCCCTGCACATAGTAGG - Intergenic
904681117 1:32229967-32229989 AGCACTGCCCAGCACATAGTAGG + Intronic
904982974 1:34522351-34522373 ATCAAGGCCGTGCACACAGTAGG + Intergenic
905213208 1:36388668-36388690 CTCAGTGCTCTGCACATAGTGGG - Intergenic
905242147 1:36588268-36588290 CTCAGGGCCTGGCACACAGTAGG + Intergenic
905349310 1:37333654-37333676 CACAGTGCCTGGCACACAGTCGG + Intergenic
905395899 1:37666291-37666313 CTCAGTGCTTGGCACACAGTAGG + Intergenic
905974621 1:42165490-42165512 CTCAATGCCTGGCACACAGAAGG + Intergenic
906212547 1:44020152-44020174 CTCAGGGCCTGGCACACAGTGGG - Intronic
906212598 1:44020457-44020479 CACACTGCCAGGTACACAGTGGG - Intronic
906302731 1:44695327-44695349 CACAGTGCCCCGCACACAATAGG + Intronic
906542528 1:46598587-46598609 CACAGTGCCTGGCACACAGTAGG - Intronic
906642003 1:47446557-47446579 GACAATGCCCAGCACACAGTAGG - Intergenic
906650586 1:47509666-47509688 CCCAGTGCCCAGCACACAGACGG + Intergenic
906943558 1:50276403-50276425 CTAACTGCCTGGCACACTGTGGG + Intergenic
907172199 1:52478838-52478860 AACACTGCCTTGCACAAAGTAGG - Intronic
907251137 1:53140673-53140695 ATCAATGCCCAGCATACAGTAGG - Intronic
907310214 1:53534788-53534810 CACACTGCCAGGCACACAGAGGG - Intronic
907314745 1:53561033-53561055 CCCAATGCCTGGCACACAGTAGG - Intronic
907516456 1:54996352-54996374 CTCAGTGTCCCCCACACAGTAGG + Intergenic
907870721 1:58440280-58440302 CCCAATGCCCAGCACATAGTAGG - Intronic
907906396 1:58785982-58786004 CTCAGTGCCTGGCTCACAGTAGG - Intergenic
907919935 1:58903032-58903054 CACAGTGCCTGGCACACAGTAGG + Intergenic
908025157 1:59942850-59942872 CTCTGTGCCCAGCACATAGTAGG - Intergenic
908781321 1:67693248-67693270 CTCAGTGTCAGGCACACAGTAGG + Intergenic
908807859 1:67949344-67949366 CCCCTTGCCCTGCACCCAGTAGG + Intergenic
909741649 1:79037026-79037048 CCCACTGCCCTGCACAACCTTGG + Intergenic
909934597 1:81536858-81536880 CTCAGTGCCCTTCACGCAGTAGG - Intronic
909936605 1:81558090-81558112 TTCAGTGCCTGGCACACAGTAGG + Intronic
910681077 1:89865138-89865160 CCCAATACCCAGCACACAGTAGG + Intronic
912157537 1:106940265-106940287 ATCAGTGCCAGGCACACAGTAGG - Intergenic
912248221 1:107983610-107983632 AACAGTGCCCAGCACACAGTAGG + Intergenic
912574970 1:110661271-110661293 TTGATTGCCCAGCACACAGTAGG - Intergenic
912694401 1:111830160-111830182 CCCAGTGCCCAGCACACAATAGG + Intronic
912833655 1:112976347-112976369 GTAACTGCACTGCACATAGTAGG - Intergenic
912868525 1:113281470-113281492 CTCACAGCCTGGCACAGAGTGGG + Intergenic
913178379 1:116296085-116296107 CCCACTGCCCTGCCCTTAGTAGG - Intergenic
913204101 1:116519891-116519913 ATCACTTTCCTGCCCACAGTAGG + Intronic
913259777 1:116987738-116987760 CTTACTGCCCTGGACAGAGGTGG - Exonic
913442735 1:118916070-118916092 CACACTGCTTTGCACACAGAAGG - Intronic
915213275 1:154325426-154325448 CCCACTGCCCCGCACAAAGATGG + Intergenic
915321625 1:155059695-155059717 CACAGTGCCCAGCACACAGAAGG + Intronic
915657600 1:157374717-157374739 CTCATTGCCTTGTACATAGTAGG + Intergenic
915671480 1:157492272-157492294 CTCATTGCCTTGTACATAGTAGG - Intergenic
916040557 1:160957610-160957632 CACAATGCCTGGCACACAGTGGG + Intergenic
916244461 1:162673331-162673353 TTCCCTGCCCTGGACCCAGTAGG - Intronic
916244778 1:162676653-162676675 CACTGTGCCTTGCACACAGTAGG - Intronic
916314654 1:163435974-163435996 TTTTGTGCCCTGCACACAGTGGG - Intergenic
916520240 1:165557048-165557070 CTTAGTGCCTGGCACACAGTAGG - Intronic
916659125 1:166904864-166904886 CCCACTTCACTGTACACAGTAGG + Intergenic
917018845 1:170564041-170564063 CACAGTGCCCTGCACACAATAGG + Intergenic
917720295 1:177780482-177780504 CTCAGTCCCTGGCACACAGTAGG - Intergenic
917979918 1:180262839-180262861 ATCCCTGCCCAGCACATAGTAGG - Intronic
918013067 1:180605420-180605442 CACAATGCCTGGCACACAGTAGG - Intergenic
918056356 1:181025084-181025106 CTCAGTGCTTAGCACACAGTAGG - Intergenic
918180857 1:182085221-182085243 CCAGCTGCCTTGCACACAGTAGG + Intergenic
918526975 1:185475484-185475506 CACAATGCCAAGCACACAGTTGG - Intergenic
919113631 1:193252819-193252841 CACAGTGCCTTGCACATAGTAGG + Exonic
919844533 1:201633266-201633288 CACTATGCCCTGCACATAGTAGG - Intronic
919905142 1:202073282-202073304 CTCACTGCCTGGCACACAGTAGG - Intergenic
920200035 1:204254167-204254189 CTCCCGGCCCTGCTCAGAGTTGG + Intronic
920235620 1:204501867-204501889 CTCACTGCTGTGGAAACAGTGGG + Intergenic
920286695 1:204884727-204884749 TTGAGTGCCCAGCACACAGTAGG + Intronic
920691813 1:208153076-208153098 GGTACTGCCCTGCACACAGTAGG + Intronic
921318317 1:213913279-213913301 CCCAGTGCCCAGCACAGAGTAGG - Intergenic
921789642 1:219275087-219275109 CTCTCTTCCCTGCCTACAGTTGG + Intergenic
921997868 1:221441244-221441266 CCCAATGCCTTTCACACAGTAGG - Intergenic
922229662 1:223674548-223674570 CCCACTGCCCTGCACAACCTCGG - Intergenic
922323249 1:224506006-224506028 CTCCCTCCCCTGCTCCCAGTTGG + Intronic
922564685 1:226593995-226594017 CACAGTGCCTTGTACACAGTAGG - Intronic
922795447 1:228337398-228337420 CTCCCTGCCCTGCTCCCAGAGGG - Intronic
923115967 1:230938311-230938333 CTCAAGGCCTGGCACACAGTAGG - Intronic
923145260 1:231193238-231193260 CCCACTGTGCTGCACAAAGTAGG - Intronic
924030742 1:239882842-239882864 CTGGCTGCCCAGCACGCAGTGGG + Intronic
924614522 1:245601641-245601663 CACAGTGCCCAGCACATAGTAGG + Intronic
1063157978 10:3397543-3397565 CACAGTGCCGTGCACATAGTAGG + Intergenic
1063208460 10:3856808-3856830 CATATTGCTCTGCACACAGTAGG - Intergenic
1064392963 10:14957436-14957458 AACACTGCCTAGCACACAGTAGG - Intergenic
1065188968 10:23193386-23193408 CTGACTGCCAAGCAGACAGTCGG + Intronic
1065883558 10:30058622-30058644 CTCGATGCCCTGGCCACAGTGGG - Intronic
1067316668 10:45173043-45173065 CTCACTGCCTAGCACACAGTTGG - Intergenic
1067375185 10:45721200-45721222 CCCCCTGCCCTGCCCACAGTGGG + Intergenic
1067883003 10:50062840-50062862 CCCCCTGTCCTGCCCACAGTGGG + Intergenic
1068048558 10:51918896-51918918 CTCACGGGCTTGTACACAGTTGG + Intronic
1068369111 10:56091008-56091030 CCCACTGCCCTGCACAGCCTTGG + Intergenic
1069747325 10:70724062-70724084 CACAGTGCCTGGCACACAGTAGG + Intronic
1069854837 10:71434388-71434410 CACAGTGCCTAGCACACAGTAGG + Intronic
1069948939 10:72006346-72006368 CCCACTGCCTGGCACATAGTTGG + Intronic
1070526320 10:77298827-77298849 CTGCCTGCCCTGCACACAATGGG - Intronic
1070642550 10:78180127-78180149 CTCCCTGCCCTGCTCACAGAGGG + Intergenic
1070754129 10:78981276-78981298 CTCAGTGCTCAGCACACAGTAGG + Intergenic
1070890104 10:79936814-79936836 CACATGGCCCTGCACTCAGTAGG - Intergenic
1072138857 10:92573009-92573031 CACAGTGCCCTGCACTTAGTAGG + Intronic
1072223212 10:93345192-93345214 CTCAGTGCCCAGCACATGGTGGG - Intronic
1072296714 10:94015535-94015557 CTGACTGCCCTGTTCCCAGTGGG - Intronic
1072308488 10:94131391-94131413 CACACTGCCTTGCACAGAGCAGG + Intronic
1072517440 10:96199500-96199522 TCCACTGCCCTCCAAACAGTGGG - Intronic
1072743253 10:97922854-97922876 CTCAGTGCCTGGCACACAGGAGG + Intronic
1072806667 10:98427715-98427737 CTCAATTCCCAGCACACAGCAGG - Intronic
1073013411 10:100379350-100379372 CTCACTGCCCTGCACTTGGAGGG + Intergenic
1073458275 10:103650777-103650799 CTTTCTGCCTTGCACACTGTAGG + Intronic
1073495298 10:103885308-103885330 CACACAGACCTGCACACGGTAGG + Intronic
1073937540 10:108651677-108651699 TTAAATGCCCTGCACATAGTGGG + Intergenic
1074149322 10:110744231-110744253 CACAGTGCCTGGCACACAGTAGG + Intronic
1074318805 10:112382108-112382130 CACACTGCCTGGCACACAGTAGG + Intronic
1074588521 10:114790602-114790624 CTCAGGGCCCTGCACTCAGAAGG - Intergenic
1074675919 10:115850921-115850943 CACCCTGTCCTTCACACAGTGGG - Intronic
1075216331 10:120539421-120539443 CACTGTGCCCAGCACACAGTGGG + Intronic
1075559500 10:123458320-123458342 CTCACTGCTTGACACACAGTAGG - Intergenic
1076257177 10:129036777-129036799 CGCAGAGCCCTGCACACTGTAGG - Intergenic
1076333874 10:129692048-129692070 CACAGTGCCCAGCACCCAGTGGG + Intronic
1076431688 10:130408232-130408254 CCCATTGTCCTGCACACATTAGG + Intergenic
1076494590 10:130888812-130888834 CTCTCAGCCTGGCACACAGTAGG - Intergenic
1076722687 10:132399630-132399652 CCCACTTCCTGGCACACAGTAGG - Intronic
1077485250 11:2835543-2835565 ACCACTGCCTGGCACACAGTAGG - Intronic
1078017267 11:7625617-7625639 CTCACTGCCCTCTCCACAGGTGG - Intronic
1080117097 11:28633344-28633366 CCCAGTGCCTGGCACACAGTAGG + Intergenic
1080445030 11:32330915-32330937 CACAATGCCTGGCACACAGTGGG - Intergenic
1080573879 11:33580691-33580713 AGCAGTGCCCTGCACATAGTAGG - Intronic
1080615996 11:33945357-33945379 CACAGTGCCTGGCACACAGTAGG - Intergenic
