ID: 928200854

View in Genome Browser
Species Human (GRCh38)
Location 2:29246814-29246836
Sequence CTGGAGGTGGGGAGAGCAGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1083
Summary {0: 1, 1: 1, 2: 12, 3: 114, 4: 955}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
928200854_928200865 17 Left 928200854 2:29246814-29246836 CCAACTGCTCTCCCCACCTCCAG 0: 1
1: 1
2: 12
3: 114
4: 955
Right 928200865 2:29246854-29246876 CACCCTCATGCTTTCACCAGGGG 0: 1
1: 0
2: 1
3: 18
4: 179
928200854_928200862 15 Left 928200854 2:29246814-29246836 CCAACTGCTCTCCCCACCTCCAG 0: 1
1: 1
2: 12
3: 114
4: 955
Right 928200862 2:29246852-29246874 TCCACCCTCATGCTTTCACCAGG 0: 1
1: 0
2: 0
3: 19
4: 183
928200854_928200869 27 Left 928200854 2:29246814-29246836 CCAACTGCTCTCCCCACCTCCAG 0: 1
1: 1
2: 12
3: 114
4: 955
Right 928200869 2:29246864-29246886 CTTTCACCAGGGGGAGCGAGAGG 0: 1
1: 0
2: 0
3: 10
4: 118
928200854_928200864 16 Left 928200854 2:29246814-29246836 CCAACTGCTCTCCCCACCTCCAG 0: 1
1: 1
2: 12
3: 114
4: 955
Right 928200864 2:29246853-29246875 CCACCCTCATGCTTTCACCAGGG 0: 1
1: 0
2: 1
3: 17
4: 209
928200854_928200866 18 Left 928200854 2:29246814-29246836 CCAACTGCTCTCCCCACCTCCAG 0: 1
1: 1
2: 12
3: 114
4: 955
Right 928200866 2:29246855-29246877 ACCCTCATGCTTTCACCAGGGGG 0: 1
1: 0
2: 4
3: 11
4: 130

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
928200854 Original CRISPR CTGGAGGTGGGGAGAGCAGT TGG (reversed) Intronic
900004320 1:34750-34772 TTGGAGGTGGGAAGAGCAGGCGG + Intergenic
900024047 1:205266-205288 TTGGAGGTGGGAAGAGCAGGCGG + Intergenic
900116399 1:1029495-1029517 CTGGGGCTGGGGTCAGCAGTGGG + Intronic
900266314 1:1759067-1759089 CTGTTGGCGGGGAGAGCAGGGGG - Intronic
900363652 1:2301694-2301716 CTGGAGGTGGGAAGAGCCCCCGG + Intronic
900367848 1:2318517-2318539 CTGGACGTGGGGTGAGGAGCCGG - Intergenic
900424159 1:2568457-2568479 GAGGAGGTGGGGAAAGCAGACGG - Intergenic
900828974 1:4950383-4950405 GTGGGGTTGGGGAGAGCATTAGG + Intergenic
900831219 1:4967119-4967141 AGGGAGCAGGGGAGAGCAGTGGG - Intergenic
900849552 1:5131333-5131355 TTGGAGGTGGGGAGATAATTAGG + Intergenic
901024032 1:6269759-6269781 CGGGAGACGGGAAGAGCAGTGGG - Intronic
901090032 1:6634899-6634921 CTGGAGGTGGGTGGTGCAGGCGG + Exonic
901146093 1:7065539-7065561 CTGGAGGAGGGGACAGGAGATGG + Intronic
901436606 1:9250605-9250627 CTGCAGGGGTGGAGAGCAGCTGG - Intronic
901741183 1:11343022-11343044 GGGGAGGTGGGGAGAGGAGCAGG + Intergenic
901764732 1:11492545-11492567 GTGGGGGTGGGGAGAGGAATCGG - Intronic
901849588 1:12007047-12007069 CTGCAGGTGTGGAAGGCAGTGGG + Exonic
901882372 1:12201875-12201897 CAGGAGGTGTGGATGGCAGTGGG + Intronic
901911797 1:12464709-12464731 GTGGGGGTGGGGAGAGAAGAGGG + Intronic
902081946 1:13827249-13827271 GGGGAGGTGGGGAGAGTAGATGG + Intergenic
902360412 1:15939384-15939406 CATGAGGTGGGGAGAGATGTTGG - Exonic
902816453 1:18919166-18919188 CTGTGGGTGGGGGGAGCTGTTGG - Intronic
903570109 1:24297943-24297965 GAGGAGGAGGGGAGAGCAGCTGG + Intergenic
904314014 1:29648364-29648386 AGTAAGGTGGGGAGAGCAGTAGG + Intergenic
904354551 1:29930660-29930682 CTGGGGGTGGGCAGAGGAGGGGG - Intergenic
904357292 1:29948536-29948558 CTGGAGGGAGGGATAGCAGCAGG - Intergenic
904469241 1:30725838-30725860 GTTGGGGTGGGGGGAGCAGTTGG - Intergenic
904472079 1:30742237-30742259 CTGCAGGTGGTGAGAGCAGATGG - Intronic
904601061 1:31672846-31672868 CAGGGAGTGGGGAGAGGAGTGGG + Intronic
904719288 1:32494870-32494892 CTGGAGGCGGAGATTGCAGTGGG - Exonic
905231011 1:36514958-36514980 CTGGAGAGGGGCACAGCAGTTGG + Intergenic
905698828 1:39996384-39996406 CTGGAGATGGGGAGAGTCCTGGG - Intergenic
905701733 1:40021414-40021436 CTGGAGGTGGAGGTTGCAGTGGG + Intergenic
906191969 1:43904746-43904768 CAGGAGGAGGGGAGAGTGGTGGG - Intronic
906204654 1:43980267-43980289 CTGGAGATGGGCACAGCACTGGG - Intronic
906280734 1:44551718-44551740 TTGGAGGTGGGGAGACCAATGGG - Intronic
906524894 1:46488303-46488325 GGGGGGGTGGGGGGAGCAGTGGG - Intergenic
906660425 1:47577938-47577960 CAGAAGCTGGGGAGGGCAGTGGG - Intergenic
906686727 1:47767773-47767795 GTCGAGGTGGGGCAAGCAGTGGG - Intronic
906720261 1:47998871-47998893 TTGGAGGCAGGGAGACCAGTGGG + Intergenic
906725352 1:48040316-48040338 CTGGGGATGGGGAGAGGAGTGGG + Intergenic
907011712 1:50969213-50969235 CTGGAGATGGGGAGAGTCCTGGG - Exonic
907097001 1:51791176-51791198 CTGGAGGTGGGGTGAGGGGGAGG - Intronic
907342667 1:53747998-53748020 CTGGAGGCAGGGAGACCAATGGG - Intergenic
907365825 1:53958957-53958979 CTGGAGGTGGAGGTTGCAGTGGG - Intronic
907497559 1:54854939-54854961 TTGGAGGTGGGCAGAGCTGGAGG - Intronic
907854346 1:58287167-58287189 CTGGAGGGAGGGAGAGCATCAGG + Intronic
907962298 1:59295135-59295157 GTGGAGGTCTGGAGGGCAGTGGG + Intergenic
908681895 1:66671329-66671351 CTGGGGGTGGGAAGAACAGGCGG + Intronic
908786924 1:67744356-67744378 CTGGAGTTGCGGACAGCAGTTGG - Intronic
909212728 1:72845072-72845094 CTGGAGGCAGGGAAACCAGTTGG + Intergenic
909476835 1:76090447-76090469 CTTGTGGCAGGGAGAGCAGTAGG - Intronic
909712010 1:78662113-78662135 CTGGAGGTGGGAACACCAGTTGG + Intronic
909969683 1:81966682-81966704 CTGGGGATGGGGAGAGAACTGGG + Intronic
911045947 1:93628486-93628508 CTGGAGCTGGTGAAAGCAGCTGG - Intronic
911046037 1:93629210-93629232 CTGGAGCAGGAGAGAACAGTGGG - Intronic
911261671 1:95693789-95693811 CAGCAGGTGGTGAGGGCAGTGGG + Intergenic
912490576 1:110060618-110060640 CTGGAGGCTGCGAGAGCAGCTGG - Exonic
912697858 1:111855072-111855094 CAGGGGGTGGTGAGAGCAGCTGG - Intronic
913125035 1:115778861-115778883 CTAGAGATGGGGAGGGCTGTAGG + Intergenic
913142453 1:115954992-115955014 CAGGAGAGGGGAAGAGCAGTGGG + Intergenic
913176369 1:116276686-116276708 CAGGAGGAGAGGCGAGCAGTGGG - Intergenic
913248427 1:116890898-116890920 CAGGGGCTGGGGAGAGCAGAAGG - Intergenic
913501208 1:119474316-119474338 TAGGAGGTGGGCAGAGTAGTGGG + Intergenic
914320575 1:146555548-146555570 CTGGAGGTGGGAAGGGTAGTGGG + Intergenic
914772575 1:150702749-150702771 TTGGAGGGAGGGAGAGCATTAGG + Intronic
915037738 1:152942823-152942845 ATGGAGGCAGGGAGACCAGTTGG - Intergenic
915086251 1:153390895-153390917 CTGGAGGTGGGGAGTGAGGCAGG - Intronic
915227424 1:154421259-154421281 CTGGAGGTTGGTGGGGCAGTGGG + Intronic
915259648 1:154667539-154667561 CAGGAGGTGGAGATTGCAGTGGG + Intergenic
915406425 1:155663295-155663317 CAGGAGGTGGAGAGTGCAGTGGG + Intronic
915464169 1:156086565-156086587 GTGGAGGTTGGGGGAGGAGTGGG + Intronic
915586403 1:156846064-156846086 CAGGAGGTGGGAGGAGGAGTTGG + Exonic
915891216 1:159775639-159775661 CTGGAGATGGGGAGGGAGGTGGG - Intergenic
916652611 1:166845470-166845492 GTGGAGGTGGGGAGAGAACAAGG + Intronic
917073925 1:171183666-171183688 CTGGAGGTCGAGACTGCAGTGGG - Intergenic
917407515 1:174723146-174723168 CAGGAGGTGGAGATTGCAGTGGG - Intronic
917915267 1:179694895-179694917 CTGGAGGAAGGGGGAGCTGTGGG + Intergenic
918041610 1:180917122-180917144 CAGGTGGTGGGGGGAGCAGGAGG + Intronic
918115856 1:181496956-181496978 CTGGAGGTGGGGTGAGTAGGTGG + Intronic
918177825 1:182060895-182060917 CTGGAGGTGGGGTGGGGAGCGGG - Intronic
918248866 1:182684356-182684378 CTGGCGGTGGGCAGCGCAGCTGG + Intronic
918490453 1:185075658-185075680 CAGGAGGAAGAGAGAGCAGTGGG + Intronic
918571569 1:185999694-185999716 CTGGATGTGGGGAGAGTTTTAGG - Intronic
918709591 1:187710257-187710279 CAGGAGGTGGAGATTGCAGTGGG + Intergenic
919207163 1:194432190-194432212 CTGGAGGTGGAGGTTGCAGTGGG + Intergenic
919249099 1:195030149-195030171 CTGGATGTGGGAAAAGAAGTAGG - Intergenic
919699844 1:200620698-200620720 CTGGAGGTGGTGAGTGGCGTGGG - Exonic
919727209 1:200891975-200891997 CTGGATGTGGAGGGCGCAGTGGG + Intronic
919843489 1:201626351-201626373 CTGGAGATGGGGAGGGAAGCAGG - Intronic
920009574 1:202858101-202858123 CTTGAGACGGGGAGAGCAGGTGG + Intergenic
920035086 1:203060391-203060413 CTGGAGGTGGGTGGGGCAGAGGG - Exonic
920161015 1:203997627-203997649 GCGGAGGTGGGGAGGGAAGTTGG - Intergenic
920189145 1:204181288-204181310 TTGCAGTTGGGGAGAGAAGTTGG + Intergenic
920216570 1:204365324-204365346 CTGGAGGCAGGAAGATCAGTTGG + Intronic
920445018 1:206009748-206009770 GTGGAGCTGGAGAGAGGAGTGGG + Exonic
920577575 1:207072754-207072776 ATGGAGGGCGGGTGAGCAGTCGG + Exonic
920689136 1:208132312-208132334 CCGGGTGTGGGGAGAGCAGGAGG + Intronic
920807828 1:209251724-209251746 ATGGAGGTGGGGAGAGAGTTTGG - Intergenic
921014565 1:211176623-211176645 CTGGAGACAGGGAGACCAGTTGG + Intergenic
921262207 1:213394431-213394453 GTGGAGGTGGGGTGAGGGGTAGG - Intergenic
921284275 1:213594957-213594979 CTGGGGGTTGGGAGAGAGGTGGG + Intergenic
922222398 1:223618609-223618631 CTGGGTGTGGGGAGGGGAGTGGG + Intronic
922442096 1:225664315-225664337 CGGGAGGTGGAGATTGCAGTGGG + Intergenic
922605090 1:226885254-226885276 GTGGGGGTGGGGAAAGCAGCAGG + Intronic
922669012 1:227494897-227494919 CTGGGGGTGGGGATAGGAGAGGG - Intergenic
922670585 1:227506405-227506427 CTGGGGGTGGGGATAGGAGAGGG + Intergenic
922770990 1:228182796-228182818 CTGGAGGTGTGGATAGCAGTTGG + Intergenic
922862933 1:228834804-228834826 CTGGAGCTGGGCAGACCAGAAGG + Intergenic
922930574 1:229386021-229386043 CAGGAGGAGGGGAGAACTGTGGG + Intergenic
922936524 1:229426963-229426985 CTGGAGCTGGGGAGAGAAGCAGG + Intergenic
923262768 1:232283221-232283243 CTGGAGGTGGGAAGAGAGGTAGG - Intergenic
923404074 1:233643241-233643263 CTGGATTTGGTGAGAGAAGTGGG + Intronic
924224931 1:241913733-241913755 CTGGAGGTGGGCAGATCACGAGG - Intergenic
924279583 1:242422920-242422942 CAGGAGGTGGAGACTGCAGTGGG - Intronic
924350452 1:243109318-243109340 CTGAAGAAGGGCAGAGCAGTAGG + Intergenic
924698788 1:246428880-246428902 CTGGAAGAGGGCAGAGCAGAGGG - Intronic
1062820404 10:530478-530500 CTTGAGGGGGTGAGAGGAGTAGG + Intronic
1063503111 10:6572365-6572387 TTGGAGGGAGGGAGAGCATTAGG - Intronic
