ID: 928200934

View in Genome Browser
Species Human (GRCh38)
Location 2:29247154-29247176
Sequence CCGCGGCAGCGCCTTTCCCC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 206
Summary {0: 1, 1: 1, 2: 1, 3: 12, 4: 191}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
928200922_928200934 12 Left 928200922 2:29247119-29247141 CCCGGCCTCCGCGGCAGCGCCTT 0: 3
1: 0
2: 0
3: 20
4: 142
Right 928200934 2:29247154-29247176 CCGCGGCAGCGCCTTTCCCCCGG 0: 1
1: 1
2: 1
3: 12
4: 191
928200923_928200934 11 Left 928200923 2:29247120-29247142 CCGGCCTCCGCGGCAGCGCCTTT 0: 2
1: 1
2: 0
3: 10
4: 131
Right 928200934 2:29247154-29247176 CCGCGGCAGCGCCTTTCCCCCGG 0: 1
1: 1
2: 1
3: 12
4: 191
928200920_928200934 14 Left 928200920 2:29247117-29247139 CCCCCGGCCTCCGCGGCAGCGCC 0: 2
1: 0
2: 1
3: 37
4: 363
Right 928200934 2:29247154-29247176 CCGCGGCAGCGCCTTTCCCCCGG 0: 1
1: 1
2: 1
3: 12
4: 191
928200924_928200934 7 Left 928200924 2:29247124-29247146 CCTCCGCGGCAGCGCCTTTTACC 0: 1
1: 0
2: 1
3: 6
4: 115
Right 928200934 2:29247154-29247176 CCGCGGCAGCGCCTTTCCCCCGG 0: 1
1: 1
2: 1
3: 12
4: 191
928200919_928200934 19 Left 928200919 2:29247112-29247134 CCTTTCCCCCGGCCTCCGCGGCA 0: 2
1: 0
2: 1
3: 17
4: 249
Right 928200934 2:29247154-29247176 CCGCGGCAGCGCCTTTCCCCCGG 0: 1
1: 1
2: 1
3: 12
4: 191
928200925_928200934 4 Left 928200925 2:29247127-29247149 CCGCGGCAGCGCCTTTTACCCCG 0: 1
1: 0
2: 0
3: 3
4: 56
Right 928200934 2:29247154-29247176 CCGCGGCAGCGCCTTTCCCCCGG 0: 1
1: 1
2: 1
3: 12
4: 191
928200921_928200934 13 Left 928200921 2:29247118-29247140 CCCCGGCCTCCGCGGCAGCGCCT 0: 3
1: 0
2: 2
3: 33
4: 285
Right 928200934 2:29247154-29247176 CCGCGGCAGCGCCTTTCCCCCGG 0: 1
1: 1
2: 1
3: 12
4: 191
928200928_928200934 -7 Left 928200928 2:29247138-29247160 CCTTTTACCCCGGCCTCCGCGGC 0: 1
1: 0
2: 0
3: 6
4: 98
Right 928200934 2:29247154-29247176 CCGCGGCAGCGCCTTTCCCCCGG 0: 1
1: 1
2: 1
3: 12
4: 191

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
928200934 Original CRISPR CCGCGGCAGCGCCTTTCCCC CGG Intronic