1080872222 11:36246464-36246486 ATCAGTGCCTAGCACACAGTAGG - Intergenic
1080915465 11:36653812-36653834 CTCAGTGCCATGCATATAGTAGG + Intronic
1081154816 11:39677119-39677141 CCCACTGGCCTGCACACAGTGGG - Intergenic
1081249703 11:40814396-40814418 GTCCCTACACTGCACACAGTAGG + Intronic
1081256033 11:40896252-40896274 TTCTTTGCCCTGCACACTGTAGG + Intronic
1081646221 11:44792488-44792510 CTGACTGCCTGGCACACAGTAGG + Intronic
1081719125 11:45273689-45273711 CTCAGTGCCTTGCACATAGCAGG + Intronic
1082818652 11:57528445-57528467 CACACTGCTTTGCACATAGTAGG + Exonic
1083546658 11:63553858-63553880 CCCACTGCCAGGCACAGAGTCGG + Intronic
1083632080 11:64100993-64101015 CTCAGTGCCTTGCATGCAGTTGG - Intronic
1084346397 11:68552606-68552628 CACACTCCCCTGCCCACAGGAGG - Intronic
1084480862 11:69419257-69419279 CTCACGGCCCTGAACACAGTAGG + Intergenic
1084610992 11:70203020-70203042 GCCCCGGCCCTGCACACAGTAGG + Intergenic
1084798468 11:71525564-71525586 CTCACTGCCCTGCATAGCCTTGG + Intergenic
1084934747 11:72580859-72580881 GACCCTGCCCTGCTCACAGTGGG - Intronic
1084939076 11:72602694-72602716 CACAGTGCCCAGCACACAGTAGG - Intronic
1085102120 11:73809840-73809862 CACACTTCCTTGCACACAGTAGG - Intronic
1085264686 11:75230332-75230354 CTCAGTGCACTGCACACAGTGGG + Intergenic
1085321290 11:75575595-75575617 CACAATGCCCGGCACACAGGAGG + Intergenic
1085707025 11:78795671-78795693 CACCATGCCCAGCACACAGTAGG + Intronic
1086060515 11:82695416-82695438 CCCAGTGCCCAGCACAGAGTAGG + Intergenic
1086539838 11:87895744-87895766 CTCAGTGGCCAGCACAAAGTGGG - Intergenic
1086916943 11:92541142-92541164 CACAGTGCCTAGCACACAGTAGG - Intronic
1087476775 11:98645934-98645956 CTTCCTTCCCTGTACACAGTTGG - Intergenic
1088023456 11:105148802-105148824 CACAATGCCTGGCACACAGTAGG - Intergenic
1088214123 11:107489291-107489313 CACAATGCCTGGCACACAGTGGG + Intergenic
1088338425 11:108735306-108735328 CTCAATGCCTAGCACACAGCAGG - Intronic
1088819135 11:113442261-113442283 CTTACAGCCCTGCACCCAGCTGG + Intronic
1089307094 11:117533544-117533566 TTCACTGCCTTGCACACAACGGG - Intronic
1089372365 11:117970475-117970497 CCCACTGCCTAGCACACAGTGGG + Intergenic
1089402069 11:118170091-118170113 CTAAGTGCCTGGCACACAGTAGG - Intronic
1089581785 11:119485920-119485942 GACAGTGCCCAGCACACAGTAGG - Intergenic
1089618934 11:119711486-119711508 CTCAGCACCTTGCACACAGTAGG - Intronic
1089759711 11:120714428-120714450 CTCAGTGCCTGGCACACAGTAGG - Intronic
1089817123 11:121186250-121186272 GTCTCTGCCCTCCACACAGCTGG - Intronic
1089921665 11:122214945-122214967 CACACAGCCTGGCACACAGTAGG - Intergenic
1090064746 11:123493027-123493049 CGCTGTGCCTTGCACACAGTAGG + Intergenic
1090260301 11:125314551-125314573 ATCACTGACCTGCAGTCAGTGGG + Intronic
1090657400 11:128856450-128856472 CTCTCTGCCCTGCACTCTGAGGG - Intronic
1090837467 11:130463727-130463749 CACAGTTCCCTGAACACAGTGGG - Intronic
1090856881 11:130617540-130617562 TTCAGTGCCCAGAACACAGTAGG - Intergenic
1091614336 12:2037585-2037607 CTGCCTGACCTGCACAAAGTGGG - Intronic
1091703972 12:2681314-2681336 CACAGTGCCCAGCACACAGTCGG + Intronic
1091947644 12:4562542-4562564 CTCCCTGTCCTGCACTCAGCTGG - Intronic
1092034213 12:5316910-5316932 AGCAGTGCCCAGCACACAGTAGG + Intergenic
1092261305 12:6954690-6954712 CGCAGTGCCTGGCACACAGTAGG + Intronic
1093110239 12:15143524-15143546 CTCATTGCCATGCACATAGTAGG - Intronic
1094205132 12:27831717-27831739 AGCCCAGCCCTGCACACAGTGGG - Intergenic
1094493237 12:30974338-30974360 GAGACTGCCCTGCACCCAGTGGG + Intronic
1096105526 12:48995176-48995198 CACACTGCCTGGCACACAGTAGG - Exonic
1096421701 12:51464239-51464261 CACAGTGCCCTGAACAGAGTAGG + Intronic
1097285074 12:57870865-57870887 CACAGTGCCTGGCACACAGTAGG + Intergenic
1098078505 12:66759013-66759035 CTCACAGCTCTGCCCCCAGTAGG + Intronic
1098945530 12:76585153-76585175 AACACTGCCTTGCACACAGTAGG - Intergenic
1100040600 12:90312772-90312794 CACAATGCCCTGGACACAGTAGG - Intergenic
1100081444 12:90856651-90856673 ATCAATGCCATGCATACAGTTGG + Intergenic
1100402347 12:94243157-94243179 CTCTCTGCCCTACACAAATTGGG + Intronic
1100406051 12:94273709-94273731 TACAGTGCCCTGCACACAATAGG + Intronic
1100745112 12:97637066-97637088 TTAATTGCCCTGCACATAGTAGG + Intergenic
1101330632 12:103755156-103755178 CTCTGTGCCTGGCACACAGTAGG - Intronic
1101533081 12:105592519-105592541 CTCCCTTCCCTGCACACAAAGGG + Intergenic
1101836805 12:108301544-108301566 CTCAGTGCCTGGCACATAGTAGG + Intronic
1101849578 12:108391515-108391537 CTCAGTTCCTGGCACACAGTAGG - Intergenic
1101898117 12:108770650-108770672 CTCAGTGCCAAGCACATAGTAGG - Intergenic
1102531583 12:113550514-113550536 CACGGTGCCTTGCACACAGTAGG + Intergenic
1103294941 12:119877793-119877815 CTGACTGCCCTGCAAGGAGTTGG + Intergenic
1103708948 12:122896562-122896584 CTCAATGCCCAGTACAGAGTAGG - Intergenic
1103897954 12:124286368-124286390 CCCATTGACCGGCACACAGTAGG + Intronic
1103901321 12:124304898-124304920 CACAGGGCCCAGCACACAGTAGG + Intronic
1103909625 12:124345125-124345147 CTTACTGCCCTGCGCACCCTGGG + Intronic
1103941133 12:124501842-124501864 CCCAGAGCCCAGCACACAGTAGG + Intronic
1103978419 12:124719688-124719710 AACACTGCCTGGCACACAGTAGG - Intergenic
1104153982 12:126112733-126112755 CACAGTGCCCAGCACACAGTAGG - Intergenic
1104364105 12:128161593-128161615 CACAGTGCCTGGCACACAGTAGG - Intergenic
1104553639 12:129780217-129780239 CACAGTGCCCAGCACACAGCGGG - Intronic
1104588439 12:130065569-130065591 GTTACTGCACTGAACACAGTAGG + Intergenic
1104595934 12:130119963-130119985 CTCACAGGCATGCATACAGTGGG + Intergenic
1104653424 12:130555401-130555423 CTCACCGTCCTGGACACAGACGG + Intronic
1104963479 12:132498886-132498908 CTCTCTGCCCAGCCCCCAGTGGG - Intronic
1106556057 13:30809607-30809629 CACAGTGCCTGGCACACAGTAGG - Intergenic
1106569253 13:30912040-30912062 CCCAGTGCCCAGCACACAGTAGG + Intronic
1107428565 13:40317970-40317992 TTCAATGCCCTGAACACTGTTGG + Intergenic
1107662176 13:42650096-42650118 CTCAATGCTCTGCACACAGTGGG - Intergenic
1107987276 13:45786205-45786227 CTACCGGCCCTGCAGACAGTGGG - Intronic
1109538009 13:63741213-63741235 CTCACTACCCTCCTCACGGTGGG + Intergenic
1109538127 13:63741609-63741631 CTCACTACCCTCCTCGCAGTGGG + Intergenic
1109829992 13:67773304-67773326 CTCACTTCCCTGCAAGCAGAGGG + Intergenic
1110187586 13:72693104-72693126 CTCACTGCCCTGCGCAGCCTTGG + Intergenic
1110617132 13:77553758-77553780 ATTATTGCCCAGCACACAGTAGG - Intronic
1110679634 13:78293518-78293540 CTCTATTCCCTGCACACAGCAGG - Intergenic
1111055460 13:82943677-82943699 CTCAATTTCCTGCACACATTGGG + Intergenic
1111494804 13:89034177-89034199 CCCACTGCCCTGCACAGCTTTGG + Intergenic
1112315549 13:98359284-98359306 CCCACTGCCTGGCACACAGTGGG + Intronic
1115490277 14:33951597-33951619 CATAGTGCCTTGCACACAGTAGG - Intronic
1115704646 14:35986609-35986631 CTCAGTGCCTAGCACACAGTAGG + Intergenic
1115737641 14:36351831-36351853 TTAAGTGCCCTGCACATAGTGGG - Intergenic
1115750181 14:36481620-36481642 CACAATGCCTGGCACACAGTGGG + Intronic
1116478118 14:45365279-45365301 CTCACTGGCCTGCACTGAGGAGG - Intergenic
1117865827 14:60148178-60148200 TTCACTGTCCTGCAAAGAGTTGG + Exonic
1118037603 14:61884826-61884848 CTTTCTGCCCTACAAACAGTGGG - Intergenic
1120092877 14:80353723-80353745 CTAAGTGCCCTGAACACATTAGG - Intronic
1120228989 14:81822458-81822480 CTGGCTGCCCTCCACACAGTGGG + Intergenic
1120875747 14:89373670-89373692 CACAGTGCCTGGCACACAGTAGG + Intronic
1121436433 14:93923585-93923607 CTCTGGTCCCTGCACACAGTAGG + Intronic
1121504570 14:94466975-94466997 CTCTCTGTCCTGCATGCAGTTGG + Intronic
1121565348 14:94905369-94905391 CTCAGTGACCAGCACATAGTAGG + Intergenic
1121779671 14:96614156-96614178 CCCAGTGCCTGGCACACAGTAGG + Intergenic
1122049417 14:99045414-99045436 CCCAATGCCTAGCACACAGTGGG + Intergenic
1122171939 14:99883881-99883903 AACAATGCCCAGCACACAGTAGG + Intronic
1122191172 14:100044886-100044908 CTCACTGCACTGTCCCCAGTGGG - Intronic
1122292701 14:100688167-100688189 GCCACTGCCCTGCTCACAGCTGG + Intergenic
1122861669 14:104585243-104585265 CTCCCTGCCCTGCTCCCAGCTGG - Intronic
1122861892 14:104586518-104586540 CTCTCTGCCCTGCACACCCGCGG - Exonic
1122938180 14:104969544-104969566 CTCAGAGCCTGGCACACAGTAGG + Intronic
1122956708 14:105074647-105074669 CTCATTGCCCTTCACAGCGTGGG + Intergenic
1123019734 14:105392020-105392042 CTCTCAGCTCTGTACACAGTTGG + Intronic
1124031710 15:26018100-26018122 CCCAATGCCTGGCACACAGTTGG - Intergenic