1063505722 10:6597630-6597652 CTGGAGGTGGGGGGGGAAATAGG - Intergenic
1064495086 10:15901106-15901128 GTGGAGGGGGGAAGAGCATTAGG + Intergenic
1064542012 10:16414805-16414827 CGGGAGGTGGGGGGAGCTGGGGG - Intergenic
1064657571 10:17570969-17570991 GTGGAGGGAGGGAGAGCATTAGG + Intergenic
1064680437 10:17806400-17806422 CTGGAAGTGGGGAGTGGAGTGGG + Intergenic
1065546875 10:26830518-26830540 CTTGAGGTGGGAGGATCAGTTGG + Intronic
1066039595 10:31534369-31534391 CTCGAGGTGGGGAGAGAATGGGG + Intergenic
1067019072 10:42779598-42779620 CTGGAGCTGGTGAGGGGAGTGGG + Intergenic
1067082847 10:43221415-43221437 CTGGAGAAGGGGGGAGCAGCAGG - Intronic
1067158906 10:43806171-43806193 CTGGAGGAAGGGAGGGCAGCAGG - Intergenic
1067498928 10:46785192-46785214 CTGGAGCTGGTGAGAGGAGTGGG + Intergenic
1067533120 10:47088766-47088788 CTGGAGTTGGGCACAGCAGGCGG + Intergenic
1067545270 10:47188237-47188259 GTGGAGGTGGGGAGAGAAGAGGG + Intergenic
1067595714 10:47555181-47555203 CTGGAGCTGGTGAGAGGAGTGGG - Intergenic
1067878086 10:50021712-50021734 CTGAGTGTTGGGAGAGCAGTGGG + Intergenic
1068697029 10:59978899-59978921 ATGGAGGAGGGGAGAAGAGTTGG + Intergenic
1068823262 10:61402780-61402802 CAGGAGGTTGGAAGACCAGTTGG + Intergenic
1068855807 10:61796100-61796122 CTTGAGGTTGGAAGTGCAGTGGG - Intergenic
1069175226 10:65281931-65281953 CTGCAGGGTGAGAGAGCAGTGGG + Intergenic
1069567600 10:69474165-69474187 CAGGCGGTGGGGAGAGCAGGTGG - Intronic
1069853036 10:71422902-71422924 CTGGGGGAGGGCAGAGCAGAGGG + Intronic
1069867227 10:71511394-71511416 CTGGGGTTGGGAAGAGCAGTTGG + Intronic
1069871718 10:71537072-71537094 ATGGAGCTGGGGGGAGCAGTTGG - Intronic
1070150228 10:73800796-73800818 AGGAAGGTGGGGAGAGCAGGTGG - Intronic
1070677494 10:78422263-78422285 CTGGATGTGGGGAAAGGTGTAGG - Intergenic
1070892143 10:79948913-79948935 CAGGAGGTGGGGAGCACAGGAGG - Intronic
1071445138 10:85738831-85738853 CTGGAGGTGGGGATGGGAGAAGG + Intronic
1071682827 10:87724385-87724407 CTGAAGATGGGGAGACCTGTGGG + Intronic
1071802641 10:89080785-89080807 CTGGAGGTGGGGGGTGGGGTAGG - Intergenic
1071844882 10:89511593-89511615 CTGGGGGAGGGGATAGCATTAGG + Intronic
1072451873 10:95545132-95545154 CTGGAGCTTGGGAGAGCTGAGGG - Intronic
1072507538 10:96083777-96083799 TTGGATCTGGGGAGAGCAGCTGG - Intergenic
1072548830 10:96461504-96461526 TGGGAGTTGGGGAGAGAAGTTGG - Intronic
1072554366 10:96503601-96503623 GTGGAGGTGAGGAGAGTGGTTGG + Intronic
1072925625 10:99613963-99613985 GTTGAGGTGGGGCGAGAAGTTGG - Intronic
1073071863 10:100799227-100799249 GTGGAGGTGGGGGGACCAGTGGG - Intronic
1073280089 10:102347581-102347603 CTGGAGGTGGTTATTGCAGTGGG + Intronic
1074199453 10:111221944-111221966 CTGGAGAAGGGCAGACCAGTTGG - Intergenic
1074280290 10:112045130-112045152 CTGGAGGCGGAAAGACCAGTTGG - Intergenic
1074384593 10:113006895-113006917 CTGGAAGTGGGAAGGGCAGGAGG - Intronic
1074616893 10:115078749-115078771 CTGGAGGTTAGGAGAACAATCGG - Intergenic
1074957901 10:118410533-118410555 CTGGAGGTTGGGTCATCAGTTGG + Intergenic
1075358815 10:121810774-121810796 CTGGAGGTGGAGATTGCAGTGGG - Intronic
1075536252 10:123274730-123274752 AGGGAGGTGGGGAGAGGAGGAGG + Intergenic
1075540566 10:123310023-123310045 CTGGGTGTGGGGCCAGCAGTGGG + Intergenic
1075553236 10:123409575-123409597 CTGGAGTTGGGGAGGGGGGTTGG - Intergenic
1075598512 10:123749706-123749728 CAGGAGTTGGGAACAGCAGTGGG - Intronic
1076063349 10:127430055-127430077 CTGTAGGTGGGGAGGGGAGAGGG - Intronic
1076134668 10:128037071-128037093 CTGGAGTTGGGCACAGGAGTGGG + Intronic
1076375912 10:129984493-129984515 CAGGAGGTGGAGATTGCAGTGGG + Intergenic
1076483873 10:130803110-130803132 CTGCTGGTGGGGTGGGCAGTGGG + Intergenic
1076492219 10:130869696-130869718 CTGGAGGTGGGGAGACCGTCGGG - Intergenic
1076504108 10:130960612-130960634 ATGGAGGAGGGGTGAGCAGAGGG + Intergenic
1076541221 10:131216234-131216256 GAGGAGGTGGAGAGAGAAGTGGG + Intronic
1076549326 10:131267772-131267794 CTGGTGGTGGGAGCAGCAGTGGG - Intronic
1076602000 10:131663321-131663343 CAGACTGTGGGGAGAGCAGTGGG - Intergenic
1076701563 10:132275834-132275856 CAGGAGGTGGGGAGAAAAGAGGG - Intronic
1076718692 10:132382656-132382678 CAGGAAGTGGGGAGTGCAGGGGG + Intergenic
1076749200 10:132533835-132533857 CTGGGGGTGGTCAGCGCAGTTGG + Intergenic
1076786864 10:132754238-132754260 CTGTAGGTGGGAAGACCCGTGGG + Intronic
1076802216 10:132835951-132835973 CGGGAAGTGGGGAGGGGAGTGGG - Intronic
1077058112 11:605747-605769 GGGGAGGTGGGGGCAGCAGTTGG + Intronic
1077100898 11:821886-821908 GTGGCGGTGGGGGGGGCAGTGGG + Intronic
1077175129 11:1185931-1185953 CTGGTGGTGGGAACAGCACTGGG - Intronic
1077254297 11:1573481-1573503 CTGGGGGTGGGGAGTACTGTGGG + Intergenic
1077529766 11:3089754-3089776 CGGGAGGTGGGGAGGCCAGGAGG - Intronic
1077916170 11:6612656-6612678 CGAGAGGTGGGGGCAGCAGTGGG + Exonic
1078101880 11:8334802-8334824 TTGGAGGTGGGGAGAGGGGTTGG - Intergenic
1078324754 11:10370395-10370417 CTGGAGCTGGAGAGGGCAGAGGG + Intronic
1078386953 11:10900739-10900761 CTGGTTGTGGAAAGAGCAGTGGG + Intergenic
1078518700 11:12046720-12046742 CTGGAGGGTGGGAGAGGGGTTGG + Intergenic
1079117004 11:17646272-17646294 GTGGAGGGGGTGAGAGCTGTGGG + Intronic
1079147031 11:17862094-17862116 CTGGAGGGGAGCAGAGCAGTGGG - Intronic
1079210479 11:18456294-18456316 CTGGAGGTTGGGGGAACAGCAGG + Exonic
1079321276 11:19453706-19453728 CAGGAGGAGGAGAGAGCTGTGGG - Intronic
1079355906 11:19730312-19730334 CTGGATGTGGTGAAAGCAGCCGG - Intronic
1080220767 11:29900977-29900999 CTAGGGGAGGGGATAGCAGTAGG - Intergenic
1080510910 11:32970476-32970498 CAGGAGGTGGAGATGGCAGTGGG - Intronic
1080910119 11:36588455-36588477 GTGGAGTTGGGGAGAGCAATAGG + Intronic
1081504217 11:43698000-43698022 CAGGAGGTTGGGAGACCAGCAGG + Intronic
1081692270 11:45086583-45086605 CTGGGGGCGGAGAGAGCAGGAGG - Intergenic
1082005354 11:47416025-47416047 CTGGAGGTGGCAAGAGCTGCTGG - Exonic
1082081247 11:48013933-48013955 CTGAAGTTGGGCAGAGCAGGTGG + Intronic
1082651419 11:55798630-55798652 ATGTAAGTGGGTAGAGCAGTGGG + Intergenic
1083067847 11:59944204-59944226 CTGGAGGGGGTGAGAGCTGAAGG + Intergenic
1083221092 11:61253094-61253116 CTGGAGGTGGGAAGAACACATGG - Intergenic
1083296631 11:61718717-61718739 CTGAGGGTGGGGGGAGGAGTAGG + Intronic
1083727802 11:64637424-64637446 CTGGAGGTGGGGAGCCCAGTAGG + Intronic
1083732192 11:64658529-64658551 CTGGAGGTGGGGAGATATGCAGG - Intronic
1084064667 11:66696924-66696946 CTGGAAGTGGGGAAACCAGGTGG - Intronic
1084273365 11:68040334-68040356 CTGCAGGTGGGCAGGGCAGGGGG - Intronic
1084568669 11:69946012-69946034 CAGGAGGTGGGCAGAGAAGGTGG + Intergenic
1084731480 11:71076290-71076312 CTAGGGGTGTTGAGAGCAGTAGG + Intronic
1084741878 11:71145531-71145553 CTGGGGGTGGGCTGAGCAGAGGG + Intronic
1085345782 11:75767518-75767540 CTGTAGGTCAGGAGGGCAGTGGG - Intronic
1085491433 11:76922253-76922275 CTGGAGGCAGGGAGTGCAGGAGG - Intronic
1085988767 11:81814176-81814198 CTGAAGGGAGGGAGAGCATTAGG + Intergenic
1086521486 11:87673178-87673200 ATGGAGGGAGGGAGAGCATTAGG - Intergenic
1086902426 11:92382972-92382994 CTGGGGGTAGGGAGAGCATCGGG - Intronic
1087414483 11:97836384-97836406 CTTGAGATGGGGAAAGGAGTTGG + Intergenic
1087666263 11:101052652-101052674 CTGGAGTTAGGGAGGACAGTTGG + Intronic
1088283849 11:108165536-108165558 CAGGAGGTTGAGAGTGCAGTGGG - Intronic
1088289744 11:108223107-108223129 CGGGAGGAGGCGAGAGGAGTCGG + Exonic
1088849050 11:113690545-113690567 CTGGGAGTGGGAAGAGCAGGAGG + Intronic
1089130041 11:116204964-116204986 GTGGGGGTGGGGAGAGGATTTGG + Intergenic
1089507683 11:118974996-118975018 CTGGAGTTCTGGAGAGAAGTGGG + Intronic
1089589094 11:119529187-119529209 CTGGAGGGAGGCTGAGCAGTGGG + Intergenic
1090105651 11:123851733-123851755 CTGGGGGTGGGGGCAGCAGACGG + Intergenic
1090207990 11:124896389-124896411 TTTGAGGAGGGGAGAGCAGGGGG - Intronic
1090459373 11:126876609-126876631 CTGGAGGTGGAGGTTGCAGTGGG - Intronic
1090608821 11:128451994-128452016 CTGCAGGTGGGCAGAGCGGCTGG - Intergenic
1090609017 11:128453541-128453563 GTGGAGGCAGGGAGACCAGTTGG - Intergenic
1091139462 11:133222791-133222813 GTGGAGGTGGGGGGAGCAAAGGG + Intronic
1091192931 11:133709247-133709269 CTGAAGGTGGGGAGGGGAGAGGG - Intergenic
1091368219 11:135039171-135039193 GTGGAGCTGGGGAGAGTACTGGG - Intergenic
1091377743 12:36798-36820 TTGGAGGTGGGAAGAGCAGGTGG + Intergenic
1091449306 12:562592-562614 CTGGAGGCAGGGAGAGGAGTGGG + Exonic
1091545364 12:1498254-1498276 CGGGAGGTGGCCACAGCAGTGGG - Intergenic
1091706307 12:2695644-2695666 CTGGGGCTGGGGAGGGCAGTGGG - Intronic
1091711535 12:2743873-2743895 CTGGGGCTGGGGAGGGCAGTGGG - Intergenic
1091915623 12:4270438-4270460 CTGGAGGTGGAGGGTGCAGCAGG - Intergenic
1092140054 12:6177728-6177750 CTGGAGCTGGGGAGAGATGGAGG - Intergenic
1092964587 12:13629429-13629451 ATGGAGGTGGGGAAACCATTAGG - Intronic
1093430519 12:19080202-19080224 GTCGAGGTGGGCAGATCAGTTGG + Intergenic
1093651193 12:21647768-21647790 CGGGAGGTGGAGATTGCAGTGGG - Intronic
1094154142 12:27320078-27320100 TTAGAGGTGGGAAGAGGAGTAGG - Intronic
1095523263 12:43094054-43094076 CTGCAAGTGGGGTGAGCAGCAGG - Intergenic
1096026881 12:48373676-48373698 GTGGGGGTGGGGATAGCATTAGG + Intergenic
1096031206 12:48416786-48416808 CAGGAGGTGGGGGTTGCAGTGGG + Intergenic
1096192288 12:49627754-49627776 GTGGATGTGGGGAAAACAGTTGG + Intronic
1096499043 12:52054467-52054489 CTGAAGCTGGGCAGGGCAGTGGG - Exonic
1096562045 12:52442740-52442762 CTGGGGGAGGAGAGAACAGTCGG + Intergenic
1096573892 12:52540736-52540758 CTGGGGCTGAGGAGAGCAGCAGG - Intergenic
1096653822 12:53075982-53076004 CTGGAGGCTGCGAGAGGAGTAGG - Intronic
1096673427 12:53213701-53213723 CTGGAGGTGGGGGGTGGAGGAGG + Intronic
1096722292 12:53532323-53532345 CTAAAGGTGGGGAGAGGAGATGG + Intronic