1124213119 15:27780316-27780338 CTCCCTCCCCTGACCACAGTTGG + Intronic
1125089933 15:35778576-35778598 ACCAGTGCACTGCACACAGTAGG - Intergenic
1125180431 15:36877199-36877221 GGGACTGCCCTGAACACAGTCGG - Intergenic
1125416330 15:39457309-39457331 CTCACTGCTCTGCACACACCAGG + Intergenic
1125608167 15:40953823-40953845 CTCACTCCCCTGGGCACGGTTGG - Intronic
1126229761 15:46311052-46311074 CACGATGCCTTGCACACAGTGGG - Intergenic
1127053126 15:55105616-55105638 ATCATTGCCCTGAACACAGTTGG - Intergenic
1127398112 15:58559354-58559376 AACAGTGCCTTGCACACAGTAGG - Intronic
1127620184 15:60726429-60726451 CAAACTGCCTTGCACACAGTAGG - Intronic
1128258626 15:66216470-66216492 CCCAGTACCCTGCACACAGCTGG + Intronic
1128801045 15:70497314-70497336 CCCAGAGCCCTGCATACAGTAGG + Intergenic
1129242869 15:74261872-74261894 CCCAAGGCCCTGCACACAGCAGG + Intronic
1129243744 15:74267554-74267576 CTCACTACCTGGCACATAGTAGG - Intronic
1129454248 15:75667971-75667993 CTCAGTGCCCGACACATAGTAGG - Intergenic
1129704179 15:77785170-77785192 CTCAGGGCCTGGCACACAGTGGG + Intronic
1129836391 15:78709970-78709992 CTCTGTGCCCAGTACACAGTAGG - Intronic
1130217135 15:81983028-81983050 CACACTGGCCTGCACTTAGTAGG - Intergenic
1130256930 15:82330121-82330143 CACCCACCCCTGCACACAGTGGG + Intergenic
1130550710 15:84888578-84888600 GGCAGAGCCCTGCACACAGTAGG + Intronic
1130598018 15:85259867-85259889 CACCCACCCCTGCACACAGTGGG - Intergenic
1130971742 15:88739235-88739257 TACAGTGCCCTGCACACAGTAGG + Intergenic
1131118429 15:89808456-89808478 CACAGTGCCTGGCACACAGTAGG + Intronic
1131150819 15:90046271-90046293 CTCAGTGCCCAGCCCATAGTAGG + Intronic
1131197248 15:90365519-90365541 CACAGTGCCCAGCACGCAGTAGG + Intronic
1131718665 15:95142770-95142792 CTCCCTGCCCTGCCAACAGTTGG + Intergenic
1131810417 15:96167613-96167635 CTCAGTGCCTTGTACATAGTAGG - Intergenic
1132019707 15:98349961-98349983 CACACTGCCTGGCACATAGTAGG - Intergenic
1132026731 15:98410165-98410187 CTCATTGCCTGGCACATAGTTGG + Intergenic
1132144586 15:99421397-99421419 CACACTGCCCTGCAAAAAGGAGG + Intergenic
1132232706 15:100196025-100196047 CACAGTACCCTGCACATAGTAGG + Intronic
1132240892 15:100256401-100256423 CTCACAGCCAGGCATACAGTTGG + Intronic
1132411205 15:101579357-101579379 CTCACTTCCCTGCACAGAGCAGG + Intergenic
1133261392 16:4552988-4553010 CACAGATCCCTGCACACAGTAGG - Intergenic
1133285995 16:4691101-4691123 CTCACTGCCCTGACCCCAGAGGG - Intergenic
1133323615 16:4930321-4930343 CTCACCGTCCTGCACGCAGGAGG + Intronic
1133345080 16:5064538-5064560 CTCAGTGCCATGCAGCCAGTTGG + Intronic
1133346250 16:5072474-5072496 ACCGCTGCCCTGCACACTGTGGG - Intronic
1133600878 16:7339272-7339294 TTCACAGCCTGGCACACAGTAGG - Intronic
1133759674 16:8788428-8788450 ATAATTGCCCAGCACACAGTAGG + Intronic
1133825879 16:9277889-9277911 CTCAGAGGCCAGCACACAGTAGG - Intergenic
1133989138 16:10691359-10691381 CTCTTGGCCCTTCACACAGTTGG - Intronic
1134018763 16:10907323-10907345 CACACTGCCCGGCACAAAGTAGG - Exonic
1134216489 16:12320628-12320650 CACACTGCCTGGAACACAGTGGG - Intronic
1134685792 16:16157380-16157402 CACACTGCCCAGCACATATTAGG + Intronic
1134756305 16:16670517-16670539 CACAGTGCCCAGCACATAGTAGG + Intergenic
1134989765 16:18688647-18688669 CACAGTGCCCAGCACATAGTAGG - Intergenic
1135142135 16:19930970-19930992 CAAAATGTCCTGCACACAGTAGG - Intergenic
1136013800 16:27382326-27382348 GGCAGTGCCTTGCACACAGTAGG - Intergenic
1136031127 16:27503924-27503946 CCCACTTCCCTGCCCACTGTGGG + Intronic
1136034095 16:27525652-27525674 CTCAGTGCCCTGCAGAAGGTAGG - Intronic
1136039144 16:27564231-27564253 AACAGTGCCCTGCATACAGTAGG - Intronic
1136127430 16:28194392-28194414 CTTACTGTCCTGAACACAGATGG - Intronic
1136470230 16:30474640-30474662 GCCACCGCCCAGCACACAGTAGG + Intronic
1136540728 16:30926451-30926473 CACAAGGCCCAGCACACAGTAGG + Intronic
1136628306 16:31474971-31474993 CACAGTGCCTGGCACACAGTAGG - Intronic
1137035910 16:35569755-35569777 CCTCATGCCCTGCACACAGTGGG - Intergenic
1137539337 16:49351330-49351352 CTCAGTGCCTGGCACGCAGTAGG + Intergenic
1137577972 16:49616134-49616156 CTTACTGCCTGGCACACAGTAGG + Intronic
1137627760 16:49920388-49920410 CTCAGTGCCCAGCACATAGTAGG - Intergenic
1137645277 16:50067794-50067816 CTCAGTGTCTGGCACACAGTTGG - Intronic
1138088466 16:54155066-54155088 CTCACTGCCTGGCATGCAGTAGG - Intergenic
1138553578 16:57759833-57759855 CGCCCTTCCCTGCTCACAGTGGG - Exonic
1138965720 16:62081732-62081754 CTCACTGTCCTTCACAGATTGGG - Intergenic
1139657324 16:68396945-68396967 CACAGTGCCTGGCACACAGTGGG - Intronic
1139774839 16:69310667-69310689 CACACAACGCTGCACACAGTAGG + Intronic
1140239133 16:73185243-73185265 CCCACTTCCCGGCACATAGTAGG - Intergenic
1140241287 16:73203231-73203253 CTTACTGCCAGGCACTCAGTAGG + Intergenic
1140771688 16:78211383-78211405 ATCAGTGCTCAGCACACAGTAGG - Intronic
1140813129 16:78597309-78597331 TACAGTGCCCGGCACACAGTAGG - Intronic
1141134046 16:81454213-81454235 CACTGTGCCCGGCACACAGTAGG - Intronic
1141203454 16:81914610-81914632 CACAGGGCCCGGCACACAGTAGG - Intronic
1141323577 16:83035199-83035221 CCCACTTGGCTGCACACAGTAGG - Intronic
1141423329 16:83931026-83931048 CACAGGGCCCTGCACACGGTAGG - Intronic
1141474698 16:84264998-84265020 CTCACTACCATGAACACAGTAGG + Intergenic
1141636174 16:85315101-85315123 CTGCCCGCCCTGGACACAGTGGG + Intergenic
1141651054 16:85393466-85393488 CACAGTACCCAGCACACAGTAGG + Intergenic
1141780214 16:86154465-86154487 CCCAAGGCCTTGCACACAGTAGG - Intergenic
1141992650 16:87619511-87619533 CACAGTGCCATGCACACAGTAGG + Intronic
1142007906 16:87698812-87698834 CCTGCTTCCCTGCACACAGTCGG + Intronic
1142013302 16:87728595-87728617 CTCACTGTCCTACACATAGTAGG + Intronic
1142144929 16:88488981-88489003 CTCAGTGCCCGGCACTCAGCAGG + Intronic
1143248368 17:5504172-5504194 CACAGTTCCCAGCACACAGTCGG - Intronic
1143273628 17:5693945-5693967 CTCAGTGCCCAGCACAAGGTGGG + Intergenic
1143493301 17:7296093-7296115 TTTATTTCCCTGCACACAGTGGG + Intergenic
1144366966 17:14553985-14554007 CCCACTGCTTTGCATACAGTAGG + Intergenic
1144452088 17:15389639-15389661 CTTCCTGCCTTGCACACAGCAGG + Intergenic
1144624390 17:16837402-16837424 CACAGTGCCAGGCACACAGTAGG - Intergenic
1144759399 17:17698820-17698842 CTCAGTGCCTGGCACACAGTAGG - Intronic
1144781837 17:17812306-17812328 CTCTCTTCCCTGTACACAGGAGG + Exonic
1144965546 17:19075246-19075268 AACAGTGCCTTGCACACAGTAGG - Intergenic
1144982421 17:19176937-19176959 AACAGTGCCTTGCACACAGTAGG + Intergenic
1144985802 17:19201302-19201324 AACAGTGCCTTGCACACAGTAGG - Intergenic
1145260841 17:21353615-21353637 CACAGTGCCTGGCACACAGTAGG - Intergenic
1146378575 17:32311803-32311825 ACCACTGCCTGGCACACAGTAGG - Intronic
1146380942 17:32326979-32327001 CTCAGTGCCTAGCACATAGTAGG - Intronic
1146475738 17:33161244-33161266 CACACTGCCTGGCATACAGTAGG - Intronic
1146491330 17:33284977-33284999 CTCAGTGCCTGGCACACAGTAGG + Intronic
1146712276 17:35052698-35052720 TTCAGTTCCCTGCACATAGTGGG - Intronic
1146720299 17:35119323-35119345 CGCGGTGCCCTGCACACAGTAGG + Intronic
1146905274 17:36614022-36614044 CACAGTGCCCGGGACACAGTAGG + Intergenic
1146922849 17:36724981-36725003 TTTAGTGCCTTGCACACAGTGGG + Intergenic
1146972870 17:37086806-37086828 CTCTTAGCCCAGCACACAGTAGG - Exonic
1147177877 17:38667876-38667898 ATCAGTGCCTTGCACACAGCAGG - Intergenic
1147536916 17:41327449-41327471 CTCAGTGCTGTGCACACAGGAGG + Intergenic
1147987170 17:44313278-44313300 CTCTCTGCTCTGGACACAGGGGG + Intronic
1148187328 17:45654166-45654188 CCCAATGCCTTGCACACAGTGGG - Intergenic
1148788086 17:50155731-50155753 CTCAGTGCCCAGCACGCAGGTGG + Intergenic
1148995093 17:51702616-51702638 GTGAGTGCCATGCACACAGTGGG - Intronic
1149183162 17:53964587-53964609 CTCAGAGCTCGGCACACAGTAGG + Intergenic
1149394507 17:56225573-56225595 CACAGTGCCTTGCACATAGTAGG + Intronic
1149544028 17:57489730-57489752 CACTGTGCCCAGCACACAGTGGG - Intronic
1150296243 17:64009155-64009177 GACACTGCCTGGCACACAGTAGG + Intronic
1150494837 17:65599369-65599391 CACAGTGCCCAGCACATAGTAGG - Intronic
1150659295 17:67061524-67061546 CTCTCTGGCCAGCACACGGTAGG + Intergenic
1150859521 17:68786927-68786949 CTCACTGCGCTTCACACACTGGG - Intergenic
1151257712 17:72891955-72891977 CACAGTGTCCAGCACACAGTAGG + Intronic
1151272922 17:73010988-73011010 CACAGTGCCCGGCACAGAGTAGG - Intronic
1151566261 17:74900240-74900262 CACACTGCCCTGTACCCAGCCGG + Intergenic
1151718277 17:75842579-75842601 CTCAATGCCCAGCAGGCAGTAGG + Exonic
1152646569 17:81471673-81471695 CTCACTGCTCTGCTCACCGCCGG - Intergenic
1152921912 17:83070090-83070112 CTCCCAGCCCTGCACACACGGGG - Intergenic
1153721280 18:7905955-7905977 CCCACTGCCATACACACATTTGG - Intronic
1154477388 18:14776225-14776247 CTCACTGCCTAGCACACAGTTGG - Intronic
1154482010 18:14839110-14839132 CTCACTGCCTAGCACACAGTTGG - Intronic
1155164167 18:23219148-23219170 GGCAGTGCCCAGCACACAGTAGG - Intronic
1155492039 18:26408888-26408910 CTCAATGCTCTGGTCACAGTGGG + Intergenic
1155505725 18:26530741-26530763 CACAGTGCCAGGCACACAGTAGG + Intronic
1155919949 18:31593599-31593621 CCCCCAGCCTTGCACACAGTAGG - Intronic
1156495178 18:37520802-37520824 CACACTGCTATGCTCACAGTAGG + Intronic
1156615867 18:38783524-38783546 CTCACTGCCCTGAACAGCCTCGG - Intergenic
1157359403 18:46964019-46964041 CTCACAGCCCTGAGCACAGACGG - Exonic
1157360997 18:47023538-47023560 CTCACAGCCCTGAGCACAGACGG - Exonic
1157361987 18:47029453-47029475 CTCACAGCCCTGAGCACAGACGG - Exonic
1157362865 18:47034875-47034897 CTCACAGCCCTGAGCACAGACGG - Exonic
1157482198 18:48062502-48062524 CTCAATACCTGGCACACAGTAGG - Intronic
1157517867 18:48323712-48323734 CTCACTGCACAGCCCACAGTAGG - Intronic
1158489643 18:57898456-57898478 CTCACTGCCTGGCATATAGTAGG + Intergenic
1159125630 18:64220764-64220786 CACACTGCCTGGCACATAGTAGG - Intergenic
1159329788 18:66977338-66977360 CTCACTGAACTGCTCACTGTAGG - Intergenic
1159967757 18:74612635-74612657 ATCAGTGCCTGGCACACAGTAGG - Intronic
1160578219 18:79869090-79869112 CACACAGCCCTGCAGACACTGGG + Intronic
1160659894 19:293043-293065 CTTGCTCCCCAGCACACAGTAGG - Intergenic
1160702859 19:517039-517061 AACACTGCCCTGCCCACAGTAGG - Intronic
1160919864 19:1514270-1514292 TTCACAGCTGTGCACACAGTAGG - Intergenic
1160942015 19:1624692-1624714 CTCACGGACGTGCGCACAGTGGG + Intronic
1161214240 19:3085327-3085349 CCCAGTTCCCGGCACACAGTAGG + Intergenic
1161609644 19:5234742-5234764 CACAGTGCCTGGCACACAGTAGG - Intronic
1161609762 19:5235768-5235790 CATACTGCCTGGCACACAGTAGG - Intronic
1162046602 19:8004760-8004782 CCACCTGCCCTGCACACAGTAGG + Intronic
1162445631 19:10720764-10720786 CGCACTGCCTGGCACATAGTAGG + Intronic
1162538388 19:11277715-11277737 CACACAGCCTGGCACACAGTAGG + Intergenic
1162774519 19:12971101-12971123 CCCACTGCCTGGCACAAAGTAGG - Intronic
1162840637 19:13354073-13354095 ATCATTGCCTGGCACACAGTAGG + Intronic
1162858142 19:13485018-13485040 CTCAGTGCCTGGCACACAGTTGG + Intronic
1163373397 19:16914983-16915005 CACATTGCCCAGCACCCAGTGGG + Intronic
1163485356 19:17582338-17582360 CTCAGCTCCCTGCACACAGCAGG - Exonic
1163571493 19:18084857-18084879 CTCTCTGCCCTCCAGACTGTTGG - Intronic
1164509096 19:28882939-28882961 CGCAGGGCCCAGCACACAGTCGG - Intergenic
1164680990 19:30133651-30133673 CTCAGTGCCTGGCATACAGTAGG - Intergenic
1164707579 19:30331856-30331878 CCCGCTGCCCTTCACCCAGTGGG + Intronic
1164954060 19:32365851-32365873 CACACTGCCCGGGACATAGTAGG + Intronic
1165113668 19:33516052-33516074 CTCAGAGCCCTGCACAGGGTGGG - Intronic
1165114508 19:33521132-33521154 CCCGGTGCCTTGCACACAGTAGG - Intronic
1165894620 19:39134008-39134030 CTCCCTGCCCTCCCCACAGGAGG + Intronic
1166668681 19:44697158-44697180 CGCAGTGCCCGGCACATAGTTGG + Intergenic
1166895972 19:46022150-46022172 CACACTGCCTGGCACATAGTAGG + Intronic
1167062535 19:47158693-47158715 CACAGTGCCTTGCACACAGTAGG - Intronic
1167194679 19:48019953-48019975 CTCAGTGCCTGGCTCACAGTGGG - Intronic
1167211125 19:48134807-48134829 CTCTCTGCTCAGCACCCAGTGGG + Intronic
1167556819 19:50201944-50201966 CTCAGTGCCTGGCACACAGTAGG - Intronic
1167608285 19:50493314-50493336 CTTCCTGCCCTGCAGACACTTGG - Intergenic
1167746828 19:51356582-51356604 CTCAGAGCCAGGCACACAGTGGG - Exonic
1168252722 19:55149493-55149515 CCCCATGCCCGGCACACAGTAGG + Intergenic
1168303913 19:55423732-55423754 TTGCCCGCCCTGCACACAGTGGG + Intergenic
925005022 2:436345-436367 CTCATATCCATGCACACAGTGGG - Intergenic
925005092 2:436906-436928 CTCATATCCATGCACACAGTGGG - Intergenic
925005128 2:437281-437303 CTCATGTCCATGCACACAGTGGG - Intergenic
925005131 2:437306-437328 CTCACATCCATGCACATAGTGGG - Intergenic
925005137 2:437355-437377 CTCATATCCATGCACACAGTGGG - Intergenic
925005141 2:437404-437426 CTCATATCCATGCACACAGTGGG - Intergenic
925005146 2:437454-437476 CTCACATCCATGCACACAGTGGG - Intergenic
925005149 2:437479-437501 CTCACATCCATGCACACAGTGGG - Intergenic
925039560 2:720757-720779 CTCACTCCCCTGCACAAAACAGG + Intergenic
925082486 2:1081216-1081238 CCCACTCCGCTGCACACAGAGGG - Intronic
925735668 2:6961448-6961470 CACAGTGCCCTGGACACAGAAGG - Intronic
925753987 2:7116353-7116375 CTCAGTGCCCTGCACATAGTAGG - Intergenic
926000585 2:9329012-9329034 CACAGTGCCCGGAACACAGTAGG + Intronic
926060076 2:9799752-9799774 CTCAGTGTCTTGCACACAGTGGG + Intergenic
926696388 2:15772295-15772317 CTCATTTCCCTCCTCACAGTTGG - Intergenic
926735071 2:16067696-16067718 CTCCCTGTCCAGCGCACAGTAGG - Intergenic
927041641 2:19236635-19236657 CTCAATGCCTTGCACTTAGTTGG + Intergenic
927054083 2:19354109-19354131 CTCAGTGTCTTGCATACAGTAGG - Intronic
927095389 2:19744465-19744487 CTCAGTATCTTGCACACAGTAGG - Intergenic
927203680 2:20593730-20593752 CACAGTTCCCTGCACACACTCGG - Intronic
927250670 2:20992615-20992637 CACACTGCCCAGCACACAGTAGG - Intergenic
927324145 2:21783711-21783733 CTCAGTGAGTTGCACACAGTAGG - Intergenic
927515491 2:23669544-23669566 CACAGGGCCCGGCACACAGTGGG + Intronic
927647643 2:24888076-24888098 AACACTGCCTTGTACACAGTAGG + Intronic
927719622 2:25374187-25374209 CTTCGTGCCCAGCACACAGTTGG + Intergenic
928097132 2:28411666-28411688 CACTGTGCCCTGCACAAAGTAGG + Intronic
928200500 2:29244975-29244997 CTCAGTGCCTGGCACACAGTAGG + Intronic
928200509 2:29245040-29245062 GACAGTGCCCTTCACACAGTTGG + Intronic
928200515 2:29245073-29245095 CTCACTGCCCTGCACACAGTAGG + Intronic
928200522 2:29245106-29245128 CTCAGTGCCCTGCACACAGTTGG + Intronic
928200531 2:29245171-29245193 CTCAGTGCCCTGCACACAGTAGG + Intronic
928200537 2:29245204-29245226 CTCAGTGTCCTGCACATAGTAGG + Intronic
928200543 2:29245237-29245259 CTCAGTGCCCTGCACACAGTAGG + Intronic
928200549 2:29245270-29245292 CTCAATGCCCTGCACACAGCAGG + Intronic
928200555 2:29245302-29245324 CTCAGTGCCCTGCACACAGTAGG + Intronic
928200562 2:29245335-29245357 CTCAGTGCCCTGCACACAGTAGG + Intronic
928200569 2:29245368-29245390 CTCAGTGCCCTGCACACAGTAGG + Intronic
928200576 2:29245401-29245423 CTCAGTGCCCTGCACGTAGTAGG + Intronic
928200583 2:29245434-29245456 CTCAGTGCCCTGCACGTAGTAGG + Intronic
928200590 2:29245467-29245489 CTCAGTGCCCTGCACACAGTAGG + Intronic
928200595 2:29245500-29245522 CTCAGTGCCCTGCACATAGTAGG + Intronic
928200601 2:29245533-29245555 CTCAGTGCCCTGCACAAAGTAGG + Intronic
928200606 2:29245565-29245587 CTCAATGCCCTGCACACAGCAGG + Intronic
928200612 2:29245597-29245619 CTCAGTGCCCTGCACACAGTAGG + Intronic
928200618 2:29245630-29245652 CTCAGTGCCCTGCACATAGTAGG + Intronic
928200625 2:29245663-29245685 CTCAGTGCCCTGCACACAGTAGG + Intronic
928200631 2:29245696-29245718 CTCAATGCCCTGCACACAGCAGG + Intronic
928200638 2:29245728-29245750 CTCAGTGCCCTGCACACTAAGGG + Intronic
928200642 2:29245759-29245781 CTCAGTGCCCTGCACACAGTAGG + Intronic
928200648 2:29245792-29245814 CTCAGTGCCCTGCACATAGTAGG + Intronic
928200654 2:29245825-29245847 CTCAGTGCCTTGCACACAGTTGG + Intronic
928200660 2:29245858-29245880 CTCAGTGCCCTGCACACAGTAGG + Intronic
928233993 2:29524209-29524231 CACACTGCCTAGCACATAGTAGG - Intronic
929417691 2:41760620-41760642 CTCAGTGCCATGCACATAATGGG + Intergenic
929611067 2:43270988-43271010 CCCACTGGCCTGCTCAGAGTGGG + Intronic
929660611 2:43780522-43780544 CTCACTACCCTACATACATTAGG - Intronic
929923085 2:46187206-46187228 CCCACTGCCGTGCAAACACTAGG - Exonic
930330234 2:49974161-49974183 ATCAGTGCCCTGCACACAGATGG + Intronic
932099134 2:68880568-68880590 CTCAGTGCCTGGCACAGAGTAGG - Intergenic
932217382 2:69975688-69975710 CACAGTGCCCAGCACGCAGTAGG + Intergenic
933156751 2:78983961-78983983 GGGACTGCCCTGCACACTGTAGG + Intergenic
933612581 2:84452789-84452811 GTCAGTGCCTTACACACAGTAGG + Intronic
933629504 2:84639742-84639764 CACAGTGCTCTGCACACAGTAGG - Intronic
933759464 2:85663902-85663924 CTCTCTGCCCAGCACCCAGCTGG + Intronic
933940269 2:87239423-87239445 CACAGTACCCTGCACAGAGTGGG - Intergenic
934855310 2:97725579-97725601 CTCAGTGCCTGGTACACAGTAGG - Intronic
935336290 2:102020406-102020428 CTCCATGTCCGGCACACAGTTGG - Intronic
936352869 2:111726353-111726375 CACAGTACCCTGCACAGAGTGGG + Intergenic