1096839155 12:54370215-54370237 CTGGAGGTGGGGAGTTGAATGGG + Exonic
1096868836 12:54580690-54580712 CTGGAATGGGTGAGAGCAGTAGG - Intronic
1096974116 12:55688827-55688849 CTGGAGGTGAGGATACCACTCGG - Exonic
1097153277 12:56994930-56994952 CTGGGGGTGGGGAGAAATGTTGG + Intronic
1098141702 12:67456709-67456731 CGGGAGGTGGGGGAAGGAGTTGG - Intergenic
1098179288 12:67828892-67828914 ATGGAGGGTGGGAGAACAGTGGG - Intergenic
1098788708 12:74792847-74792869 CTGGATGTGGGGTTATCAGTAGG - Intergenic
1099298693 12:80864251-80864273 GTGGAGATGGTTAGAGCAGTGGG - Intronic
1099356303 12:81639455-81639477 CTGGAGGTGGGAAGAAATGTGGG - Intronic
1099540705 12:83904381-83904403 ATGGAGGTGTGGAGTGCAGTGGG - Intergenic
1099957849 12:89368643-89368665 CATCAGGTGGGGAGGGCAGTGGG + Intergenic
1100587097 12:95990526-95990548 CAGGAGGCTGGGAGAGAAGTAGG + Exonic
1100646794 12:96540174-96540196 CGGGAGGTGGGGATTGCAGTGGG - Intronic
1100891487 12:99131159-99131181 CTGGATGTTGGGAGAGCAGGTGG - Intronic
1101098304 12:101366606-101366628 CTGGAGTTGGGGGAAGCAGAAGG - Exonic
1101219228 12:102619050-102619072 CTGGAGCTGGGGTGAGAAGTGGG - Intergenic
1101329241 12:103744102-103744124 CTGGAGGTGGTGAGAGGTGGTGG + Intronic
1101371052 12:104130913-104130935 TTGGGGGTGGGGAGGGCAGGCGG + Intronic
1101642778 12:106600727-106600749 CGGGAGGTGGGGAGAGCAGCAGG - Intronic
1102365882 12:112334133-112334155 CTGGAGGTGGAGGTTGCAGTGGG + Intronic
1102659822 12:114516284-114516306 CTGGGGGTGGGGAGAGAATGGGG + Intergenic
1102662467 12:114541651-114541673 CTGGAGCTGGGCGAAGCAGTGGG + Intergenic
1102936553 12:116902286-116902308 ATTGAGATGGGGAGACCAGTGGG + Intergenic
1103475439 12:121214856-121214878 CGGGAGGTGGAGATTGCAGTGGG - Intronic
1103705248 12:122867817-122867839 CTGGTGGTGGGGTGCGCAGCAGG - Intronic
1103808442 12:123593324-123593346 CAGGAGGTGGAGATTGCAGTGGG - Intronic
1104574450 12:129954120-129954142 CTGGCTGTGGGGAGAGGGGTTGG - Intergenic
1104644059 12:130484652-130484674 GGGGTGGTGGGGACAGCAGTGGG - Intronic
1104880182 12:132065291-132065313 CTGTAGGCAGGGAGAGCATTTGG + Intronic
1104900865 12:132188974-132188996 CGGGAAGAGGGCAGAGCAGTGGG - Intergenic
1105492833 13:20904082-20904104 CAGGAGGTCGAGAGTGCAGTGGG + Intergenic
1105578938 13:21675669-21675691 CTGTAGGTGGGGGGTGCGGTGGG + Intronic
1106090785 13:26591408-26591430 GTTGAGGTGGGGGAAGCAGTAGG + Intronic
1106262606 13:28080300-28080322 CAGGAGGTGGAGATTGCAGTTGG + Intronic
1106456994 13:29936229-29936251 GTGTGGGTGTGGAGAGCAGTGGG + Intergenic
1106777300 13:33020672-33020694 CTGGAGGTAGGTAGAGCTGCAGG - Intronic
1107092303 13:36495091-36495113 CTGGAGGTGGGAAGACCAGTTGG + Intergenic
1107323758 13:39217478-39217500 ATGGGGGTTGGGAGAGCAGAGGG - Intergenic
1107329411 13:39282808-39282830 CTGGTGGTGGAAAGAGAAGTGGG - Intergenic
1107423637 13:40272422-40272444 CTGGCCGTGGGGAGAAAAGTGGG - Intergenic
1107633183 13:42363734-42363756 TTGGAGGTGGGGTCAGCAATAGG - Intergenic
1107950455 13:45456838-45456860 TTGGAGGTGGAGAGAGAAGATGG + Intergenic
1107978937 13:45715908-45715930 CTGGGGTTGGGGAGAGCACAGGG - Intergenic
1108469715 13:50756000-50756022 CTGGAGGTGGGGAGACTTGCTGG - Intronic
1108576585 13:51796451-51796473 ATGGAGGTGAGGGGGGCAGTAGG + Intronic
1108585554 13:51867000-51867022 CTGGGGGTGGGGAGATTAGATGG + Intergenic
1109150045 13:58835742-58835764 CTGGAGGAGTGGGGAGCAGAGGG - Intergenic
1109518497 13:63476646-63476668 ATGGAGGTGGGAAGAACAGAAGG - Intergenic
1110145286 13:72183213-72183235 ATGGAGGTAGGGAGAGCATCAGG - Intergenic
1110786235 13:79530398-79530420 CTGGAGCTGGGCACAGCAGCTGG - Intronic
1111597218 13:90427621-90427643 CTGGGAGTGGGGAGAGCCCTGGG - Intergenic
1111642926 13:90993715-90993737 TTTGAGGTGGTGAGAGGAGTGGG - Intergenic
1111708874 13:91785884-91785906 GTGGAAGTAGGGAGAGTAGTTGG - Intronic
1112054483 13:95677432-95677454 CGGGAGGTGGGGCGAGCGCTGGG + Intronic
1112212615 13:97395533-97395555 TTGGAGGTGGGGAGAGGGGGTGG - Intergenic
1112327216 13:98449892-98449914 CTGGAGGTGGGGGGAGCATAGGG - Intronic
1112993027 13:105536947-105536969 CAGGAGGTGGAGATTGCAGTAGG - Intergenic
1113248918 13:108429410-108429432 CTGGAGGTGGAAACACCAGTAGG - Intergenic
1113358977 13:109610718-109610740 GCAGAGGTGGGGAGTGCAGTGGG + Intergenic
1116035129 14:39618499-39618521 TATGAGGTGGGGAGAGCAGATGG - Intergenic
1118033428 14:61840293-61840315 CTAGAGCTTGGGAGAGAAGTTGG + Intergenic
1118145747 14:63134042-63134064 CAGGAGCTGGGGAGAGCAGTTGG + Intergenic
1118282871 14:64445042-64445064 CTGGAGGTGGGGAGTGCTACTGG + Intronic
1118294070 14:64552587-64552609 CTGGAGGTCAGGAAAGGAGTTGG + Intronic
1118313306 14:64708383-64708405 CTGGAGGTCGGAAGCGGAGTGGG + Intronic
1118683662 14:68269356-68269378 CAAGAGGTGGTCAGAGCAGTGGG - Intronic
1118744024 14:68761330-68761352 TTGGAAGTGGGGCGGGCAGTAGG + Intergenic
1119029165 14:71177992-71178014 CTGGGGGTGGGGACAGAGGTAGG - Intergenic
1119522484 14:75296162-75296184 CTGCAGGACGGGAGGGCAGTTGG - Intergenic
1119543610 14:75456525-75456547 CTGGAGCAGGGGAAAGCAGGTGG - Intronic
1119635538 14:76270325-76270347 CTTGAGGTGGGCAGAGAATTTGG - Intergenic
1119651302 14:76385647-76385669 CGGGATGGTGGGAGAGCAGTGGG - Intronic
1119915018 14:78390919-78390941 ATGGAGGTGGGGAGAGCATTAGG - Intronic
1119983045 14:79103535-79103557 CTGGAGTTCGGGAGGGAAGTTGG + Intronic
1120094976 14:80378353-80378375 CTGGAAGTGGGGAGGGGACTTGG + Intronic
1120867354 14:89307252-89307274 GTGGAGGTGGAGAGAGGATTGGG - Intronic
1121428685 14:93872062-93872084 CAGGAGGTGGGGGGAGCACAGGG + Intergenic
1121513885 14:94536065-94536087 GTGTAGGTGGAGAGAGCAGGGGG + Intergenic
1121520117 14:94580553-94580575 CTGCAGGTGGGGTGTGGAGTTGG - Intronic
1121525908 14:94619172-94619194 CTGAAGGTGGAGCAAGCAGTTGG - Intronic
1122147372 14:99699710-99699732 CTGGAGGTTGGGGGAGAAGGAGG - Intronic
1122269556 14:100562461-100562483 CCCGAGGTGGGGACAGCTGTGGG - Intronic
1122403765 14:101484238-101484260 CAGGAGGGAGGGAGAGAAGTTGG + Intergenic
1122412697 14:101534020-101534042 CTGGGGGTGGGGGGGGCACTGGG + Intergenic
1122454591 14:101840462-101840484 TTGGTGGTGGGGGGAGCAGGTGG - Intronic
1122780075 14:104139776-104139798 CTTGAGGCTGGGAGAGGAGTAGG - Intronic
1123110978 14:105866703-105866725 CTGGATGTGGGGAGAGGGTTGGG + Intergenic
1123771422 15:23533633-23533655 CTGGAGGTGGAGAGTACAGGAGG + Intergenic
1124027053 15:25976574-25976596 CTGGAGGAGCGGCCAGCAGTGGG - Intergenic
1124222890 15:27865245-27865267 GTGTAGGTGGGGAGAGCTGGCGG - Intronic
1124984321 15:34591501-34591523 GTGGAAGTAGGGAGAGCGGTTGG - Intergenic
1125340620 15:38671970-38671992 CTGGGGGTGTGGAGAACAGCAGG + Intergenic
1127044994 15:55016474-55016496 CTTGAGGAGGGGAGAGCTGGTGG - Intergenic
1127256429 15:57297429-57297451 CTGGTGGTGGGTAGGGCAATAGG + Intronic
1127521669 15:59749045-59749067 GCGGGGGTGGGGAGAGCATTAGG + Intergenic
1127858874 15:62976457-62976479 ATGGAGGTGGGGAGAGGGTTGGG + Intergenic
1128273170 15:66329836-66329858 CAGGAGGTGGAGATTGCAGTGGG + Intronic
1128523124 15:68388735-68388757 CTGGAGGTGAGGAGTCAAGTGGG - Intronic
1128567679 15:68711922-68711944 CTGGAGGTAGGGGGTGCAGTGGG - Intronic
1129049257 15:72765220-72765242 CAGGAGGTGGAGATTGCAGTGGG - Intronic
1129112654 15:73346777-73346799 CTGGAGGAGGTGAGAGGAGTTGG + Intronic
1129181183 15:73876903-73876925 CTGGGGGTGGGAGGGGCAGTGGG - Intronic
1129332457 15:74834641-74834663 AGGTAGGTGTGGAGAGCAGTGGG - Intergenic
1129349612 15:74947708-74947730 CAGGAGGTGGAGGGTGCAGTAGG - Intergenic
1129425119 15:75456977-75456999 CTGAAGGTGGGGAAAGCTTTCGG - Intergenic
1129455907 15:75676124-75676146 CTGGAGGTGGGCAGGCCAGAGGG - Exonic
1129503515 15:76061455-76061477 CTGGAGGTGGGGAGCCCTGAGGG + Intronic
1130338481 15:82978396-82978418 TTGGAGGTGGGGACAATAGTGGG + Intronic
1131139268 15:89963912-89963934 CTGTGGGAGGGCAGAGCAGTGGG - Intergenic
1131149877 15:90040699-90040721 CTGGAGTTGGGGAGCGAGGTGGG - Intronic
1131232605 15:90670579-90670601 CTGGAGGGGTGGGGAGCAGGGGG + Intergenic
1131681945 15:94732729-94732751 CTGGAGGTGGAGCTTGCAGTGGG + Intergenic
1132131734 15:99287929-99287951 CTGGAGGTAGGAATTGCAGTTGG - Exonic
1132449184 15:101956194-101956216 TTGGAGGTGGGAAGAGCAGGCGG - Intergenic
1132497467 16:270662-270684 CTAGGGGTGGGGACAGCACTGGG + Intronic
1132664414 16:1075037-1075059 CTGGAGGGGGAGCCAGCAGTAGG - Intergenic
1132777666 16:1604720-1604742 CTGGAGGAGGGAAGGGCGGTTGG + Intronic
1132831998 16:1932994-1933016 CTGGAGCTGCGGAGAGCAGGGGG - Intergenic
1133220625 16:4317722-4317744 CTGGAGGTGGGCAGTGAAATGGG - Intronic
1133245691 16:4447440-4447462 CTGGAGGTGGGAAGAGCTGGAGG - Intronic
1133398056 16:5464232-5464254 CTGGTGCTCAGGAGAGCAGTTGG + Intergenic
1133600782 16:7338189-7338211 GTGGGGGTGGGGAGAGCATTAGG - Intronic
1134879021 16:17728119-17728141 CTGGAGGTGGAGAGAGGGGCTGG - Intergenic
1135099508 16:19593841-19593863 CAGGAGGTGGAGATTGCAGTGGG + Intronic
1135251707 16:20906071-20906093 TAGGAGGTGGGGAGAGCAGGGGG - Intronic
1135279061 16:21138172-21138194 CAGGAGGTGGAGATTGCAGTGGG + Intronic
1135411254 16:22236296-22236318 CTGCAGGAGGGGAGAGTAGTTGG + Intronic
1137444829 16:48525372-48525394 CTGGAGGGGGAGAGAGTAGTAGG + Intergenic
1137646543 16:50080058-50080080 CTGGAGGAAGGGAGAGCACAGGG + Intronic
1137843426 16:51663189-51663211 CTAGGGGTGGGGAGAGGAGGTGG - Intergenic
1137889641 16:52145560-52145582 CTGGGGGTGGGGCGGGAAGTAGG + Intergenic
1138008649 16:53358803-53358825 GTGCAGGTGGGGAGAGCAGAAGG + Intergenic
1138240900 16:55426246-55426268 CTGGAGGAGGGCAGAACAGAGGG + Intronic
1138322276 16:56125796-56125818 TGGGAGGTGGGGAGAACAGCTGG - Intergenic
1138329410 16:56201555-56201577 CTGGAGGTTGGGAGACCAGATGG + Intronic
1138367055 16:56488723-56488745 CTGGAGGTTGGGAGAGGGGTGGG + Intronic
1138452074 16:57099130-57099152 CTGGAAGTCAGGATAGCAGTAGG - Intronic