936387994 2:112047591-112047613 CACTCTGCCCTGCGCATAGTGGG + Intergenic
936594941 2:113838998-113839020 CTCCCTACCCCGGACACAGTAGG - Intergenic
937102960 2:119285844-119285866 CTCCATGGCCTGCACACACTGGG - Intergenic
937120639 2:119438012-119438034 CAGAATGCCCTGCACACAGTAGG + Exonic
937249446 2:120514346-120514368 CTCACGGCCTGGCACACAGTAGG + Intergenic
937287717 2:120763629-120763651 CCCACTCCCCTGCAGACAGAGGG + Intronic
937662458 2:124446247-124446269 CTAAGTGCCGTGCATACAGTAGG + Intronic
938064058 2:128271666-128271688 CTCACCCTCCTGCTCACAGTGGG + Intronic
938650460 2:133377690-133377712 CACACTGCTTTGCACACGGTAGG - Intronic
938900117 2:135792527-135792549 ATCTCTGCCCTGCGCACTGTTGG + Intronic
940134879 2:150424990-150425012 CACAGTGCCTGGCACACAGTGGG - Intergenic
940522229 2:154765496-154765518 CATACTGCCTTGCACATAGTTGG + Intronic
942367584 2:175243905-175243927 TTTAGTGCCTTGCACACAGTAGG + Intergenic
942574444 2:177348663-177348685 CCCAATGCCCAGCACACAATGGG - Intronic
943481666 2:188427492-188427514 CTTGCTGCCCTGCACAGACTTGG + Intronic
943702104 2:190997430-190997452 TACAGTGCCCGGCACACAGTAGG + Intronic
944158770 2:196637342-196637364 TACAATGCCCGGCACACAGTAGG - Intergenic
944298621 2:198096065-198096087 CACACTGCCTTGCACATAGTAGG - Intronic
944318315 2:198307114-198307136 CCCAGTGCCTGGCACACAGTGGG - Intronic
944318751 2:198311523-198311545 CTCTGTGCCCTGCACACATCAGG + Intronic
944987851 2:205199152-205199174 TGCACTTCCCGGCACACAGTAGG - Intronic
945373176 2:209046839-209046861 CTAAATGCCCTGCACACAGCAGG + Intergenic
945539820 2:211071489-211071511 CTCCCAGCCCAGCATACAGTGGG + Intergenic
945681814 2:212923284-212923306 CACTGTGCCCTGCACACAGTAGG + Intergenic
945871448 2:215231160-215231182 CTCAATGCCTAGCACACAGTAGG + Intergenic
946175039 2:217917320-217917342 CCCGCTGCCTTGCACACGGTAGG - Intronic
946827311 2:223692016-223692038 ATCATTACCTTGCACACAGTTGG + Intergenic
946876773 2:224137390-224137412 CTCAGTGCCCTGGACTCAGGAGG - Intergenic
947640543 2:231705533-231705555 CTCACTGCCATGTACACAGCGGG + Intergenic
947813480 2:233020555-233020577 CACAGGGCCCAGCACACAGTGGG - Intergenic
948172376 2:235915055-235915077 CTCACAGCCCCCCACACGGTAGG + Intronic
948304719 2:236938076-236938098 TTCAGTGCCTGGCACACAGTAGG - Intergenic
948466663 2:238155471-238155493 CCCTCTGCCCTGAAAACAGTGGG - Intergenic
948584028 2:239007399-239007421 CCCTCTGCCTTGCACACCGTGGG + Intergenic
948671133 2:239569605-239569627 CTCACTTCCCTGCATTCTGTGGG - Intergenic
948845399 2:240680566-240680588 CTCCCAGGCCTGCACACAGTGGG - Intronic
948848462 2:240694313-240694335 CTCCCAGGCCTGCACACAGTGGG + Intronic
1168851231 20:978453-978475 CCCACGGCCCTGCACATTGTAGG + Intronic
1168862038 20:1052537-1052559 CTCAGTGCCTGGCACACAGTGGG - Intergenic
1168886792 20:1265948-1265970 CTCACTCCCTGGCACATAGTTGG - Intronic
1168928741 20:1604312-1604334 CACAACGCCCAGCACACAGTAGG + Intronic
1168936508 20:1670413-1670435 CACAACGCCCAGCACACAGTAGG + Intergenic
1168969638 20:1922120-1922142 CACAACGCCCAGCACACAGTAGG - Intronic
1169300468 20:4437736-4437758 TTCAATGCCTGGCACACAGTCGG - Intergenic
1169924575 20:10769415-10769437 CTCAATGCATTGCACACAGCTGG + Intergenic
1169981696 20:11392020-11392042 AACACTGCCCAGCACATAGTAGG - Intergenic
1170312029 20:15002729-15002751 CTCAGTGCCCTGAAGACAATTGG + Intronic
1170530871 20:17290218-17290240 ATCACTGCCTGGCACACAGTAGG + Intronic
1170532926 20:17312614-17312636 TGCACTGTTCTGCACACAGTAGG + Intronic
1170583335 20:17715361-17715383 CTCAAGGCCTTGCACACAGATGG + Intronic
1172007552 20:31827841-31827863 CTCACTACCATGCACATGGTAGG + Intronic
1172010351 20:31842821-31842843 CACCATGCCCTGCACACAGAGGG + Intergenic
1172120586 20:32596451-32596473 CACAGTGCCCGGCACATAGTAGG + Intronic
1172212975 20:33213949-33213971 CACAGTGCCTGGCACACAGTTGG + Intergenic
1172303980 20:33868713-33868735 CACAGTGCCCAGCACACAGTAGG + Intergenic
1172304103 20:33869483-33869505 CGTGGTGCCCTGCACACAGTAGG - Intergenic
1172662437 20:36576393-36576415 CTCACTGCAAGGTACACAGTAGG + Intronic
1172801310 20:37578250-37578272 CGCTGTGCCCAGCACACAGTAGG - Intergenic
1172817108 20:37696127-37696149 TAGACTGCCTTGCACACAGTAGG - Intronic
1172941119 20:38655494-38655516 CCCAGTGCCAGGCACACAGTAGG - Intergenic
1173171948 20:40733642-40733664 GTCAGTGCTTTGCACACAGTAGG - Intergenic
1173186346 20:40843359-40843381 CTCAAGGCCCTGCACACACAGGG + Intergenic
1173236875 20:41254417-41254439 CTCAGTGCCTGCCACACAGTTGG + Intronic
1173518643 20:43682898-43682920 GACAGTGCCTTGCACACAGTGGG + Intronic
1173560436 20:44001375-44001397 CTCAGTGCCTGGCACATAGTAGG + Intronic
1173791464 20:45830507-45830529 CTCCCTGGTCTGGACACAGTGGG - Intronic
1173839375 20:46147382-46147404 CTCAGGGCCTGGCACACAGTAGG - Intergenic
1173861715 20:46288117-46288139 CTCACAGGCCTCCACACATTGGG - Intronic
1173878060 20:46388911-46388933 CACACTGCTCTGCACACAGGTGG + Intronic
1173896480 20:46554885-46554907 CTCCCTGCCCTGCACCCGGGAGG + Intergenic
1173953611 20:47013127-47013149 CTCCCTGTCTTGCACATAGTAGG - Intronic
1174202930 20:48819807-48819829 CACAGTGCCTGGCACACAGTGGG + Intronic
1174265015 20:49325068-49325090 CCCAGTGCTCTGCACACAGTAGG + Intergenic
1174348419 20:49948990-49949012 CTCACTTCTCTGCTTACAGTAGG + Intronic
1174391850 20:50222681-50222703 CACAGGGCCCCGCACACAGTAGG + Intergenic
1174392378 20:50225879-50225901 ACCACTGCTTTGCACACAGTAGG + Intergenic
1174393615 20:50233115-50233137 CCCACAGCCCAGCACACAGTAGG + Intergenic
1174414146 20:50356261-50356283 CTTGGTGCCCTGCACACAGTAGG - Intergenic
1174431346 20:50472017-50472039 CACAGTGCCTTGCACACAGGAGG - Intergenic
1174506738 20:51022357-51022379 CCCAGTGCCTAGCACACAGTAGG + Intronic
1174572144 20:51509379-51509401 CCCAGTGCCAAGCACACAGTAGG + Intronic
1174580608 20:51568913-51568935 CACAGTGCCCAGTACACAGTAGG + Intergenic
1174718538 20:52786058-52786080 CTCAGTGTCAGGCACACAGTAGG - Intergenic
1174735908 20:52965562-52965584 AGCACTGCCCTGCACAAGGTAGG + Intergenic
1175169983 20:57073600-57073622 CACAGTGCCCGGCACACAGGAGG + Intergenic
1175226764 20:57449208-57449230 CTCCCTCCCTTGCTCACAGTGGG + Intergenic
1175271275 20:57735719-57735741 AACACTGCTCAGCACACAGTAGG - Intergenic
1175550874 20:59816663-59816685 CTCAGTGCCTGGTACACAGTAGG + Intronic
1175594885 20:60223082-60223104 CACACTGCCCAGCACAGAGTAGG - Intergenic
1175762210 20:61568932-61568954 TTCAGTGCCTGGCACACAGTAGG + Intronic
1175824764 20:61930900-61930922 CTCACAGCCCTGCCCACAGAGGG - Intronic
1175975182 20:62707502-62707524 CTCCCAGCCCTGCACACATGGGG + Intergenic
1176310208 21:5145326-5145348 TTCAGAGCCCTGCACACAGCAGG + Intronic
1176798594 21:13397507-13397529 CTCACTGCCTAGTACACAGCTGG + Intergenic
1177131345 21:17259943-17259965 CTTAGTGTCCTGCACACAGCTGG + Intergenic
1177169611 21:17640722-17640744 CCCACTGCCCTGCACAGCCTCGG - Intergenic
1177835767 21:26184748-26184770 CCCACTGCCCTGCACAGCCTTGG - Intergenic
1178290048 21:31359349-31359371 GACACTGCCTAGCACACAGTAGG + Intronic
1178915410 21:36703110-36703132 CTCACTCCACTGCACCCAGGAGG + Intronic
1179269968 21:39843337-39843359 CACAGTGCCCTCCACACAGATGG - Intergenic
1179351104 21:40611705-40611727 AAAACTGTCCTGCACACAGTTGG - Intronic
1179726196 21:43342861-43342883 CCCTCTGCCCTGCACTCAGTTGG + Intergenic
1179846848 21:44116710-44116732 TTCAGAGCCCTGCACACAGCAGG - Intronic
1179961269 21:44768116-44768138 CTCACTCCCCTGCAAGCAGCTGG - Intergenic
1180594682 22:16965381-16965403 CTCAGTCCCCCGCACACAGCTGG - Intronic
1181526729 22:23493769-23493791 CTCTCTGCCCTGTAGACACTGGG + Intergenic
1181683533 22:24513132-24513154 CACATTGTCCTGTACACAGTTGG - Intronic
1181765007 22:25085170-25085192 CACAGTGCCCAGCACAGAGTAGG - Intronic
1181784892 22:25219872-25219894 CACAGTGCCTGGCACACAGTGGG + Intronic
1181873824 22:25924375-25924397 CACACTGCCTGACACACAGTAGG - Intronic
1181930655 22:26398727-26398749 CACAGTGCCCAGCACAGAGTAGG + Intergenic
1182083612 22:27546109-27546131 CACACTGCCCAGCACATAGTAGG - Intergenic
1182125780 22:27814969-27814991 ATTACTGCCCAGCACATAGTAGG - Intergenic
1182598318 22:31439867-31439889 CTGCCTGCCCTGCTCACTGTCGG + Exonic
1182663845 22:31943760-31943782 CTCACTACCCAGCCCACAGTGGG - Intronic
1183043400 22:35200504-35200526 CAGACTGCTCTGCATACAGTAGG - Intergenic
1183065425 22:35359540-35359562 CTCAGAGCCTAGCACACAGTAGG - Intergenic
1183233289 22:36596559-36596581 CCCAGTGCCTAGCACACAGTAGG - Intronic
1183262697 22:36806089-36806111 CACAGTGCCTGGCACACAGTGGG + Intronic