1138759671 16:59527445-59527467 CTGAAGCTGGGCAAAGCAGTGGG - Intergenic
1138795964 16:59969284-59969306 CGGGAGATGGGGAGAGCATTGGG - Intergenic
1140012958 16:71154558-71154580 CTGGAGGTGGGAAGGGTAGTGGG - Intronic
1140445474 16:75023942-75023964 CAGGAGGTGGAGATTGCAGTGGG - Intronic
1140715459 16:77722332-77722354 CTTGAGGTGGGGAGAGGCGCGGG - Intergenic
1140727000 16:77822529-77822551 TTGGAGGAGGGGAGAGAAGAAGG + Intronic
1140880919 16:79197457-79197479 CTGGAGGGGGGCAGTGCAGGGGG - Intronic
1141124314 16:81389476-81389498 GCGGAGGTGGGCAGAGCAGGGGG - Exonic
1141509308 16:84502285-84502307 CTGGGGGAGGGGAGTGCCGTTGG + Intronic
1141818671 16:86430425-86430447 AGGGAGGTGGGGAGAGAAGCTGG - Intergenic
1142144041 16:88485263-88485285 CTGGTGCTGGGGGGAGCAGGTGG + Intronic
1142170264 16:88618265-88618287 AGGGAGGTGGGGAGAGCATGTGG + Intronic
1142174813 16:88640216-88640238 CTGGAGATGAGGAGAACAGTGGG - Exonic
1142194569 16:88733478-88733500 CTGGGCTTGGGGAGGGCAGTGGG + Intronic
1142201152 16:88761741-88761763 GGGGAGGTGCGGAGGGCAGTGGG - Intronic
1142694031 17:1623594-1623616 CTGGAGGAGAGGAGAGAAGTGGG - Intronic
1142699618 17:1651068-1651090 GGGGATGTGGGGATAGCAGTAGG - Intronic
1142781189 17:2182448-2182470 CTAGAGGTGGGGAGGGCATGGGG + Intronic
1142896191 17:2980670-2980692 CTGGATGTGGTGAGTGCTGTAGG + Intronic
1143014417 17:3884037-3884059 CTGGTGGTGGGTAGTGCAGATGG - Intronic
1143309553 17:5977240-5977262 CTGGATGCGGGGAGATCAGGTGG + Intronic
1143331715 17:6141715-6141737 CTGGAGGTGGAGACAGAAGGGGG - Intergenic
1143518328 17:7431041-7431063 TTGGAGGTTGGAAGAACAGTAGG - Intergenic
1143627836 17:8121461-8121483 CAGGTGTTGGGGAGGGCAGTGGG - Exonic
1143767089 17:9144963-9144985 CTGGAGCTGGAGATAGCTGTGGG - Intronic
1143840203 17:9725770-9725792 CGGCAGGTGGCGAGAGGAGTTGG - Intronic
1143858299 17:9869200-9869222 CTGGAGGAGGGGAGATCAGTTGG - Intronic
1144601356 17:16617600-16617622 GTGGAGGTGGATACAGCAGTCGG - Intergenic
1145878872 17:28339747-28339769 CTCGGGGTGGGGAGGGCAGGAGG + Intronic
1145980148 17:29006204-29006226 CTGGGGGTGGGCAGCGCAGAAGG - Exonic
1146033939 17:29390323-29390345 CTGGAGGAGGGGAGTGGTGTCGG + Intergenic
1146124381 17:30220362-30220384 CTGGGGGAGAGCAGAGCAGTGGG - Intronic
1146466341 17:33089689-33089711 CTGAAGGTGGGGATATCAGGAGG + Intronic
1147042876 17:37731626-37731648 CTGGTGGTGGGGGGAGCCGTGGG + Exonic
1147310316 17:39592230-39592252 CTGGAGGTGGGGGAGGCAGCGGG - Intergenic
1147498917 17:40943443-40943465 GGGCGGGTGGGGAGAGCAGTAGG - Intergenic
1147522897 17:41191465-41191487 ATAGAGGTGGGGAGAGTATTTGG - Intronic
1147603088 17:41757851-41757873 GTGGAGGTGGGCAGTGCTGTGGG - Intronic
1147914717 17:43879480-43879502 CTGGGGTTGGGGTGAGCACTTGG + Intronic
1148078934 17:44956692-44956714 CTGGAGGTGGAGGTTGCAGTGGG + Intergenic
1148210642 17:45806539-45806561 CTGGAGGAAGGGAGGGAAGTGGG + Intronic
1148353104 17:46955673-46955695 CTGGAGGAGGTGAGTGCAGAAGG - Intronic
1148858515 17:50592097-50592119 GGTGAGGTGGGCAGAGCAGTGGG - Intronic
1148863271 17:50615532-50615554 CTGGAGGTGGGGGGGCCAGATGG - Intronic
1149231871 17:54544391-54544413 CTGGAGCTGGGGAGACTAGGTGG + Intergenic
1149541585 17:57471863-57471885 CTGGAGGAGAGGAGAGGAGAGGG + Intronic
1149734618 17:58980886-58980908 CTGGAAGTGGGAAGAGAAATAGG + Exonic
1149771871 17:59328828-59328850 CTGGAAGCAGGGAGATCAGTTGG + Intergenic
1150007736 17:61479985-61480007 CTGGGGGTGGGGCGGGCAGATGG + Intronic
1150809550 17:68345947-68345969 CGGGAGGTGGGGGTTGCAGTGGG - Intronic
1150950387 17:69797569-69797591 CAGGACGTGGGGAGAGCGGCAGG + Intergenic
1151045643 17:70917123-70917145 CTGGGGCTGTGCAGAGCAGTGGG - Intergenic
1151150349 17:72079774-72079796 GTGGAGGTGGGGAGAGAAGGCGG + Intergenic
1151240064 17:72750420-72750442 CTGGAGGTGGGGTGGGGGGTGGG + Intronic
1151246517 17:72799002-72799024 GTGGAGGAGGGGAGAGGAGCTGG + Intronic
1151365378 17:73613344-73613366 GCGGGGGTGGGGAGAGCAGAGGG - Intronic
1151507596 17:74539711-74539733 CTGGAGGCAGGCAGAGGAGTGGG - Intergenic
1151657293 17:75501992-75502014 CAGGAGTTGGGGAAGGCAGTGGG + Exonic
1151872206 17:76844019-76844041 CTGGAGGTGGGGACATCTGGTGG + Intergenic
1152036904 17:77879320-77879342 CTGCTGGTGGGGAGAGGGGTAGG + Intergenic
1152148960 17:78587054-78587076 CAGGAAGTGGCGAGAGCAGTGGG + Intergenic
1152261638 17:79270396-79270418 CTTGAGCTGGGGAGTGCAGGAGG - Intronic
1152284549 17:79404569-79404591 CTGGATGTGGGCAGAGGAGAGGG - Intronic
1152288531 17:79425803-79425825 GTGGAGATGGGGAGGGCAGGAGG + Intronic
1152408910 17:80112226-80112248 CAGCGGGTGGGGAGAGCACTCGG - Intergenic
1152434106 17:80264648-80264670 GTGGAGGCGGGGAGACCAGCAGG - Intronic
1152451397 17:80383244-80383266 CTGTAGGAGGGAAGAGCACTTGG - Intronic
1152617726 17:81345684-81345706 CTGGCCGTGGGGCGAGCAGCCGG - Intergenic
1152789838 17:82273120-82273142 CCAGGGGTGGGGAGGGCAGTGGG - Intronic
1152800897 17:82330209-82330231 GGGGTGGTGCGGAGAGCAGTGGG - Intronic
1153769080 18:8401033-8401055 CTGGGGGTGGGGAGAGGGGATGG - Intronic
1153814789 18:8783056-8783078 TTGGAGGTGGTGAGTGCAGCAGG + Intronic
1153819072 18:8817332-8817354 GTGGAGGAGGAGAGAGCAGAGGG + Intronic
1153942830 18:9992093-9992115 CTGGATGTGGGGATCTCAGTGGG - Intergenic
1154369688 18:13748472-13748494 CCAGAGGTGGAAAGAGCAGTCGG + Intronic
1155173002 18:23280944-23280966 CTGGGGGTGGGGAGAGGCGTGGG - Intronic
1155277149 18:24199288-24199310 CTGGGGGTGTGGCGAACAGTGGG + Intronic
1155397854 18:25405429-25405451 CTGGTGGTGGGAATAGGAGTAGG + Intergenic
1155915084 18:31549603-31549625 TTGGAGGTGGGCTGATCAGTTGG + Intergenic
1156489401 18:37487376-37487398 TTGGAGGTGGGGAAGGCAGAGGG - Intronic
1156516948 18:37688189-37688211 CTGGATGTGGAGAGTGCAGCAGG - Intergenic
1156730305 18:40186313-40186335 CTGGAGGTGGAGGTTGCAGTGGG - Intergenic
1157314378 18:46575823-46575845 AGGGAGGAGGGGAGAGCAGTAGG - Intronic
1157566041 18:48679965-48679987 CTGTATGTAGGGAGAGCAGTTGG + Intronic
1157647651 18:49292955-49292977 CTAGAGGAGGGGATAGCATTAGG - Intronic
1158390266 18:57039263-57039285 CTGGATGTTGGTGGAGCAGTTGG + Intergenic
1158714186 18:59863219-59863241 CAGGAGGTGGAGATTGCAGTGGG + Intergenic
1159138609 18:64365969-64365991 GTGGAGGTGGGGAGGGTAGAAGG + Intergenic
1159682444 18:71371587-71371609 CTGGGGTTGGGGAGAGGAATGGG + Intergenic
1160078830 18:75703886-75703908 CTGGGGGTGCAGAGAGCTGTGGG + Intergenic
1160130181 18:76218444-76218466 CTGCTGGTGGGGAGCCCAGTAGG + Intergenic
1160533139 18:79577088-79577110 CTGGAGCTGCTCAGAGCAGTGGG - Intergenic
1160636072 19:76359-76381 TTGGAGGTGGGAAGAGCAGGCGG + Intergenic
1160965309 19:1744723-1744745 CTGGAGGGGGGAAGAGGAGGAGG - Intergenic
1161208902 19:3056249-3056271 CTGGAGGTGGGGGGAGGAGGGGG + Intronic
1161285496 19:3466366-3466388 CTGGAGGTGGTGAGGGCTGCAGG - Intronic
1161440978 19:4291516-4291538 CTGGAGGTGGGGAGAAGAAGGGG - Intergenic
1161498155 19:4598479-4598501 CTGGCGGTGGGGAGGTCAGAGGG - Intergenic
1161535450 19:4816433-4816455 CTGGCTGTGGGGAGGGCGGTGGG + Exonic
1161646033 19:5453992-5454014 CTGTGGGAGGGGAGAGAAGTGGG + Intergenic
1161666216 19:5578627-5578649 CTGGAGGTGGGGGAAGCCGTGGG - Intergenic
1161741992 19:6026946-6026968 ATGGAGGTGGGGAGGGAGGTGGG + Intronic
1161876451 19:6914942-6914964 TTGAAGATGGTGAGAGCAGTAGG + Intronic
1162128539 19:8511961-8511983 CTGGAGGTGGGCAGAGGGCTGGG + Intronic
1162348431 19:10134782-10134804 CTGGAGGTGGAGGTTGCAGTGGG + Intronic
1162767433 19:12928523-12928545 CTGGAGATGGGGTGAGCACAGGG - Exonic
1162775264 19:12975353-12975375 CAGGAGGTGGGCACAGCAGAGGG - Intergenic
1162808035 19:13149092-13149114 CTGGAGGTAAGGACAGCATTAGG + Intronic
1163089590 19:15010655-15010677 CCAGAGGTGGGGGGAGGAGTAGG - Intronic
1163132672 19:15285429-15285451 CTGGAGCTGGGCAGAGTAGCTGG - Intronic
1163498882 19:17663655-17663677 TTTGGGGTGGGGGGAGCAGTTGG - Intronic
1163500994 19:17676067-17676089 AGGGAGGTGGGGAGAGATGTGGG + Intronic
1163566132 19:18052283-18052305 CGGGAGGTGGGGAGGGGAGGAGG + Intergenic
1163701469 19:18788785-18788807 CGGGAGGTGGGGCGAGCGGCGGG - Intronic
1163854268 19:19687343-19687365 CAGGAGGGAGGGAAAGCAGTAGG - Intergenic
1164579965 19:29428967-29428989 CTGAGGGTGGGCAGAGCAGTAGG + Intergenic
1165258701 19:34595822-34595844 CTGGGGGTGGGGAAGGCAGCAGG + Exonic
1165341718 19:35217092-35217114 CTGGAGGATGAGAGAGCAGGTGG + Intergenic
1165358473 19:35318843-35318865 GTGGAGATGGGGAGAGGGGTGGG + Intergenic
1165445530 19:35855166-35855188 CAGGGGGTGTAGAGAGCAGTTGG - Intronic
1165796511 19:38523129-38523151 CTGGTTGTGGGGAGGGCGGTTGG - Intronic
1165854407 19:38870993-38871015 CTGGAAGTGAGGAGGGCATTCGG + Intronic
1165869275 19:38959350-38959372 CAGGAGGTGGAGATTGCAGTGGG - Intronic
1166042563 19:40212738-40212760 CTGGAGGCTGGGAGCCCAGTGGG + Intronic
1166209294 19:41295755-41295777 GTGGAGGTGGGGACAGCGTTTGG + Intronic
1166283293 19:41809198-41809220 CTGGAGGGAGGGAGAGAAGGAGG + Intronic
1166317763 19:41998495-41998517 CTGGAGGTGGGGAGGGCCTCTGG - Exonic
1166925823 19:46266698-46266720 CTGGAGGTGGAGGTTGCAGTGGG - Intergenic
1167216898 19:48170872-48170894 CTGGACGTGGGGGGAGCATCTGG + Intronic
1167217070 19:48171767-48171789 GTGGAGGAGGGGAGAACAGGTGG - Intronic
1167291891 19:48629212-48629234 CAGGAGGTGAAGACAGCAGTGGG - Exonic
1167369889 19:49074146-49074168 CTGGGGGTGTGGAGAGAGGTAGG + Intergenic
1167374015 19:49101759-49101781 CTGGAGGTGGGGGGAGGGGTCGG + Intronic
1167448562 19:49553956-49553978 GTGGAGGTGGAGAGGCCAGTGGG + Intergenic
1167649530 19:50721802-50721824 GTAGAGGTGGTGAGGGCAGTGGG - Intergenic
1167801355 19:51744686-51744708 CTGGAGGTGAGGAGATAAGAGGG + Intergenic
1167890978 19:52539050-52539072 CGGGAGTGGGGGAGAGAAGTAGG + Intronic
1168376368 19:55883282-55883304 CGGGAGGTGGAGGGTGCAGTGGG - Intergenic
1168585102 19:57585334-57585356 CTGGAGGTGATGAGAACAATGGG + Intronic
1168675322 19:58273614-58273636 CGGGAGGTGGAGATTGCAGTGGG + Intronic
925320225 2:2960551-2960573 CTGGACTTGGGGAGATCAGATGG - Intergenic
925337490 2:3108841-3108863 CTGGAGAAGGCGAGGGCAGTGGG - Intergenic
925507450 2:4584202-4584224 CAGGGGGTGGGGACAGGAGTGGG - Intergenic
925830009 2:7884479-7884501 CTGGGGGTGGGGAGGGAACTCGG + Intergenic
926089438 2:10040954-10040976 CTGGAGGGAGGGAGACCTGTTGG + Intergenic
926108638 2:10168196-10168218 CTGCAGTTGGGGAGAGAGGTTGG - Intronic
926205719 2:10833291-10833313 CCGGAGGAGGGGAGAGGAGAGGG - Intronic
926297595 2:11579874-11579896 CTGGAGTCCAGGAGAGCAGTCGG - Intronic
926615869 2:14995987-14996009 CTGGAGGTGGGGAGTACATGGGG - Intergenic
927395672 2:22648185-22648207 CTGGAGGAAGAGAGAGAAGTGGG - Intergenic
927928152 2:27027110-27027132 CAGGGGGTGGGGAGGGCAGGTGG - Exonic
928142700 2:28744338-28744360 CAGGAGGTGGGGATCGCAGCGGG + Intergenic
928200854 2:29246814-29246836 CTGGAGGTGGGGAGAGCAGTTGG - Intronic
928549730 2:32358063-32358085 GTGGGGGTGGGGAGGGAAGTAGG + Intronic
929440681 2:41963959-41963981 CAGGATGTGCAGAGAGCAGTGGG + Intergenic
929884072 2:45863015-45863037 CTGGAGGAGAAGAGAGCAGTTGG + Intronic
929994385 2:46816331-46816353 CTGGAGGGTGGGAGAGAAATGGG + Intergenic
930052128 2:47224610-47224632 CAGGAGATGGGGAGAGGAGCCGG - Intergenic
930104882 2:47631965-47631987 CTGGGGGTGGAGAGAGCCTTTGG + Intergenic
930767339 2:55097484-55097506 CTGGAGGCAGAAAGAGCAGTTGG + Intronic
931367314 2:61629996-61630018 GTGGAGGCGGGGTGAGGAGTAGG + Intergenic
931666361 2:64612202-64612224 CTGGAGGCTGGGGGACCAGTTGG + Intergenic
932495978 2:72146016-72146038 CTGGAGGTGAGGAGGGAAATAGG - Intronic
933721860 2:85402037-85402059 CTGGGGATGAGGAGAGCAGTGGG + Intronic
934501990 2:94869307-94869329 CCAGAGATGGGGAGGGCAGTTGG - Intergenic
934536697 2:95140144-95140166 CTGAGGGTGGGGATAGCATTAGG + Intronic
934652354 2:96099842-96099864 TGGGAGGAGGGGAGAGGAGTAGG + Intergenic
934741498 2:96726708-96726730 CAGGAGGTGGAGATTGCAGTGGG + Intronic
935217211 2:100983648-100983670 GAGGAGGTGGGGAGAGCAGCAGG - Intronic
935220807 2:101010806-101010828 CTGGAGGTGGAGGTTGCAGTGGG + Intronic
935249268 2:101247401-101247423 CGGGAGGTGGAGATTGCAGTGGG + Intronic
935790664 2:106587328-106587350 CAGGCGCTGGGGAGAGCAGGGGG - Intergenic
936402233 2:112174129-112174151 CTGGAAGTGGGCAGATCACTAGG - Intronic
936565409 2:113578691-113578713 TTGGAAGTGGGAAGAGCAGGCGG - Intergenic
938191063 2:129280980-129281002 TTGGTGGTGGGGAGGACAGTGGG + Intergenic
938899729 2:135789879-135789901 AAGGCGGTGGGGAGAGCAGTAGG - Intronic
939168429 2:138665186-138665208 TTGGAGGTGGTGAGAGGGGTTGG - Intergenic
939734840 2:145830608-145830630 CTGGTGGTGGGTAGTGAAGTTGG - Intergenic
941860299 2:170272383-170272405 CTGGAAGTAGGGAGACCAGCTGG - Intronic
942064057 2:172253624-172253646 TGGCAGGAGGGGAGAGCAGTTGG + Intergenic
942666279 2:178322242-178322264 TTGGAGGTGGGGGAAACAGTTGG + Intronic
942893168 2:181017077-181017099 CTGGAGGTGGAGACAGAATTGGG + Intronic
943124101 2:183775182-183775204 CTGGGGGTGGGGTTAGCATTAGG - Intergenic
943623679 2:190177239-190177261 GTGGAGGTGGTGGGAGCAGGTGG + Intronic
943723066 2:191225394-191225416 CTGGGGGTGGGGGAAGCATTTGG - Intergenic
943794959 2:191980693-191980715 CTGGAGGTCTGGAGAGAAGAGGG - Intronic
944136770 2:196408079-196408101 CAGGAGGTTAGAAGAGCAGTAGG + Intronic
945471275 2:210230075-210230097 GTGGAGGTGGGGAGAGTAAATGG + Intergenic
946247092 2:218394103-218394125 CGGGAGCTGGGGAGAGCAGCAGG - Exonic
946374553 2:219300165-219300187 CTGGAGGTAGGGCTGGCAGTGGG + Exonic
946642295 2:221797169-221797191 GTGGAGGTGGAGGGAGGAGTGGG + Intergenic
946981401 2:225220085-225220107 GTGGAGGGAGGGAGAGCACTAGG - Intergenic
946996020 2:225392325-225392347 GTGGGGGTAGGGAGAGCATTAGG + Intergenic
947133533 2:226954576-226954598 GTGGGGGTCGGGGGAGCAGTGGG - Intronic
947973443 2:234344056-234344078 CTGGAACTGAGGAGAGGAGTGGG - Intergenic
948025543 2:234773178-234773200 CTGGAGGGGGGCAGAGTAATGGG + Intergenic
948063055 2:235056104-235056126 CTGGAGGTAGGGGGAGGAATGGG + Intergenic
948505027 2:238422668-238422690 CTGGAGGAGGGGAGGGAGGTTGG + Intergenic
948571916 2:238923014-238923036 CTGCAGGTGGGGAGGGAAGCAGG - Intergenic
948617184 2:239207075-239207097 CCAGCGGTGGGGAGAGCAGGTGG - Intronic
948674919 2:239591617-239591639 CAGGAGGTGTGGACGGCAGTGGG + Intergenic
948827387 2:240579240-240579262 CAGGAAGTGGGGAGGGCAGGAGG + Exonic
948834706 2:240620411-240620433 CTGCAGGTGGGCAGAGCTGGAGG + Intronic
949042524 2:241855865-241855887 GTGGAGGTGGGAAGGGCTGTGGG + Intronic
1168851185 20:978131-978153 CAGGAGGTGGGGGGACCAGCAGG + Intronic
1169028713 20:2391516-2391538 CTGGAGGAGTGGAAAGCAATGGG + Intronic
1169838481 20:9907270-9907292 GTGGAGGTGGAAAGAGAAGTAGG + Intergenic
1169924067 20:10765106-10765128 CTGGAGGCAGGCACAGCAGTAGG + Intergenic
1170404283 20:16020011-16020033 CTGGCAGTGGGAAGAACAGTTGG - Intronic
1170589179 20:17758309-17758331 CTGGAGGAGCGGACAGCAGTTGG + Intergenic
1170794971 20:19539303-19539325 CCAGAGGTGGGGAGGGCAGGAGG - Intronic
1170830049 20:19832369-19832391 AGGGAGGTGGGGAGAGCCATCGG - Intergenic
1170880351 20:20291687-20291709 CTGGAGGGGAGGAAAACAGTGGG - Intronic
1171217607 20:23363158-23363180 CTGGAGAAGGGGAGAGGGGTGGG + Intronic
1171250948 20:23646893-23646915 CTGGAGGTAGAGATTGCAGTGGG - Intergenic
1171488407 20:25500038-25500060 CTGGAGGGGGCGACAGCTGTTGG - Intronic
1172115933 20:32573726-32573748 CTGCAGGTCAGCAGAGCAGTGGG - Intronic
1172183904 20:33019742-33019764 CTGGATGTGGTGAGTGCGGTGGG + Exonic
1172484294 20:35288994-35289016 CTGGATGTGGGGAGTGCCCTGGG - Intronic
1172766751 20:37355224-37355246 GTGGGGGTGGGGAGGGCAGGAGG - Intronic
1173028911 20:39336317-39336339 TTGGAGGTGTGGAGAGCATGTGG + Intergenic
1173236371 20:41249725-41249747 AAGGAGGTGGGGAGAGAAATGGG - Intronic
1173488654 20:43459774-43459796 GTGGAGGTGGATACAGCAGTCGG + Exonic
1173558471 20:43984834-43984856 CTGGGGGAGGGGATAGCAGTGGG + Intronic
1173672075 20:44805814-44805836 CTGGGGGTGTGGAGAGAAATCGG + Intronic
1173958360 20:47052258-47052280 CTGGAGTTGGGGGGAGCATGGGG + Intronic
1174131517 20:48346832-48346854 TGGGAGGTGGGGAGAGGAATGGG - Intergenic
1174133603 20:48363243-48363265 CTGGAGGTGGAGGTTGCAGTGGG - Intergenic
1174549036 20:51348186-51348208 CTGGGGGTGAGGATAACAGTTGG + Intergenic
1175204499 20:57301435-57301457 CTGGAAGTGGGGACAGGAGCGGG - Intergenic
1175530727 20:59672868-59672890 GTGGAGGTGGGAAGAGCCTTGGG + Intronic
1175612880 20:60366112-60366134 CCGGAGGAGGGGAGAGACGTTGG - Intergenic
1175633454 20:60560919-60560941 ACTAAGGTGGGGAGAGCAGTTGG + Intergenic
1175772352 20:61631800-61631822 CTGAAGGTGTGGACAGCAGTGGG + Intronic
1176180491 20:63747374-63747396 GTGGAGGTGGGGGGGGCAGGTGG + Intronic
1176231263 20:64034254-64034276 GTGCAGGTGGGCAGAGCTGTGGG - Intronic
1176430662 21:6573608-6573630 TGGCAGGTGGGCAGAGCAGTGGG + Intergenic
1176695436 21:9971999-9972021 CTTGAGGAGTTGAGAGCAGTGGG - Intergenic
1178314176 21:31555602-31555624 CTTGAGGAGGGCAGAGGAGTGGG - Intronic
1178473169 21:32913301-32913323 TTGGGGGTAGGGAGAGCATTAGG - Intergenic
1178910022 21:36666829-36666851 CTGGAGGCGGGGAGGCCATTTGG + Intergenic
1179340678 21:40505811-40505833 CTGGATATGGGGAGTGTAGTGGG - Intronic
1179562958 21:42228380-42228402 CTGTGGCTGGGGAGGGCAGTGGG - Intronic
1179706056 21:43181070-43181092 TGGCAGGTGGGCAGAGCAGTGGG + Intergenic
1179961384 21:44768711-44768733 CTGCAGGAGGGAAGCGCAGTCGG + Exonic
1180028189 21:45180951-45180973 CGGGATGTGGGGAGAGGACTCGG - Intronic
1180201434 21:46227194-46227216 CTGTAGGTGGGCAGAGTGGTGGG - Intronic
1181917277 22:26291450-26291472 TTGGGGGAGGGGAGAGCATTAGG + Intronic
1182159949 22:28111647-28111669 CCGGAGCTGGGGAGGGCAGTAGG + Intronic
1182257258 22:29048258-29048280 TTGGAGGTGGGGAGGAGAGTAGG + Intronic
1182288203 22:29260241-29260263 TTGGGGGTGGGGGGAGAAGTGGG + Intronic
1182355255 22:29719932-29719954 CTGGGGGTGGGGAGCGCGGAGGG + Intergenic
1182456883 22:30457454-30457476 CAGGAGGTGGAGATTGCAGTGGG - Intronic
1182585671 22:31343158-31343180 CTGGAGGGGGGAAGAGAAATGGG + Intronic
1182654503 22:31879304-31879326 CTGGGGGTGGGAGGAGGAGTTGG - Intronic
1182916453 22:34037187-34037209 CTGGAGATGAGGAGAAGAGTGGG + Intergenic
1182923046 22:34097710-34097732 GTGGAGGTGGGGAGGGATGTGGG + Intergenic
1182971283 22:34580693-34580715 CTGTAGTTGGGGAGTGGAGTAGG - Intergenic
1182977637 22:34638226-34638248 CTGTAGGTGGGGAGTGCAGAGGG - Intergenic
1183204311 22:36408089-36408111 GTGGAGGAGGGGAGAGGAGATGG - Intergenic
1183226932 22:36556875-36556897 CTGGAGGTGGAGACAGAAATGGG - Intergenic
1183265437 22:36822302-36822324 CGGGAGGTGGAGATTGCAGTGGG + Intergenic
1183318695 22:37150730-37150752 ATGGAGATGGGAAGGGCAGTGGG - Intronic
1183467387 22:37986537-37986559 ATGGGGGTGGGGGTAGCAGTGGG + Intronic
1183530433 22:38350599-38350621 CTGGAGATGGGGCGGGCAGTAGG - Intronic
1183724711 22:39582062-39582084 GTGGAGGTGGACAGAGCAGGGGG + Intronic
1183921717 22:41174931-41174953 GTGGTGATGGGGGGAGCAGTGGG - Intronic
1183960952 22:41411583-41411605 GTGGAGGAGGGGTGAGCAGTAGG - Intergenic
1184092345 22:42299312-42299334 CTGGATGTGGGGAGAGGGGCTGG - Intronic
1184689084 22:46109348-46109370 CTGGAGGTAGGAGGAGCCGTGGG + Intronic
1184829852 22:46977762-46977784 CTGGAGGTGGAGGGAGGGGTTGG + Intronic
1185003811 22:48263415-48263437 TTGGAGGTGGGAAGAGCTTTGGG + Intergenic
1185053402 22:48565307-48565329 CTAGCGGTGGGTAGAGGAGTGGG + Intronic
1185074492 22:48676013-48676035 CTGGCGGTGGGGCAGGCAGTGGG + Intronic
1185227970 22:49664001-49664023 CTGGAGCTGGGGACAGAACTCGG - Intergenic
1185410409 22:50678688-50678710 CAGGAGGTGAGGAGTGGAGTCGG + Intergenic