1183326513 22:37197487-37197509 AACACTGCCAGGCACACAGTTGG - Intronic
1183363407 22:37394596-37394618 CTCCCGCCCCGGCACACAGTAGG + Intronic
1183429039 22:37754787-37754809 CTCACTATGCTGCACACAGGAGG - Intronic
1183486248 22:38089099-38089121 CTCCCTGCCCCGCACGCCGTCGG - Exonic
1183608339 22:38880227-38880249 CACAGGGCCCTGCACACAGTAGG + Intergenic
1183669515 22:39264273-39264295 CACCGTGCCCAGCACACAGTGGG - Intergenic
1183720910 22:39560759-39560781 CTGTGTGCCCTGCACACTGTGGG + Intergenic
1184067069 22:42127072-42127094 CACACTGCCTGGCACACAGCTGG + Intronic
1184069794 22:42140776-42140798 CACACTGCCTGGCACACAGCTGG + Intergenic
1184071536 22:42150378-42150400 CACACTGCCTGGCACACAGCTGG + Intergenic
1184272101 22:43390340-43390362 CACAGTGCCCGGCACATAGTAGG + Intergenic
1184493585 22:44824530-44824552 CACAGTGCCCGGCACATAGTAGG + Intronic
1184797957 22:46742638-46742660 TTCACTGCCTTGCACCCTGTTGG + Intergenic
1185122644 22:48981736-48981758 CCCACTGCCCTGTGCACAGACGG - Intergenic
949839202 3:8301903-8301925 CTCAGTGCCAGGCGCACAGTAGG + Intergenic
950122206 3:10489347-10489369 CCCACTGCCTGGCACACAGTAGG + Intronic
950151871 3:10693781-10693803 CACACTGCCTGGCACATAGTAGG + Intronic
950161426 3:10763990-10764012 ACCCCTGCCCCGCACACAGTAGG + Intergenic
950176595 3:10879056-10879078 CTCAATGCCTGGTACACAGTAGG + Intronic
950198708 3:11027997-11028019 GCCTCTGCCCTGCATACAGTGGG - Intronic
950221649 3:11200897-11200919 TTCACAGCTCTGCACATAGTAGG - Intronic
950236023 3:11320800-11320822 GTCAGTGCCTGGCACACAGTAGG + Intronic
950569354 3:13790626-13790648 CTGCCTGCCCTGCACCCAGGAGG + Intergenic
950617083 3:14168536-14168558 CACACTGCCCGGCACATGGTAGG - Intronic
950648323 3:14391765-14391787 CTCAGTGCCTGGCACACAGTAGG + Intergenic
950702150 3:14758064-14758086 GTCCATGCCCAGCACACAGTGGG - Intronic
950706607 3:14786321-14786343 CACAGTGCCCAGCACACAGTAGG + Intergenic
950718100 3:14863886-14863908 CTCACTTCCCTGCAGACAGGGGG - Intronic
950749593 3:15118373-15118395 CTCAGTGCCCTGCACGGGGTTGG + Intergenic
950776063 3:15351593-15351615 CCCACTGCCCTGCACAGCCTTGG + Intergenic
951561238 3:23968893-23968915 CACAGTGCCCTTTACACAGTAGG - Intronic
951578420 3:24137189-24137211 CCCAATGCCTTGTACACAGTAGG - Intronic
951915212 3:27793465-27793487 CACATTGCCTTGCACAGAGTAGG - Intergenic
952422329 3:33143509-33143531 GTCAATGCCTAGCACACAGTAGG - Exonic
952884721 3:38005493-38005515 ACCAATGCCCGGCACACAGTAGG + Intronic
952932387 3:38370355-38370377 ATCAGTGCCTTGCACACAGTAGG + Intronic
953154261 3:40354585-40354607 ATCAGTGCCTGGCACACAGTAGG + Intergenic
953241106 3:41150230-41150252 CTCAGTGCCTGGCGCACAGTGGG + Intergenic
953416409 3:42722218-42722240 CTCACTACCCTGAACACAAGAGG + Intronic
954334967 3:49910984-49911006 CTCAGAGCTCTGCGCACAGTAGG + Intronic
954875920 3:53803183-53803205 CTCAGTGCCCTGCACAATGTTGG - Intronic
955056645 3:55461103-55461125 ATGAGTGCCCAGCACACAGTGGG + Intergenic
955065261 3:55528481-55528503 CTCAGTGCCCAGCACATAGTAGG - Intronic
955157495 3:56431132-56431154 CACAATGCCTAGCACACAGTTGG + Intronic
955397792 3:58569403-58569425 CTCAGTGCCCAGCACATAGTAGG + Intronic
955821820 3:62904438-62904460 CACAGTGCCTGGCACACAGTAGG - Intergenic
956085573 3:65605911-65605933 GTAACTACCCTGCACAAAGTAGG - Intronic
956554942 3:70510318-70510340 CTGACTGCTTTGCACTCAGTAGG + Intergenic
956697470 3:71930815-71930837 CACACTTCCCTGCACACAGCTGG + Intergenic
956865759 3:73367072-73367094 CTGGGTGCCCAGCACACAGTAGG + Intergenic
957047743 3:75389507-75389529 AACAGTGTCCTGCACACAGTAGG - Intergenic
957214251 3:77298775-77298797 CACACTCCCATGCACACAGGAGG - Intronic
957517108 3:81269490-81269512 CTTAGTGCTATGCACACAGTAGG + Intergenic
957839207 3:85644539-85644561 CTCACTGCCCTGCAGCTACTGGG - Intronic
958557973 3:95704598-95704620 CTCACTGCCCTGCACAGCCTTGG + Intergenic
958563779 3:95781468-95781490 GTCTCTAACCTGCACACAGTAGG - Intergenic
959257222 3:104031034-104031056 CTCTCAGCCCTGCAGACAGCAGG - Intergenic
960231732 3:115235933-115235955 TACACTGCCTGGCACACAGTAGG - Intergenic
961011599 3:123440160-123440182 ATCAGTGCTCAGCACACAGTAGG - Intronic
961112477 3:124296754-124296776 TTCATTGCCCTCGACACAGTGGG + Intronic
961734572 3:128993474-128993496 TTCACTGCCTGCCACACAGTCGG + Intronic
961775275 3:129279499-129279521 CTCAGTGCCCTGCACGGAGCTGG + Intronic
962005338 3:131343798-131343820 CCCACTGCCCTGCACAGCCTCGG - Intronic
962475517 3:135751861-135751883 CTCAGTGCCTGGCCCACAGTAGG + Intergenic
963249749 3:143092213-143092235 CTCATGCCCCTGCATACAGTGGG - Intergenic
963322695 3:143826517-143826539 CTCTCTACCCTGTACACAGCAGG + Intronic
963631936 3:147744225-147744247 CACAGTGCCCAGCACATAGTAGG - Intergenic
964154110 3:153564164-153564186 CCCACTGCCCTGCACAACCTTGG + Intergenic
964527657 3:157632141-157632163 CACACTGCCACACACACAGTCGG - Intronic
964567537 3:158073845-158073867 CTCCCTCCCCCACACACAGTAGG + Intergenic
965657501 3:171004120-171004142 CTCTATGCACTGAACACAGTTGG - Intronic
965890162 3:173503296-173503318 CACACTGCTTTGCACACAGTAGG - Intronic
966374023 3:179277297-179277319 CCCACTACCCTGCATAGAGTGGG - Intergenic
966924828 3:184637551-184637573 CACAGTGCCCGGCACACAGTAGG - Intronic
966931838 3:184680355-184680377 CTTAGTGCCTGGCACACAGTTGG - Intronic
967051045 3:185784826-185784848 CCCATTGCCTTGCACATAGTAGG - Intronic
967989757 3:195122086-195122108 CTCACTGCCCAGTTCACAGATGG + Intronic
968001626 3:195210378-195210400 CCCAGTGCCCTGAACACAGTGGG + Intronic
968843007 4:3021858-3021880 CTCACCCGCCTGCACTCAGTGGG + Intronic
969050461 4:4369323-4369345 CTCTATGCCCAGCACTCAGTGGG - Intronic
969096235 4:4734912-4734934 CACTCTGGCCTGCTCACAGTAGG - Intergenic
969171234 4:5365370-5365392 CACAGTGCCTGGCACACAGTAGG + Intronic
969303418 4:6310698-6310720 CACAAGGCCCAGCACACAGTAGG + Intergenic
969311462 4:6355161-6355183 TTCAGTGCCTGGCACACAGTAGG + Intronic
969483062 4:7457072-7457094 CTCAGGACCCAGCACACAGTAGG + Intronic
969718952 4:8882504-8882526 CTCAGGGCTCTGCGCACAGTAGG + Intergenic
969964433 4:10979383-10979405 CTCACTGCTGTGCACTCAGCAGG - Intergenic
970859928 4:20690546-20690568 GTCACTGCCCTGAACAAATTGGG + Intergenic
970873931 4:20847880-20847902 CTCATTTCCCTGGAAACAGTTGG - Intronic
971230806 4:24799326-24799348 CACAGTGCCCGGCACACAGCAGG + Intronic
973079606 4:45973053-45973075 CTCACTGCACAGTTCACAGTAGG + Intergenic
973131571 4:46654195-46654217 CCCACTGCCCTGCACAGCCTTGG - Intergenic
974009878 4:56596930-56596952 ATCACTGCCTGGCTCACAGTAGG - Intronic
975046201 4:69807565-69807587 GTCCCTAGCCTGCACACAGTAGG - Intergenic
975204077 4:71624237-71624259 GTCCCTGGGCTGCACACAGTAGG + Intergenic
975689177 4:76948666-76948688 CTCGCTGCCCTGCACGCACCGGG + Intergenic
978616853 4:110606252-110606274 CACACTTCACTGCAAACAGTGGG - Intergenic
978903729 4:113982376-113982398 CTGAGTGCCCTACCCACAGTAGG + Intergenic
979373277 4:119914582-119914604 CCCACTGCCCTGCACAACTTTGG - Intergenic
979439183 4:120731145-120731167 CTGACTGCCTAGCACACGGTGGG - Intronic
979746086 4:124214930-124214952 CACACTGCCCTGCATAACGTAGG + Intergenic
980115059 4:128671538-128671560 CACAGTGACTTGCACACAGTAGG - Intergenic
980165563 4:129222526-129222548 CACAGTGCCTGGCACACAGTAGG + Intergenic
981226921 4:142307450-142307472 CCCACTGCATAGCACACAGTAGG + Intronic
981538208 4:145822539-145822561 AGTACTGCCCTGCACACAGGTGG + Intronic
984058291 4:174957378-174957400 CCCACTGACCTGTACCCAGTTGG + Intronic
984237982 4:177184350-177184372 CTTCATGCACTGCACACAGTAGG + Intergenic
984656684 4:182326255-182326277 CGCACTGACCAGCACGCAGTAGG - Intronic
985845064 5:2338422-2338444 ATGACTGCTCTGAACACAGTGGG + Intergenic
985933345 5:3076686-3076708 CACAGTGCCTGGCACACAGTAGG - Intergenic
986749840 5:10776993-10777015 CTCAGAGCCTTGCATACAGTGGG - Intergenic
987035659 5:14015680-14015702 TTCATTGCCTAGCACACAGTAGG + Intergenic
987113816 5:14711502-14711524 CTCAGTGCCAGGCACACAGCAGG - Intronic
987520061 5:18970275-18970297 CTCACAGCCCTGCACGGAGGTGG - Intergenic
989237098 5:39160737-39160759 CTATCTGCCAAGCACACAGTAGG + Intronic
989708675 5:44370034-44370056 CTAGATGCACTGCACACAGTTGG - Intronic
990011735 5:51006969-51006991 CACAGTGCCTTGCACATAGTAGG - Intergenic
990528208 5:56649685-56649707 CTCACAGCCCTGCTCCCAGGAGG + Intergenic
990714724 5:58624127-58624149 CACAGTGCCTGGCACACAGTAGG - Intronic
991155327 5:63427693-63427715 CTCTCTGCCCGGCCCACAGATGG + Intergenic
992226606 5:74624987-74625009 CTCAGTGCCTGGCACATAGTAGG - Intergenic