1185413670 22:50698399-50698421 CTGGGGGTGGGGGCAGCAGCAGG + Intergenic
949386644 3:3509921-3509943 CAGGGGGTGGGGAGAGAAGGGGG + Intergenic
949434419 3:4013060-4013082 ATGGAGGTGGGGAGGGGAGGTGG + Intronic
949535014 3:4988848-4988870 CTGGAGGGAGGGAGAGAAGGAGG + Intergenic
949736086 3:7173365-7173387 AGAGGGGTGGGGAGAGCAGTTGG - Intronic
949893579 3:8752575-8752597 CTGGACTTGGGGTAAGCAGTGGG - Exonic
950153654 3:10707327-10707349 CTGGAGATGCGGAGAGCACTTGG + Intronic
950812399 3:15661190-15661212 CGGGAGGTGGAGACTGCAGTGGG + Intergenic
952019053 3:28994930-28994952 CTGGTTGTGGGGAGAGGAGTGGG + Intergenic
952373759 3:32747944-32747966 TTGGAGGTGGGGGGAGCGTTGGG - Intronic
952421532 3:33136050-33136072 CTGGAGGTGGAGGCAGGAGTGGG - Intronic
953110415 3:39932219-39932241 CTGGTGATGGAAAGAGCAGTAGG + Intronic
953434682 3:42869072-42869094 TATGAGGTGGGAAGAGCAGTGGG - Intronic
953517071 3:43604309-43604331 ATGGAGGTGGGGATAAAAGTAGG - Intronic
953929802 3:47000211-47000233 CTGGTGGTGGCGGCAGCAGTGGG + Exonic
954138668 3:48594092-48594114 CTGGAGATGGGGAGCCCAGGAGG - Intronic
954224526 3:49173464-49173486 CTGGGGTGGGGGAGAGGAGTAGG + Intronic
954305035 3:49721124-49721146 TTGGTGGTGGGGAGAGCAGTAGG + Exonic
954566440 3:51604050-51604072 GTGGAGGTGGTGAAAGTAGTTGG + Intronic
954714948 3:52522307-52522329 CTGGGGTTGGAGAGAGCAGTGGG - Intronic
954756138 3:52841158-52841180 CTGGAGGTGGACTGAGAAGTGGG - Intronic
954801384 3:53189035-53189057 CTGGCGGTGGGGAGAGCAGCAGG - Intronic
955856196 3:63276695-63276717 CTGCATGTAGGAAGAGCAGTAGG + Intronic
956040717 3:65142313-65142335 GTGGAGGGAGGGAGAGCATTAGG - Intergenic
956746200 3:72312687-72312709 CTGGAGGATGGGAGGGAAGTAGG + Intergenic
957544469 3:81620254-81620276 CGGGAGGTGGAGGGTGCAGTGGG - Intronic
958796425 3:98711185-98711207 CTGGAGGCAGGGATTGCAGTGGG - Intergenic
959948139 3:112149156-112149178 CAGGAAGTGGGGGGAGCAGTTGG + Intronic
960147095 3:114215117-114215139 CAGGAGGTGGGGTGAGCACATGG + Intergenic
960159813 3:114338404-114338426 GTGGGGGTGGGAAGGGCAGTGGG - Intronic
960352280 3:116607773-116607795 CTGGAGAAGTTGAGAGCAGTGGG + Intronic
960383294 3:116990762-116990784 GTGGTGGTGGCGATAGCAGTTGG - Intronic
961116437 3:124334073-124334095 CTGGTGGAGGGCAGAGCAGCTGG - Intronic
961406632 3:126684325-126684347 CTGGATGGAGGGAGAGCAGGTGG + Intergenic
961621915 3:128231054-128231076 ATGGAGGGGAGGAGAGGAGTAGG - Intronic
962167376 3:133063473-133063495 CTAGAGGTGGAGTGAGCAGTGGG + Intronic
962389923 3:134962780-134962802 CAGGAGGAGGGGAGGGCAGAGGG - Intronic
962471246 3:135711202-135711224 CTGGAGGAAGGGAGAGCTGAGGG - Intergenic
962701500 3:138004098-138004120 CTGGAGGTGGAGGTTGCAGTGGG + Intronic
962744092 3:138384646-138384668 CTGTAGGAGGGGAGACCTGTGGG + Intronic
962826551 3:139104844-139104866 CAGGATGTGGGGACAGCAGAGGG - Intronic
963097691 3:141562744-141562766 CGGGAGGTGGAGATTGCAGTGGG - Intronic
963916677 3:150865112-150865134 GAGAAGGTGAGGAGAGCAGTCGG + Intergenic
964394799 3:156234142-156234164 CTGGGGTTGGGGAGAGGAGGAGG + Intronic
964608068 3:158580144-158580166 GTGGAAGTAGGGAGAGCATTAGG + Intronic
964649037 3:158991165-158991187 CTGGGGGAAGGGAGAGCTGTAGG - Intronic
965091021 3:164163017-164163039 CTGGGGGTAGGGGCAGCAGTGGG - Intergenic
965343713 3:167521073-167521095 CTGGAGTTGCAGGGAGCAGTGGG + Intronic
965679421 3:171235113-171235135 CAGGAGGTGGAGATTGCAGTGGG - Intronic
965985502 3:174748166-174748188 GTGGAGGGAGGGAGAGCATTAGG + Intronic
966065563 3:175817268-175817290 CTGGAGGCGGAGATTGCAGTGGG + Intergenic
966200152 3:177353616-177353638 GTAGAGGTGGGAAGATCAGTTGG + Intergenic
966557914 3:181284607-181284629 GAAGAGGTGGTGAGAGCAGTAGG + Intergenic
967711224 3:192710717-192710739 CTGGGATTGTGGAGAGCAGTTGG - Intronic
967806616 3:193719723-193719745 CTGGAGGTGGGTGGGGCAGCAGG + Intergenic
967826235 3:193879786-193879808 CTGGAGGTGGAGAGACCAGCTGG + Intergenic
968430640 4:556360-556382 GTGGAGGTGGGGAGGGCTCTGGG - Intergenic
968534469 4:1114116-1114138 GTGGGGGTGGGGGGGGCAGTTGG + Intergenic
968670476 4:1847920-1847942 CGGGAGGTGGAGATTGCAGTGGG + Intronic
969900950 4:10348847-10348869 CAGGGGGTGGGGATAGCATTAGG - Intergenic
970182332 4:13412352-13412374 CTGGGGGTGGGAGGAGAAGTGGG + Intronic
970365542 4:15354436-15354458 CTGGATGTGGGGAGGCCAGATGG + Intronic
970720160 4:18977604-18977626 CTGGAGGTGGGAAGATCACGAGG + Intergenic
971044582 4:22791173-22791195 GTGGAGGTGGGGAGAACATTTGG + Intergenic
971176011 4:24283377-24283399 CTGAAGGTGGGTAGGGCAGGTGG - Intergenic
971329426 4:25670405-25670427 CTGGTGTTGAGGACAGCAGTGGG - Intronic
971451507 4:26805629-26805651 GTGGAGGTGGGGAGCCCAGATGG - Intergenic
971464192 4:26937287-26937309 CCGGAAGGGGGCAGAGCAGTGGG + Intronic
971937511 4:33171282-33171304 CTGGAGGTGGAGGCTGCAGTGGG + Intergenic
972191672 4:36600539-36600561 GTGGGGGTGGGGATAGCATTAGG - Intergenic
972397809 4:38672583-38672605 CTGGGGGTGGGCAGGGCAGCCGG + Intronic
972440042 4:39079194-39079216 GTGGAGGCAGGGAGACCAGTTGG - Intronic
974120876 4:57637647-57637669 AGGGAGGTGGGGAGAGATGTGGG - Intergenic
975621948 4:76305355-76305377 GGGAAGGTGGGGAGAGTAGTAGG + Intronic
976244948 4:82997609-82997631 TTGGAGGCAGGGAGACCAGTTGG + Intronic
976368989 4:84265429-84265451 GGGGAGGATGGGAGAGCAGTGGG + Intergenic
976431445 4:84966658-84966680 CGGGAGGTGGAGAAAGCAGGAGG - Intergenic
976609388 4:87014034-87014056 CTGGAGGTTGGTAGAGAAGGTGG + Intronic
976621660 4:87134542-87134564 CTGGCAGTGTGGGGAGCAGTGGG + Exonic
976995221 4:91423354-91423376 CAGGAGGTGGAGATTGCAGTAGG + Intronic
977277156 4:94992028-94992050 ATGGAGCTGGGAAGAGCAGATGG - Intronic
977739388 4:100459574-100459596 CTGGAGGTGGGGAGTTGGGTAGG - Intronic
978764031 4:112386196-112386218 GAGGAGGGGAGGAGAGCAGTGGG - Intronic
978764776 4:112392849-112392871 CTAGAGTTAGGGAGAGGAGTTGG - Intronic
978789445 4:112645583-112645605 GTGGAGGTGGGGGCAGAAGTTGG - Intronic
978796622 4:112714254-112714276 CAGGAGGTGGAGATGGCAGTGGG - Intergenic
979251487 4:118571239-118571261 CTGAAGAAGGGCAGAGCAGTAGG - Intergenic
979807242 4:124989460-124989482 CTGGAGGTGGAGGTTGCAGTGGG - Intergenic
980368062 4:131832248-131832270 CTCGAGGAGTTGAGAGCAGTGGG - Intergenic
980851599 4:138389023-138389045 ATGGGGGTGGGGATAGCATTAGG - Intergenic
980935216 4:139219624-139219646 CGGGGGGTGGGGATGGCAGTGGG + Intergenic
981736750 4:147961655-147961677 CTGGAGAAGGGGAGAAGAGTGGG - Intronic
981851715 4:149239197-149239219 GTGGGGGTGGGGAGAGAACTAGG + Intergenic
982261552 4:153498551-153498573 TTGGAGGTGGGTAGGGAAGTGGG + Intronic
982452604 4:155570796-155570818 CTGGAGGTGGGGAGGGAGGATGG + Intergenic
983523538 4:168736416-168736438 CTGGAGATGGTGACAGCACTTGG - Intronic
983540629 4:168905871-168905893 CAGGAGGTGGAGACTGCAGTGGG - Intronic
983617487 4:169724355-169724377 GTGGAGGTGGTGAAAGCAGTTGG + Intergenic
984714657 4:182915170-182915192 CTGCAGGTGCTGAGAGCTGTCGG + Intronic
985025702 4:185737318-185737340 CAGGGGGTGTGGAGAGCAGGTGG + Intronic
985045641 4:185938081-185938103 CGGGAGGTGGGGGTTGCAGTGGG - Intronic
985371397 4:189289186-189289208 CTGGATGTGGGCAGAGCCTTTGG - Intergenic
985482911 5:128582-128604 CTGGAGGTGGGGCTGCCAGTGGG + Intergenic
985863882 5:2496188-2496210 CTGGAGGTGGGGCCTGCAGGAGG + Intergenic
985918349 5:2945719-2945741 CTGAAGGACGGGAAAGCAGTGGG + Intergenic
985988172 5:3534743-3534765 CTGGGGGAGGGGATAGCATTAGG + Intergenic
986607288 5:9535069-9535091 TGGGAGGTGGGAAGAGCAGAAGG - Intronic
986696757 5:10363935-10363957 CTGGAACTGGGGAGAGCAGATGG + Intronic
986994145 5:13586928-13586950 GTGGAGGGAGGGAGAGCATTAGG - Intergenic
987490549 5:18575510-18575532 TAGGAGGTGGGGAAAGCATTAGG + Intergenic
987769171 5:22277758-22277780 CGGGAGGTGGAGATTGCAGTGGG + Intronic
987831998 5:23105970-23105992 CTGGAAATGGGGAGGTCAGTTGG - Intergenic
988148102 5:27337183-27337205 CGGGAGGTGGGGAGACCATTAGG + Intergenic
988499427 5:31772018-31772040 GTGGGGGTGGGGAGAGGAGCAGG + Intronic
989737786 5:44729866-44729888 TTGGAGGATGGGAGAGCAGCAGG + Intergenic
991128575 5:63094970-63094992 CTGGGGGAGGGGATAGCATTAGG + Intergenic
991992093 5:72349920-72349942 CTGGAGGGAGGAAGAGAAGTTGG + Intronic
992738553 5:79748776-79748798 CTGGAGGTGGGCAGATCACTTGG - Intronic
993042216 5:82827089-82827111 CTGGAGGAGAGGAGAACAGGAGG + Intergenic
993476123 5:88366819-88366841 TTGGGGGTGGGGAGAGCATGGGG - Intergenic
994028917 5:95118029-95118051 GTGGAGGGAGGGAGAGCATTAGG + Intronic
994567222 5:101465605-101465627 GTGGAGGGAGGGGGAGCAGTGGG - Intergenic
995402126 5:111755432-111755454 ATGGAGGTGGTGACAGCAGTAGG - Intronic
995814911 5:116157349-116157371 CTGTAGGTGGGCAAGGCAGTTGG + Intronic
995853254 5:116569170-116569192 CAAGAGGTGGGGAGTGCTGTGGG + Intronic
996409019 5:123136824-123136846 TGGGAAGTGAGGAGAGCAGTGGG - Intronic
997517337 5:134499895-134499917 GTGGAGGGAGGGAGAGCATTAGG - Intergenic
997659144 5:135576741-135576763 CTGGGGGTGGGGGCAGGAGTAGG - Intronic
998151170 5:139758395-139758417 CTGGAGGTGGGGAGAAGGGCAGG + Intergenic
998550685 5:143075022-143075044 TGGGAGGTGGGAAGAGAAGTGGG + Intronic
998729923 5:145062923-145062945 CTGTGTGTGGGGAGGGCAGTGGG + Intergenic
998846850 5:146318698-146318720 CTGGAGGTGGGCAGATCACGAGG - Intronic
999257252 5:150216583-150216605 CTGGAGGTGGAGGGAGCTGGAGG - Intronic
999286788 5:150398950-150398972 CAGGAGGTGGGGGCAGCAGTGGG + Intronic
1000045277 5:157517175-157517197 CTGGTGGTGGGGAGAGCACTAGG - Intronic
1000120631 5:158194647-158194669 CTGGAGGGAGGGAGAGGAGGAGG - Intergenic
1001122402 5:168991537-168991559 CTGGGGGTGGTGGGGGCAGTGGG - Intronic
1001253353 5:170165378-170165400 CAGGAGGGAGGGAGAGCAGGAGG - Intergenic
1001464964 5:171955932-171955954 CTGGAGGTGGGGTGAGTGGGAGG - Intronic
1001515121 5:172350244-172350266 CTGGAGGATGGGGGAGCAGCTGG + Intronic
1001732162 5:173968579-173968601 CAGGAGGTGGGAAGAGGAGTTGG + Intergenic
1001907847 5:175487819-175487841 CTGGAGGTGGAGAGGGCCGAGGG - Intronic
1002052180 5:176577344-176577366 ATGCAGGTGGGCAGAGCAGGGGG + Intronic
1002772305 6:300458-300480 CTGGAGGTAGGGAGCTCACTAGG + Intronic
1002924297 6:1595851-1595873 GTGGAGGCGGGGAGAGAAGAGGG - Intergenic
1002972820 6:2041671-2041693 GTGGAGGTCAGGAGTGCAGTAGG + Intronic
1003737296 6:8890991-8891013 ATGAAGGTGGGGAGAGCATCAGG + Intergenic
1003884219 6:10506182-10506204 CTGGAGGTGGAGGTTGCAGTGGG + Intronic
1004227917 6:13804247-13804269 CGGGAGGTGGGGGTTGCAGTAGG + Intronic
1004348494 6:14869972-14869994 CTGGAGCTTGGGAGAGGAGAGGG - Intergenic
1004811222 6:19265862-19265884 GAGGAGGTGGGGGGGGCAGTGGG + Intergenic
1005021938 6:21426662-21426684 CTGGAGGTAGGTAGTCCAGTAGG - Intergenic
1005268821 6:24141358-24141380 TGGGAGGTGAGGAGAGCAGTTGG - Intronic
1005995222 6:30926726-30926748 CTAGAGGTGCTGAGAGAAGTAGG + Intergenic
1006075405 6:31529318-31529340 GGGGAGGTGGGGAGAGGAGTTGG - Intronic
1006164076 6:32054245-32054267 CTGGAGGCAGGGAGGCCAGTAGG - Intronic
1006391818 6:33763119-33763141 CTGGAGGAGAGGGGAGCAGTAGG - Intergenic
1006808729 6:36806205-36806227 CTGGAGCTGGGGCGGGCAGCAGG - Intronic
1006923890 6:37643748-37643770 CTGGAGGATGGGAGGGGAGTGGG - Intronic
1006990243 6:38209145-38209167 CTGGAGATGAGGAGAGCTTTTGG + Intronic
1007060928 6:38940360-38940382 CTGGTGGTTGGAAGAGGAGTTGG + Intronic
1007285545 6:40744822-40744844 CTGGGGGTGGGGAGAGAAAAAGG - Intergenic
1007391386 6:41551464-41551486 AGGGAGGTGGGCAGAGCAGCTGG - Intronic
1007396097 6:41578687-41578709 CTGGGGGAGGGGAGATCTGTGGG + Intronic
1007686097 6:43668176-43668198 CTGGAGGCGGTGACAGCAGCTGG + Intronic
1007765818 6:44159160-44159182 TTGGAGTTGGGGAGAGGAGAGGG + Intronic
1007901966 6:45421660-45421682 CTAGGGGTGGGGAGAGCAAGAGG + Intronic
1008448662 6:51623655-51623677 CAGGAGGTGGAGGGCGCAGTGGG - Intronic
1008449633 6:51635668-51635690 CTGGAGGTGTGGGGAGGATTGGG + Intronic
1009601237 6:65802964-65802986 CTGGAGGTGGAGAGAGCTATAGG - Intergenic
1009925791 6:70119172-70119194 GTAGAGGTTGGGAGAGCAGGTGG - Intronic
1011656363 6:89555538-89555560 CTGGAGGTTGGAAGAGTATTAGG + Intronic
1012066347 6:94556175-94556197 CTGGGGTTGGAGAGATCAGTTGG + Intergenic
1012084684 6:94809198-94809220 CTGGTGGTGGGAAGAGGATTAGG + Intergenic
1012403119 6:98861215-98861237 CTGGGGGTGGGGATAGGGGTAGG + Intergenic
1012454554 6:99390038-99390060 CGGGAGGTGGAGATTGCAGTGGG + Intronic
1012717969 6:102701263-102701285 CTGGATGAGGGGAATGCAGTGGG + Intergenic
1012980978 6:105830818-105830840 CTGGAGGAGGGAAGGGCAGCTGG + Intergenic
1013041208 6:106435673-106435695 CTGGAGGTGGAGGTTGCAGTGGG - Intergenic
1013366601 6:109442091-109442113 CTGGAGGTGGGGAAGGGAGGTGG - Intronic
1013804698 6:113984314-113984336 TTGGAGATGGGAGGAGCAGTGGG + Intronic
1014731656 6:125038969-125038991 GTGGAGGGAGGGAGAGCATTAGG - Intronic
1016286934 6:142484218-142484240 CTGGGAGTGGGGAGAGGAGAGGG - Intergenic
1017055812 6:150434721-150434743 ATGGAGGTGGGGAGGGAAGGGGG - Intergenic
1017162759 6:151381125-151381147 CTGGAGATGGAGAGATGAGTTGG - Intronic
1017475402 6:154786190-154786212 CGGGAAGTGGGGAGTGCTGTTGG + Intronic
1017510750 6:155112616-155112638 CTGGAGTTCAGGAGAGAAGTGGG - Intronic
1017548321 6:155475950-155475972 GGGGTGGTGGGGAGAGCATTCGG + Intergenic
1018251579 6:161877218-161877240 CTGGAGTGGGGGACACCAGTGGG - Intronic
1018372980 6:163185904-163185926 ATGGGGGTGGGGTCAGCAGTGGG - Intronic
1018635223 6:165854617-165854639 CTGGAGGTGAGGGGAGCGGGTGG + Intronic
1018786739 6:167114228-167114250 CAGGAGGTGGGGACAGCACAGGG - Intergenic
1018793189 6:167165623-167165645 CTGGAGGAGAGGTGAGCAGGGGG + Intronic
1019102291 6:169641225-169641247 CTGGAGCTCGGGAGAGGAGGGGG - Intronic
1019359294 7:596478-596500 CTGGGGGTGGGGTGAGCACTGGG - Intronic
1019431621 7:1002169-1002191 CTGCAGGTGGGGAGTCCTGTGGG + Intronic
1019503507 7:1377654-1377676 CTGGAGGTGGGGAGGGTCCTGGG - Intergenic
1019614835 7:1954497-1954519 CAGGAGGTGGGGACAGGGGTGGG + Intronic
1019641427 7:2105828-2105850 CTGGAGCTGGGGAGCGGGGTGGG - Intronic
1019701414 7:2476461-2476483 CTGGGGGTGGGGAGCGCCGGGGG + Intronic
1019881932 7:3869227-3869249 CGGGAGGTGGAGATTGCAGTGGG - Intronic
1020286143 7:6682660-6682682 CTGGGGTCGGGGAGAGCAGCTGG - Intergenic
1020378436 7:7514748-7514770 TTGGAGGTGGGAAGGGAAGTTGG - Intronic
1020410478 7:7886697-7886719 CTGGATGTAGGGAGATCAGTTGG - Intronic
1020529132 7:9307378-9307400 CCTGAGATGGGGAGAGTAGTGGG - Intergenic
1021656518 7:22879536-22879558 CTCCAGGTTGGGAGAACAGTGGG + Intergenic
1021820435 7:24492775-24492797 TTGGGGGTGGGGAGAGAGGTTGG - Intergenic
1021873734 7:25029272-25029294 CTGGCAGTGGTGAGACCAGTGGG + Intergenic
1021927010 7:25543555-25543577 CTGGAGTTGGGTTGGGCAGTGGG - Intergenic
1022620485 7:31978824-31978846 CTGGAGGTGGGGGGAGCCAATGG + Intronic
1022815855 7:33913515-33913537 CTGGAGTAGGGGTGGGCAGTAGG + Intronic
1022901267 7:34812662-34812684 CTGATTGTGGGCAGAGCAGTAGG - Intronic
1023558164 7:41444894-41444916 CTGGGGGTGGGGTGGGGAGTTGG + Intergenic
1023570375 7:41565578-41565600 CAGGAGCTGTGGAGAGCAGCAGG + Intergenic
1024055278 7:45656574-45656596 GTGGAGGTTGGGGAAGCAGTGGG + Intronic
1024526341 7:50353169-50353191 CAGGAGGCAGGGAGAGCAATGGG + Intronic
1026555893 7:71408359-71408381 CTGCTGGTGGGGAGAGGTGTTGG + Intronic
1026922891 7:74169574-74169596 CGGGAGGTGGGGGTTGCAGTGGG - Intergenic
1027264687 7:76487849-76487871 CAGGAGTTGGGGAGAGGAGGAGG + Intronic
1027316059 7:76985951-76985973 CAGGAGTTGGGGAGAGGAGGAGG + Intergenic
1027441593 7:78224975-78224997 TTGGAGGTGAGGTGAGCAGAGGG - Intronic
1027573381 7:79900891-79900913 GTGGAGGTGGGCAGATCATTAGG + Intergenic
1027890500 7:83967355-83967377 CTGGAGCTGGGGAGAGAAGGGGG - Intronic
1027969087 7:85054519-85054541 CTGGGGGTGAGGGGATCAGTGGG + Intronic
1028947951 7:96602000-96602022 AGGGAGATGGGGAGAGCTGTGGG + Intronic
1029175095 7:98658977-98658999 GTGGAGGTGGAGAGAGGAGGAGG - Intergenic
1029201660 7:98843331-98843353 CTGGAGGCTGGGAGAGCAGGTGG - Intergenic
1029334106 7:99885860-99885882 CTGGGGGTTGGGAGGGCAGGTGG + Intronic
1029337399 7:99914151-99914173 CTGTAAGTAGGGAGGGCAGTCGG - Intronic
1029429105 7:100518024-100518046 CTGGAGGTTGAGGCAGCAGTGGG - Intergenic
1029438550 7:100575305-100575327 CTGGGGGAGAGGAGAGCAGGTGG + Intronic
1029444377 7:100604383-100604405 CGGGAGGAGGGGAGAGAAGACGG - Intronic
1029451258 7:100642801-100642823 CAGGAGGTGGGTGGAGCAGGAGG - Intergenic
1030085325 7:105810875-105810897 GTGGAGGTGGGAGAAGCAGTTGG + Intronic
1030605330 7:111633560-111633582 CTGCTGCTGGGGAGAGCATTAGG + Intergenic
1030650941 7:112115429-112115451 ATGGAGGAGGTGAGAACAGTAGG - Intronic
1030820376 7:114085808-114085830 CAGGAGGTGGGGAGAAGGGTGGG + Intergenic
1030956592 7:115860590-115860612 CAGGAGCTGGGGAGTTCAGTAGG - Intergenic
1031362664 7:120865469-120865491 CTAGAGATGGGGAGAGAAGGAGG + Intergenic
1031539217 7:122972801-122972823 CAGGAGGTGGGGGGAGAACTTGG - Intergenic
1031975442 7:128090661-128090683 CTGGGAGAAGGGAGAGCAGTGGG - Intronic
1032000025 7:128259210-128259232 GAGGAGGTGGGGAGAGAAGAGGG + Intergenic
1032074143 7:128828452-128828474 CTGGAGGTGGGGGGAGCTGTGGG - Intergenic
1032151351 7:129432859-129432881 ATGTGGGTGGGGAGAGGAGTGGG + Intergenic
1032185852 7:129725399-129725421 CGGGAGGTGGAGATTGCAGTGGG - Intronic
1032983595 7:137313163-137313185 TTGGAGGTGGGGAAATCAGAAGG - Intronic
1033115056 7:138617840-138617862 GTGGAGGTGGGGAGGAAAGTAGG + Intronic
1033423349 7:141221736-141221758 CTGAAGATGGGGAGGGCAGCAGG + Intronic
1033601533 7:142892313-142892335 CTGCAGCTGGGCAGAGCAGGTGG - Intergenic
1034105636 7:148487170-148487192 CTGGGGGTGGGAAGAGGAGGCGG + Intergenic
1034198364 7:149265012-149265034 CTGGAAGTGGGGAAATCAGGTGG + Intronic
1034281029 7:149854571-149854593 CTGCAGGTGGGGAGTCCAGGTGG + Intronic
1035049844 7:155992376-155992398 CTGGAGCTGGGGAGAAGGGTGGG + Intergenic
1035542879 8:455474-455496 ATGGAGAAGGGCAGAGCAGTTGG + Intronic
1035822204 8:2605556-2605578 CTTGATGTGGGGTCAGCAGTGGG - Intergenic
1036212704 8:6855101-6855123 CTGGAGGTGGGGAGCCCATGTGG - Intergenic
1036562203 8:9906761-9906783 CGGGGGGTTGGGAGAGGAGTCGG + Intergenic
1037026271 8:14041734-14041756 CTGGCGGTGGGGTGAGGAGAGGG + Intergenic
1037435769 8:18861552-18861574 CTGGAGTTGGGGGAAGCAGCAGG - Intronic
1037699890 8:21264501-21264523 CTCTAGGTGGGGAGATCTGTGGG + Intergenic
1037766545 8:21775749-21775771 CAGGTGGTGGGGAGAACAGGAGG - Intronic
1038120055 8:24603068-24603090 TTGGAGGTGGGGGCTGCAGTAGG + Intergenic
1038142911 8:24865775-24865797 GAGGATGTGGGGAGGGCAGTTGG - Intergenic
1038227566 8:25670895-25670917 GTGGAGATGGGGAGATCAGGGGG - Intergenic
1038506322 8:28088169-28088191 GTGGAAGTGGGGAGATCAGGTGG - Intergenic
1039762911 8:40597344-40597366 GTGGAGGTGAGAAGAGCAGAAGG + Intronic
1039841797 8:41298906-41298928 CTGGAGGTGGGTAGAGAAAGAGG - Intronic
1040011299 8:42663289-42663311 CGGGAGGTGGAGACTGCAGTGGG - Intergenic
1041009625 8:53529269-53529291 CTGCAGGTGGGGAGGGGAGGAGG + Intergenic
1041142975 8:54842789-54842811 CTGGAGTTGGGGGCAGCAGGTGG - Intergenic
1042025559 8:64419705-64419727 CTCGAAGTGGGGTGACCAGTAGG + Intergenic
1042054487 8:64749487-64749509 CTGGACTGAGGGAGAGCAGTGGG + Intronic
1042696493 8:71558709-71558731 CTGGAGGTGGAGAAAGAAGTGGG + Intronic
1043148489 8:76683306-76683328 CCGGAGGTGGGGGGAAGAGTAGG - Intronic
1044931863 8:97259301-97259323 CTGTAGGTGGGGAGGGCAAGGGG - Intergenic
1044946404 8:97393842-97393864 CTGGAGTAGGCGAGAGCAGAAGG + Intergenic
1045345676 8:101291438-101291460 CTGGGGATGGGGAGAGGGGTAGG + Intergenic
1045570126 8:103360216-103360238 CTGGAAGTGGTGAGAGAAGCTGG - Intergenic