992382169 5:76248591-76248613 CCCAGTGCCCTGCACATAGTAGG + Intronic
992557607 5:77918344-77918366 CACAGTGCCCAGCACACAGCTGG + Intergenic
992568411 5:78025711-78025733 CTTACTGTCCTGAAGACAGTGGG + Intronic
992576043 5:78113820-78113842 CTCACTGTCCTGCTCACTGGAGG + Exonic
992962523 5:81970724-81970746 CTCACTGCCTTGCCCATAGCTGG + Intergenic
993075941 5:83231404-83231426 CCCAGTGCTGTGCACACAGTAGG + Intronic
994641809 5:102420229-102420251 ATCACTGCCCTGAAGTCAGTAGG - Intronic
995726497 5:115186384-115186406 GACACTGCCAGGCACACAGTAGG - Intergenic
996554627 5:124765545-124765567 CTCAGTGCCTGACACACAGTAGG - Intergenic
996963211 5:129276249-129276271 CTTACTGTACTGAACACAGTAGG - Intergenic
997600685 5:135136383-135136405 CTCAATGACCAGCACACAGCAGG - Intronic
997635248 5:135399528-135399550 CTCAGAGCCAGGCACACAGTAGG - Exonic
997749311 5:136329307-136329329 CTCAGTGCCTGGCATACAGTGGG - Intronic
998497535 5:142603579-142603601 TACAGTGCCCTGCACACAGGGGG + Intronic
998888602 5:146721768-146721790 CTCAGTGCCAGGCACACAGTGGG - Intronic
999046186 5:148472268-148472290 CACAATGCCTGGCACACAGTGGG + Intronic
999206204 5:149849922-149849944 TTCACTGCCTAGCACATAGTAGG + Exonic
999232219 5:150068397-150068419 CACACTGCCTGGAACACAGTGGG + Intronic
999316084 5:150585043-150585065 CTCAGTGCCAGGCACACAGCAGG - Intergenic
999628721 5:153547378-153547400 TTCAATACCCTGGACACAGTAGG + Intronic
999743754 5:154576382-154576404 CCCAGTGCCTGGCACACAGTAGG + Intergenic
1000630883 5:163589246-163589268 CACAGTGCCCGACACACAGTAGG + Intergenic
1001117005 5:168948225-168948247 TGCACTGCCTGGCACACAGTGGG + Intronic
1001237665 5:170043834-170043856 CTCTCTGCTCAGCACAGAGTGGG - Intronic
1001635419 5:173206630-173206652 ACCACTGCCTGGCACACAGTAGG - Intergenic
1001710995 5:173777892-173777914 GTCACTCCCCTCCACAAAGTTGG - Intergenic
1001759477 5:174195326-174195348 CTCAGTGCTTTGCACACTGTAGG + Intronic
1001844491 5:174910020-174910042 CTCTGTGCCCAGCACACAGTAGG + Intergenic
1001939535 5:175730686-175730708 CTCACTGGCTAGCTCACAGTAGG + Intergenic
1002170074 5:177370000-177370022 CACAATGCCTGGCACACAGTAGG - Intronic
1002290363 5:178196264-178196286 CTCACAAAGCTGCACACAGTGGG - Intergenic
1002308028 5:178295484-178295506 CTCATTGCCCTTCACACAGTAGG - Intronic
1002548067 5:179965275-179965297 CACAGTGCCTGGCACACAGTGGG + Intronic
1002789757 6:428393-428415 CACACTGCCCAACACACAGAAGG + Intergenic
1003244100 6:4369721-4369743 CACAGTGTCCTGCACACAGCAGG - Intergenic
1003396969 6:5761939-5761961 CTCACTGGTGTGCACACAGCAGG - Intronic
1003558286 6:7160018-7160040 CTCAGTGCCTGGCACACAGTAGG - Intronic
1003831830 6:10020478-10020500 CACAGGGCCCTGCACATAGTAGG + Intronic
1003874790 6:10425983-10426005 CTCGCTGCTCTGCACGCAGCTGG + Intergenic
1004576598 6:16901877-16901899 GACACTGCCCAGCACTCAGTGGG - Intergenic
1004854484 6:19735445-19735467 CTCACTGCCCAGGACATAGAGGG - Intergenic
1006056764 6:31390967-31390989 AACAATGCCCTGCACACAGTAGG + Intergenic
1006405238 6:33841254-33841276 CTCACTGCCCTGCCCAGCCTGGG - Intergenic
1006446958 6:34084969-34084991 GCACCTGCCCTGCACACAGTAGG - Intronic
1006510985 6:34520928-34520950 CACAGTTACCTGCACACAGTGGG - Intronic
1006512278 6:34528161-34528183 CACAGTGCCCTGCACAGAGCTGG + Intronic
1006716845 6:36125803-36125825 TTCAGTGCCTGGCACACAGTAGG - Intergenic
1006732323 6:36245616-36245638 CCCTGTGCCCAGCACACAGTAGG + Intronic
1006801301 6:36761369-36761391 GGCACTGCCGGGCACACAGTAGG - Intronic
1006904638 6:37525016-37525038 CTCAATGCCTTGCACACAGTAGG - Intergenic
1007269703 6:40627239-40627261 CACATTGCTCTGCACACAGTAGG - Intergenic
1007394028 6:41567074-41567096 CTGACTCCCCTGCACAGAGCTGG + Intronic
1007395178 6:41573652-41573674 CACACTGCCAGGCACCCAGTAGG - Intronic
1007518886 6:42436013-42436035 CCCAGTGCCCCGTACACAGTAGG + Intronic
1007686991 6:43672880-43672902 ATCCCTGCCCAGCACACACTTGG - Intronic
1007754124 6:44087783-44087805 AACACTGCCTTGTACACAGTAGG - Intergenic
1008351786 6:50499804-50499826 CCCAGTGCCCTACACAGAGTGGG - Intergenic
1008842003 6:55913634-55913656 CTCACCACCCTGCACTCAGCAGG + Intergenic
1008932080 6:56952012-56952034 CTCAGTGCCTTGTATACAGTGGG - Intronic
1008981443 6:57488596-57488618 CTTGCTGTCCTCCACACAGTGGG - Intronic
1009169537 6:60381626-60381648 CTTGCTGTCCTCCACACAGTGGG - Intergenic
1010000363 6:70942699-70942721 CACAGTGCCTTGTACACAGTAGG + Intronic
1010161185 6:72857900-72857922 CCCAATGCCCAGCACATAGTAGG - Intronic
1010531451 6:76972514-76972536 CCAACTGCCCTGCACAGAGTGGG - Intergenic
1012359051 6:98353651-98353673 CACAGTGCTCTGAACACAGTAGG - Intergenic
1012394067 6:98775552-98775574 CTCAGTGCCCAACACACAGTTGG + Intergenic
1012903929 6:105042097-105042119 CTGACTCCCCAGCACAGAGTGGG - Intronic
1013251226 6:108335310-108335332 CCCACTGCCTAGCACAAAGTAGG + Intronic
1015428749 6:133104928-133104950 CTCACTGCTTGGCACATAGTAGG - Intergenic
1015434845 6:133173458-133173480 CTCACTGCTCTGCTCACCCTTGG + Intergenic
1015573411 6:134645568-134645590 ATCAGTGCCTGGCACACAGTCGG + Intergenic
1015822958 6:137282439-137282461 CTCAGTGCTCTGCACACGCTGGG - Intergenic
1015941977 6:138461954-138461976 CTCAGGGCCTGGCACACAGTAGG - Intronic
1015954953 6:138589541-138589563 CTCGCTGCTCAGCACACAGAGGG + Intronic
1016516233 6:144895526-144895548 CTCAGTGCCTGGCACACAGTTGG + Intergenic
1016629981 6:146217615-146217637 CCCAGTGCCTGGCACACAGTAGG - Intronic
1016883079 6:148930317-148930339 CTCAATGCCTGGCACATAGTAGG - Intronic
1016932923 6:149427442-149427464 CACACTGCCCTGCACAGTGTGGG + Intergenic
1016985960 6:149896136-149896158 CATACTGCCCGGCACACAGAGGG - Intronic
1017919519 6:158859074-158859096 CACACTGCCTGGCACAAAGTGGG + Intergenic
1018950868 6:168378056-168378078 CTCAATGCCCTGGATACAGCGGG + Intergenic
1019430120 7:995189-995211 CTCACTGACCTGCACGGGGTAGG + Intergenic
1019818133 7:3216475-3216497 CCCAGTGCCCAGCACACAGTAGG - Intergenic
1019837402 7:3402175-3402197 CTCAGTATCCTGCACTCAGTAGG + Intronic
1019884233 7:3890117-3890139 CTCAGAGTCCTGCAGACAGTTGG + Intronic
1020432183 7:8125706-8125728 CCCAGTGCCTGGCACACAGTGGG + Intronic
1020968922 7:14908370-14908392 CACAGAGCCCTGCACACAGAAGG + Intronic
1021546145 7:21815110-21815132 CTCTCTACTCTGCACAGAGTAGG + Intronic
1021890306 7:25180409-25180431 CTCACCGCCCTGCCTCCAGTCGG + Intergenic
1022222106 7:28323624-28323646 TTCACTGCCCTAGACAGAGTAGG - Intronic
1022311181 7:29197227-29197249 CTTACTGCCTGGCACATAGTAGG - Intronic
1022923923 7:35041813-35041835 CTCAGTGCCTGGCACACAGTCGG + Intergenic
1023828872 7:44028051-44028073 ATCACTGCCCCGCAGGCAGTGGG + Intergenic
1024221809 7:47294663-47294685 CCCAGTGCCTTGCCCACAGTAGG + Intronic
1025027165 7:55526075-55526097 GTCTCTGCTCTGCACACAGAGGG - Intronic
1025190813 7:56894300-56894322 TGCACTGCCCGGTACACAGTTGG + Intergenic
1025256333 7:57385950-57385972 CTTGGTGCCCTGCACACAGTAGG + Intergenic
1025681130 7:63682624-63682646 TGCACTGCCCGGTACACAGTTGG - Intergenic
1025986241 7:66454972-66454994 CTTAATTCTCTGCACACAGTTGG - Intergenic
1026028724 7:66770173-66770195 CTCAATTCTCTGCACACAGTTGG + Intronic
1026388117 7:69872125-69872147 CTCAGGGCCCTGCACTCAGAAGG - Intronic
1027209457 7:76133523-76133545 CTCAGTTCTCTGCACACAGTTGG - Intergenic
1027540306 7:79456379-79456401 CTCACTGGCCACCACACCGTAGG - Intergenic
1027883159 7:83868980-83869002 CTCATTGCCAGGCACCCAGTAGG - Intergenic
1027976259 7:85159827-85159849 CACACTGTCCTGCAGATAGTAGG + Intronic
1028096569 7:86768391-86768413 CACAGTGCAGTGCACACAGTAGG - Intronic
1028741731 7:94283112-94283134 CTTAGTGCCTTGCACATAGTAGG + Intergenic
1029624039 7:101708627-101708649 CTCACTGCTATGCACGCGGTAGG + Intergenic
1029647839 7:101869352-101869374 CACAGTGCCTGGCACACAGTAGG + Intronic
1029739172 7:102482308-102482330 ATCACTGCCCCGCAGGCAGTGGG + Intergenic
1029757173 7:102581487-102581509 ATCACTGCCCCGCAGGCAGTGGG + Exonic
1029775113 7:102680548-102680570 ATCACTGCCCCGCAGGCAGTGGG + Intergenic
1029822237 7:103157585-103157607 CTCAGTGCCTGGCACACAGTCGG + Intergenic
1029906980 7:104102205-104102227 CACAGTGCCTTGCTCACAGTGGG + Intergenic
1031469411 7:122151296-122151318 CTAGCTGCCCTACACACAGTGGG + Intergenic
1031769795 7:125829308-125829330 GTCCCTACGCTGCACACAGTAGG + Intergenic
1031979383 7:128114960-128114982 CCCAGTGCCTGGCACACAGTGGG + Intergenic
1032508182 7:132451624-132451646 CTCACTGCCCTTTACCCACTGGG - Intronic
1032537754 7:132678600-132678622 CTCAGTTCCTAGCACACAGTAGG - Intronic