1045703875 8:104897669-104897691 GTGGAGGGAGGGAGAGCATTAGG + Intronic
1046116109 8:109785568-109785590 GCGGTGGTGGGGAGAGCATTAGG + Intergenic
1046892632 8:119439586-119439608 GTGGAGGTGGTGAGAGGTGTAGG + Intergenic
1047204046 8:122789240-122789262 CTGCAGCTGGGGAGAGCCATAGG - Intronic
1047238022 8:123059734-123059756 CTGGAGGTGGAGGTTGCAGTGGG - Intronic
1047303198 8:123632689-123632711 ATGGAGGTCAGGAGACCAGTTGG - Intergenic
1047665731 8:127089005-127089027 CTAGAGGTGGGGAGAGAGGTTGG + Intergenic
1047801625 8:128316078-128316100 CTGGAGGTAAGGAGAGCAGGAGG + Intergenic
1047906674 8:129480084-129480106 CTAGAGGTAGTCAGAGCAGTTGG - Intergenic
1047948536 8:129907454-129907476 GGGGAGGTGGGGATAGCATTAGG + Intronic
1048148372 8:131867974-131867996 CTGGAGAAGGGGTGAGCTGTAGG - Intergenic
1048317912 8:133375552-133375574 CTGGAGAAGGGGAGGGCAGTGGG + Intergenic
1048490281 8:134885601-134885623 ATGGGGATGGGGAGGGCAGTAGG + Intergenic
1048937243 8:139367439-139367461 GTGGTGGTGGGGAGGGCGGTTGG - Intergenic
1048990510 8:139757595-139757617 CTGGAAGTGGGCTGTGCAGTGGG + Intronic
1049009417 8:139877400-139877422 CTCCAGGTGGGAAGAGCAGGAGG - Intronic
1049025296 8:139984350-139984372 CTGGAGGTGTGGGCAGTAGTGGG - Intronic
1049159373 8:141087506-141087528 GTGAATGTGGGGAGAGCAGTCGG + Intergenic
1049163497 8:141112331-141112353 CTGGAGGAGGAGAGATCAGTAGG + Intergenic
1049180391 8:141219150-141219172 CTGGAGAAGGAGAAAGCAGTAGG + Intronic
1049317423 8:141976787-141976809 CTGGAGCTGGGGAGAGGACCAGG + Intergenic
1049378324 8:142300015-142300037 CAGGTGGTGGGGTGAGCTGTCGG - Intronic
1049673694 8:143880497-143880519 GAGGAGGTGGGTAGAGCCGTGGG - Intergenic
1049675309 8:143886502-143886524 CTGGAGGTGGGGGTACGAGTGGG - Intergenic
1049817935 8:144616635-144616657 CAGGAGGTGGGGAGGGCAGGGGG + Intergenic
1049863707 8:144919441-144919463 CAGGAGGTGGAGGGTGCAGTGGG - Intergenic
1049887017 9:34533-34555 TTGGAGGTGGGAAGAGCAGGCGG + Intergenic
1050041170 9:1495489-1495511 CTGGTGGTGAGGAGAACAGTGGG + Intergenic
1050062080 9:1719854-1719876 CTGGAGGTGGGGAGTGAAGGAGG + Intergenic
1050368982 9:4901679-4901701 CTGGGGGAAGGGGGAGCAGTGGG - Intergenic
1050483153 9:6106850-6106872 CTGGGGCTGGGGATAGCAGAGGG + Intergenic
1050925858 9:11261872-11261894 GTGGGGGTGGGGAGAGCACTAGG + Intergenic
1051561107 9:18441160-18441182 CTGGGAGTGGGGAGAGGAATGGG + Intergenic
1051666044 9:19467708-19467730 CTGGATGTGGGGAGAGTAAAGGG + Intergenic
1052313279 9:27091515-27091537 CTGGAGGTGGAGGTTGCAGTGGG - Intergenic
1052602474 9:30652993-30653015 TTGGGGGAGGGGAGAGCAGGAGG - Intergenic
1052861192 9:33438958-33438980 CTGGAGGTGGGGTGAGGAGGTGG + Intergenic
1052996310 9:34553213-34553235 CTGGAGGTGGCAAGGGCAGGGGG + Intronic
1053052684 9:34975028-34975050 CTGGAGGTGTGGAGAGCAGTTGG - Intronic
1053134808 9:35643909-35643931 CTGGAGGTGGAGGTTGCAGTGGG + Intronic
1053178709 9:35949165-35949187 GTGGAGGAGGGGAGAGAAGGTGG + Intergenic
1053200245 9:36147320-36147342 CTGGACCTAGGGAGAGCAGAGGG - Intronic
1053425647 9:38008306-38008328 CTGTGGGCGGGGAGAGAAGTGGG - Intronic
1053632415 9:39957950-39957972 CTTGAGGAGTTGAGAGCAGTGGG - Intergenic
1053738825 9:41119177-41119199 CTGGAGGTGGGGGGAGAACAGGG - Intergenic
1053773345 9:41505581-41505603 CTTGAGGAGTTGAGAGCAGTGGG + Intergenic
1053839986 9:42182854-42182876 CTGGTGGTAGGGAGAGCATCAGG + Intergenic
1053913569 9:42928560-42928582 GTGGAGGTGGGGAGAGTTGGGGG + Intergenic
1054211473 9:62292747-62292769 CTTGAGGAGTTGAGAGCAGTGGG + Intergenic
1054313510 9:63556106-63556128 CTTGAGGAGTTGAGAGCAGTGGG - Intergenic
1054689519 9:68312138-68312160 CTGGAGGTGGGGGGAGAACAGGG + Intergenic
1054758363 9:68981476-68981498 GTGGGGGTGGGGAGGGCAGGAGG + Intronic
1054807949 9:69411394-69411416 CAGGAAGTGAGGAGAGCAGAGGG - Intergenic
1055662429 9:78518508-78518530 CCTGAGGTGGAGATAGCAGTTGG + Intergenic
1055999067 9:82194691-82194713 CTGGAGGTGGGGGATGGAGTGGG - Intergenic
1056501823 9:87217124-87217146 ATGGAGGTTGGGAGAGGAGAGGG + Intergenic
1056502785 9:87226244-87226266 CTGGAGGTGGGCCTAGCAGGAGG - Intergenic
1056944561 9:90983508-90983530 CAGGGGGTGGAGAGAGAAGTAGG - Intergenic
1056981999 9:91322426-91322448 CTGAAGCTGGGGAGAGAAGCAGG + Intronic
1057142839 9:92738028-92738050 CGGGAAGTGGGCAGGGCAGTGGG - Intronic
1057269440 9:93641188-93641210 CTGGACATGGGGAAAGCATTTGG - Intronic
1057347187 9:94260768-94260790 CTGGAGGTGGGGGAAGAAGTTGG + Intronic
1057443159 9:95096437-95096459 CGGGAGGTGGGTGGAGCAGGTGG + Intergenic
1057577539 9:96255461-96255483 CTGGAGGTGGAGGTTGCAGTGGG - Intronic
1057797678 9:98170256-98170278 CTGTAGGTGGGCACAGCAGAAGG - Intronic
1058432256 9:104929485-104929507 CTGGAGGTGGGAAGAGAAGTAGG - Intergenic
1058929814 9:109708050-109708072 GTGGAGGGAGGGAGAGGAGTGGG - Intronic
1058935630 9:109767240-109767262 CTGGGGTTGGAGGGAGCAGTAGG - Intronic
1059064841 9:111072420-111072442 GTGGAGGTAGGGAGAGCATCAGG - Intergenic
1059264003 9:113008940-113008962 GTGGAGATGGGGAGAGGAATTGG + Intergenic
1059305046 9:113347430-113347452 CTGGGGGTGGGGAGGGAAATAGG - Intergenic
1059758465 9:117316343-117316365 TTGGAGGTGGGGTGAGCGGTGGG + Intronic
1060013360 9:120064407-120064429 CTTGAGGTGGTGAGAGGAATTGG - Intergenic
1060034012 9:120239686-120239708 GTGGAGGTGGTTAGGGCAGTGGG - Intergenic
1061084312 9:128390320-128390342 CTAGGGGTGGGGGGAGCAGGAGG - Exonic
1061266483 9:129508323-129508345 CAGGAGGTGGAGCGTGCAGTGGG + Intergenic
1061319393 9:129818583-129818605 CTGGAGGAGTGGAAAGCAGAGGG - Exonic
1061619192 9:131800132-131800154 CTGGAGCTGGAAGGAGCAGTGGG - Intergenic
1061790516 9:133056743-133056765 CTGGGGGTGGGGAGAGGGTTGGG - Intronic
1061836881 9:133335475-133335497 CAGGAGGAGAGGAGAGCAGCAGG - Intronic
1061921954 9:133787388-133787410 CTGGGGGTGGGGTGATCAGTGGG + Intronic
1061957162 9:133969766-133969788 TGGGGGGTGGGGAGAGAAGTGGG - Intronic
1062270843 9:135707642-135707664 CAGGGGGTGGGGACAGCAGAAGG + Intronic
1062383107 9:136297155-136297177 CTGCAGGTGGCGTGAGCTGTGGG + Intronic
1062489112 9:136795939-136795961 CTGGGGGTGGGGGGTGCAGAGGG + Intronic
1186673152 X:11787800-11787822 CTGGAAGTGCGGAAAGAAGTTGG - Intergenic
1186705798 X:12138420-12138442 GTGGGGGTGGGGAGAGGAGCAGG + Intergenic
1186771412 X:12821444-12821466 CTGGGGGTGGGGGGGGCAGTGGG + Intronic
1187346907 X:18473841-18473863 CTGGGGGTGGGGAGAGGGGATGG + Intronic
1187526231 X:20057637-20057659 GTGGAGATAGGGAGAGGAGTTGG - Intronic
1187842648 X:23504928-23504950 CTGGAGGTGGGGAGTCCTGGGGG + Intergenic
1188003077 X:25000358-25000380 CTGACGGTGGGGAGAGCGGGCGG - Intergenic
1188436194 X:30161309-30161331 TTGGAGGTGGGCAGAACTGTAGG + Intergenic
1188470377 X:30531071-30531093 CTGGAGTTTGGGAGTGCAATGGG + Intergenic
1189052526 X:37661527-37661549 CTTGAGGTGGGGATAGGGGTTGG - Intronic
1189056516 X:37704759-37704781 CTGGAGGTGGAGGTGGCAGTGGG + Intronic
1189068511 X:37837611-37837633 CTGGAGGTGGAGGTTGCAGTGGG - Intronic
1189327139 X:40119676-40119698 TTGGAGATGGGGAGCACAGTGGG + Intronic
1189381027 X:40502182-40502204 TTGGAGTTGGGGACAGTAGTGGG + Intergenic
1189811421 X:44784204-44784226 CGGGAGGTGGAGATTGCAGTGGG + Intergenic
1189832695 X:44990474-44990496 CTGGAGGTGGAGGATGCAGTGGG + Intronic
1189885398 X:45539139-45539161 CTAGAGGTGGGGAAGGTAGTTGG + Intergenic
1190545943 X:51527266-51527288 CTGGGGGTAGGGAGAGCTATAGG + Intergenic
1190730831 X:53224632-53224654 CTCGAGGTGGGGAGAGGGGGTGG - Intronic
1190789559 X:53686369-53686391 CTGGGGGAGGGGAGAGGAGGCGG + Intronic
1190891979 X:54577568-54577590 CTGGAGGTGGTGAGGGAAATGGG - Intergenic
1190916698 X:54816542-54816564 CTGGAGGAGGTGAGAGGAGTTGG + Intergenic
1191842816 X:65525103-65525125 TTGGAGGTGGGTGGAGGAGTAGG - Intronic
1191943004 X:66499971-66499993 CTGGAGGTGGCTGCAGCAGTGGG - Intergenic
1192179569 X:68908061-68908083 CAGGGGGTGGGGAGACCACTGGG - Intergenic
1192227997 X:69242592-69242614 CTGGGGGTAGGGGGAGCTGTAGG - Intergenic
1192234961 X:69289817-69289839 GTGGAGGTGGGGGCAGCTGTGGG + Intergenic
1192369239 X:70499692-70499714 CTGGAGATTGGAAGAGAAGTAGG + Intronic
1192495951 X:71616755-71616777 CAGGATGTGGGCATAGCAGTAGG + Exonic
1193092512 X:77510035-77510057 CTTGAGGTGAGGAGAGGAGAGGG + Intronic
1193487371 X:82103130-82103152 CTTGAGGAGAGGAGAGAAGTCGG - Intergenic
1193487659 X:82107094-82107116 CTTGAGGAGAGGAGAGAAGTAGG - Intergenic
1195799665 X:108693613-108693635 CTCGAGGTAGAGAGACCAGTTGG + Intronic
1195810090 X:108819365-108819387 CTAGAGGAGGGGATAGCATTAGG - Intergenic
1195936968 X:110134698-110134720 CTGGAGGTGAGGTGAGGAGTGGG + Intronic
1196823331 X:119721248-119721270 CTGGAGGTGGAGGTTGCAGTGGG + Intergenic
1197756854 X:130001701-130001723 CTGGGGGTGGTGAGAGTGGTGGG + Intronic
1197798882 X:130328558-130328580 CCGGGGGTGGGGAGATCAGGTGG - Intergenic
1197825808 X:130589137-130589159 GTGGGGGTGGGGAGAGCAGAAGG - Intergenic
1198000800 X:132433731-132433753 CCGGGGGTGGGGAGATCAGGTGG - Intronic
1198174893 X:134145520-134145542 GTGGAGGCAGGGAGAGCATTAGG - Intergenic
1198187408 X:134266951-134266973 CAGGAGAAGGGGAGAGAAGTGGG + Intergenic
1198533146 X:137564353-137564375 CTGGATGTGGAGAGAGAATTGGG + Intergenic
1199141097 X:144313407-144313429 CTGGAGCTGGGAAGAGTGGTAGG + Intergenic
1199655933 X:149995516-149995538 GTGGAGGGAGGGAGAGCATTAGG + Intergenic
1199806524 X:151305798-151305820 CTGGAGGCTGCCAGAGCAGTGGG + Intergenic
1199925751 X:152461839-152461861 GTGGGGGTGGGGAGAGCATTAGG + Intergenic
1200065748 X:153503405-153503427 CTGGAGATGGGGAGCCCAGCTGG - Intronic
1200071469 X:153531397-153531419 CTGGAGGTGGAGAGAGATGGGGG + Intronic
1201226986 Y:11827811-11827833 CAGGAGGTGGGGGTTGCAGTGGG + Intergenic
1201489173 Y:14523537-14523559 CTGGAGATGGCGAAAGCAGGAGG + Intronic
1202596467 Y:26545671-26545693 CTGGAGGTGGAGTTTGCAGTGGG + Intergenic