1032643859 7:133799360-133799382 CTCCCTGTCCTGCATACTGTGGG + Intronic
1033543775 7:142381382-142381404 CACACTGCCCGGCACCCATTGGG - Intergenic
1033656024 7:143375072-143375094 CAAACTGTCCTGCACATAGTAGG + Intergenic
1034713650 7:153219364-153219386 CTCACTTCCCTGCTCCTAGTAGG + Intergenic
1035282504 7:157786874-157786896 CTCCCTGCACTTCCCACAGTGGG - Intronic
1036486029 8:9179455-9179477 CCCACTGCCTTGCACATATTAGG - Intergenic
1036589617 8:10156943-10156965 CACAGTGCCAAGCACACAGTAGG - Intronic
1037624438 8:20594979-20595001 CTCAGTGCCCTGCACATAGTAGG + Intergenic
1038105981 8:24434591-24434613 CTCACAGCTTTGCACACAGCTGG - Intergenic
1038375037 8:27031869-27031891 CTCAATGCCTGGCACATAGTAGG - Intergenic
1038531250 8:28319550-28319572 CTCACTGCCTGGCACAGAGTGGG - Intronic
1039045888 8:33448975-33448997 CGCACTGCTTTGTACACAGTAGG - Intronic
1039539019 8:38346528-38346550 ATCATTGCCTAGCACACAGTAGG + Intronic
1039886251 8:41655696-41655718 CACTCTGCCATGCACACAGGAGG - Exonic
1039972217 8:42330146-42330168 CTCACTCCCATGCTCACTGTGGG - Intronic
1041168370 8:55114692-55114714 CTCTCTGCCCTCCCCTCAGTTGG - Intronic
1041326964 8:56678171-56678193 TTCAGTGCCCAGCACACTGTAGG + Intergenic
1043297499 8:78683527-78683549 ATCCCTACGCTGCACACAGTAGG + Intronic
1043388931 8:79772175-79772197 CTCAGTGCCCAGCACAGACTAGG - Intergenic
1043572587 8:81621625-81621647 CTCACAGCTCAGCACAGAGTTGG - Intergenic
1043751027 8:83934402-83934424 CACAATGCCTGGCACACAGTTGG - Intergenic
1044614972 8:94130655-94130677 CCAACTGCCATGCCCACAGTGGG + Exonic
1045367937 8:101493627-101493649 CTCGCGGCCCTCCACGCAGTTGG + Intronic
1045554071 8:103198122-103198144 CTGACTGCCCTACAGAAAGTTGG + Intronic
1045612345 8:103860204-103860226 CTCACTGATCTGCACACATAAGG + Intronic
1045826836 8:106408054-106408076 ATCACTGGCCTGCACCCACTAGG - Intronic
1045906856 8:107355945-107355967 TTCACTGCCTGGCACATAGTGGG + Intronic
1046395443 8:113633493-113633515 CTCATGGCCCTGCCCAGAGTGGG + Intergenic
1046676357 8:117113013-117113035 CTCACTGCTTGGCACATAGTAGG - Intronic
1047263513 8:123283363-123283385 CCTAATGCCTTGCACACAGTAGG + Intergenic
1047471730 8:125180883-125180905 ACCAGTGCCCAGCACACAGTAGG - Intronic
1047705617 8:127496591-127496613 CTCGCTGCCCTGCCCCTAGTGGG + Intergenic
1047736294 8:127768129-127768151 CTGACTGCCCTCCCCAAAGTGGG + Intergenic
1047753777 8:127902348-127902370 CACAATGCCTTGCACACAGCCGG - Intergenic
1047754123 8:127905588-127905610 TACACTGCCCTGCACATAGTAGG - Intergenic
1047911864 8:129539008-129539030 CACACTGCCTGGCACATAGTAGG + Intergenic
1048063675 8:130946678-130946700 CCACCTGCCCAGCACACAGTTGG + Intronic
1048890885 8:138945393-138945415 CCCAGTGCCTGGCACACAGTAGG - Intergenic
1050708130 9:8427466-8427488 CTCACCGCTCGGCACACAGCAGG - Intronic
1050733317 9:8734657-8734679 CTTGATGCCTTGCACACAGTAGG - Intronic
1051210284 9:14735014-14735036 CTGACGCCCCTGGACACAGTGGG + Exonic
1051722146 9:20048217-20048239 CACACTGCCTAGCACATAGTAGG + Intergenic
1051742811 9:20267893-20267915 CTCACTTCCTGGCACCCAGTAGG - Intergenic
1051869072 9:21715552-21715574 CCCACTGCCCTGCACAGTGTTGG - Intergenic
1052396762 9:27948644-27948666 GTCAGAGCCCTTCACACAGTGGG - Exonic
1052403613 9:28031931-28031953 CTGCCTGCCTGGCACACAGTTGG - Intronic
1052779479 9:32765836-32765858 CACAATGCCCAGCTCACAGTAGG + Intergenic
1053162515 9:35823362-35823384 CTCAATGCCTGGCACATAGTTGG + Intronic
1054825621 9:69570217-69570239 ATCACTGCCTGGCACAGAGTCGG - Intronic
1055480298 9:76702986-76703008 CAAACTGCCTTGCACATAGTAGG + Intronic
1055567812 9:77586593-77586615 CTCTCTCTCCTGCACACAGAGGG + Intronic
1055775641 9:79764469-79764491 CTCACTGCCTTGGTCACAGGGGG - Intergenic
1055924704 9:81497725-81497747 CTCACTCCTTGGCACACAGTAGG + Intergenic
1056179224 9:84065470-84065492 CACCATGCCCAGCACACAGTAGG + Intergenic
1056786081 9:89593440-89593462 CTCACTGTCTTGCACACAGTAGG + Intergenic
1057805812 9:98218980-98219002 CTCTCAGCCCTCCACACAGCAGG - Intronic
1058649960 9:107166539-107166561 CTAGTTGCCCTGTACACAGTTGG - Intergenic
1058810654 9:108635686-108635708 CTCACTCTCCTGCACACACAAGG + Intergenic
1059460709 9:114428001-114428023 CCCAGGGCCCAGCACACAGTAGG + Intronic
1059472007 9:114512384-114512406 CACAGTGCCTGGCACACAGTAGG - Intergenic
1059774711 9:117463553-117463575 CCCAGTGCCTGGCACACAGTGGG - Intergenic
1060190068 9:121586981-121587003 ATCACTGCCTGGCACCCAGTGGG - Intronic
1060205547 9:121680685-121680707 CCCAGTGCCTGGCACACAGTAGG - Intronic
1060212916 9:121721407-121721429 CTCAGTGCCTGGCACACAGCAGG - Intronic
1060254581 9:122015890-122015912 CACAGTGCCTGGCACACAGTAGG - Intronic
1060274695 9:122173502-122173524 CTCAGTGTCTTGCACACAGTAGG - Intronic
1060459751 9:123839409-123839431 CCCACTGCCTGGCACACAGAAGG + Intronic
1060497084 9:124126759-124126781 CGCACTGCCGGGCACATAGTAGG + Intergenic
1061004233 9:127919338-127919360 CACAGTGCCCGGCACACACTAGG + Intergenic
1061218979 9:129237900-129237922 ATGACTTCCCTGCACATAGTAGG - Intergenic
1061250953 9:129426121-129426143 CACTCTGCCTGGCACACAGTAGG - Intergenic
1061258410 9:129466087-129466109 CTCCATGCCTGGCACACAGTAGG - Intergenic
1061261953 9:129485293-129485315 CTTGATGCCCTGCACACAGTAGG - Intergenic
1061379588 9:130246085-130246107 CTCAATCCCCAGCACAAAGTGGG + Intergenic
1061396510 9:130346660-130346682 CACAGTGCCCGGCACACAGTAGG - Intronic
1061640550 9:131951409-131951431 CACACTGTCCAGCACACAGCAGG + Intronic
1061676049 9:132216258-132216280 CACACTGCCTGGCACACAGTAGG - Intronic
1062518476 9:136947592-136947614 CCCAGGGCCCAGCACACAGTGGG - Intronic
1186191701 X:7073105-7073127 CACCCTGCCTGGCACACAGTGGG + Intronic
1186583603 X:10847794-10847816 CCCAGTGGCTTGCACACAGTAGG + Intergenic
1186807833 X:13157621-13157643 TCCAATGCCATGCACACAGTAGG + Intergenic
1187052955 X:15713004-15713026 CTCAGTGCCCAGCACATAGCAGG + Intronic
1187408706 X:19027701-19027723 CTCATTGCCTGGCACATAGTAGG + Intronic
1187977501 X:24718180-24718202 CTCAGTGCCTAGCACACAATAGG - Intronic
1189172333 X:38921532-38921554 CTCAATGCCTTGCACATAGCAGG - Intergenic
1190151590 X:47954476-47954498 CACCATGCCCTGCCCACAGTGGG - Intronic
1190252579 X:48738126-48738148 GAAACTGCCCTGCACACAGTAGG + Intergenic
1190337916 X:49273945-49273967 CACTGTGCCCAGCACACAGTAGG - Intronic
1190454615 X:50615575-50615597 CACAGTGCCCGGCACACAGTGGG + Intronic
1191095049 X:56665088-56665110 GTCCCTGGGCTGCACACAGTGGG - Intergenic
1191960476 X:66695632-66695654 CTCCTTCCCCTGCACAGAGTTGG - Intergenic
1192095315 X:68204462-68204484 CTCAGTGTCCGGCACACAGCAGG + Intronic
1192165491 X:68825107-68825129 CACACTGCCTGGCATACAGTAGG + Intergenic
1192637393 X:72832477-72832499 CTCCCGGCCCAGCAGACAGTAGG - Intronic
1192644321 X:72888337-72888359 CTCCCGGCCCAGCAGACAGTAGG + Intronic
1193370695 X:80694068-80694090 CTCCCTGCTCTGCGCACACTTGG + Intronic
1193547281 X:82845806-82845828 CCCACTGCCCTGCACAGCCTTGG + Intergenic
1194313262 X:92340657-92340679 CTCACTGCCCTGCATAGCCTTGG - Intronic
1194507848 X:94754813-94754835 CCCACTGCCCTGCACAGGCTTGG - Intergenic
1195063527 X:101219146-101219168 CCAAGTGCCCAGCACACAGTAGG - Intergenic
1195070508 X:101274535-101274557 ATCACTTCCCTGTACACATTAGG + Intronic
1196287997 X:113905009-113905031 CTCAGTGCCTGGCACATAGTAGG - Intergenic
1196606128 X:117659111-117659133 CTCAGTGCCCAGCACACAGCAGG - Intergenic
1196689673 X:118545837-118545859 CTCTGTGCTATGCACACAGTAGG - Intronic
1196798687 X:119523035-119523057 CTCAGTGCCCAGCACAAGGTTGG + Intergenic
1197524747 X:127547618-127547640 CTCACTGCCCTGCACAACCTTGG + Intergenic
1197627765 X:128822090-128822112 CCTAATGCTCTGCACACAGTGGG - Intergenic
1197838633 X:130721660-130721682 CACACTGTCCTGGACACAGTGGG + Intronic
1197871525 X:131066889-131066911 CACAATGCCCAGTACACAGTAGG + Intronic
1197900416 X:131365764-131365786 TTCTCTGACTTGCACACAGTAGG + Intronic
1198049078 X:132931182-132931204 CTCCCTCCCCTTCACACAGCAGG + Intronic
1198205163 X:134459013-134459035 CACAGTGCCCAGCACATAGTTGG - Intergenic
1198217371 X:134568280-134568302 CCCATTGCCGTGCACATAGTAGG - Intronic
1198251492 X:134883430-134883452 CTGACTGCCTGGCACAGAGTAGG - Intergenic
1198423867 X:136496342-136496364 CGCAGTGCCCTGCACTTAGTAGG + Intergenic
1198920644 X:141722143-141722165 CTCACTGCCATTTACACACTAGG - Intergenic
1199697609 X:150354048-150354070 TCCAATGCTCTGCACACAGTAGG + Intergenic
1199824898 X:151489218-151489240 CACAATTCCCAGCACACAGTAGG - Intergenic
1200621528 Y:5454771-5454793 CTCACTGCCCTGCATAGCCTTGG - Intronic