ID: 928208543

View in Genome Browser
Species Human (GRCh38)
Location 2:29305602-29305624
Sequence AAGCTGGGTATACTTGGCAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 88
Summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 80}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
928208543_928208550 0 Left 928208543 2:29305602-29305624 CCCATGCCAAGTATACCCAGCTT 0: 1
1: 0
2: 1
3: 6
4: 80
Right 928208550 2:29305625-29305647 GATCTTGGCAGTCAAGGTTCTGG 0: 1
1: 0
2: 0
3: 8
4: 103
928208543_928208549 -6 Left 928208543 2:29305602-29305624 CCCATGCCAAGTATACCCAGCTT 0: 1
1: 0
2: 1
3: 6
4: 80
Right 928208549 2:29305619-29305641 CAGCTTGATCTTGGCAGTCAAGG 0: 1
1: 0
2: 2
3: 14
4: 180

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
928208543 Original CRISPR AAGCTGGGTATACTTGGCAT GGG (reversed) Intronic
901635228 1:10667411-10667433 AACCTGGGTAGAGTGGGCATCGG - Intronic
901728527 1:11261558-11261580 AAGCTGAACATACTTGGGATAGG - Intronic
902256768 1:15194382-15194404 AAGCTGGGTGTGATTGTCATTGG + Intronic
903865554 1:26395048-26395070 AAGCTGGGTAAATCTGGCTTTGG + Intergenic
909932985 1:81519532-81519554 AATCTAAATATACTTGGCATAGG + Intronic
910921701 1:92355455-92355477 AAGATGAGTATATTTAGCATAGG + Intronic
912664413 1:111566339-111566361 AAGTTGGCTAGACTTGTCATTGG + Intronic
914411897 1:147437330-147437352 AAGCTGGGTGAAATTGGCTTTGG + Intergenic
916154582 1:161832275-161832297 AAAATAGGTATACTTGGAATAGG + Intronic
1063726042 10:8638543-8638565 AAGCTGTGTAAACTTGGCCTTGG - Intergenic
1063768458 10:9169728-9169750 AAGTTGAGAATAGTTGGCATAGG - Intergenic
1064026539 10:11853188-11853210 AAGCTAGATATACTTGGTATGGG + Intronic
1069089133 10:64178023-64178045 AAGGAGGGTATAGTGGGCATAGG - Intergenic
1069701412 10:70429331-70429353 GAGCTGAGTATACTAGGCACTGG - Intergenic
1089592466 11:119552625-119552647 AAGCAGTGTGTAATTGGCATAGG + Intergenic
1091417804 12:304925-304947 AAGCTAATTATACTTGGCATGGG + Intronic
1096849798 12:54428301-54428323 AAGCCGGGTCTTCTGGGCATAGG + Intergenic
1098771229 12:74556021-74556043 AATCTAGGTATGGTTGGCATAGG - Intergenic
1101746418 12:107544866-107544888 AAGCTGGGGATCCTTGGGAAAGG + Intronic
1114475070 14:22988428-22988450 ATGCTGGGCTTTCTTGGCATAGG + Intronic
1114950378 14:27743291-27743313 AAGCAGGTTATACCTGGAATCGG + Intergenic
1115344594 14:32328692-32328714 AAGCTGGGTTTATTCTGCATGGG + Intergenic
1125433783 15:39625093-39625115 AAGATGGGTAGCCTAGGCATGGG - Intronic
1128392414 15:67191082-67191104 GAGCTGGATAGACTTGGGATGGG + Exonic
1131281690 15:91026416-91026438 GTGCTGGGCACACTTGGCATGGG - Intergenic
1136127071 16:28191742-28191764 GAGCTGGCTTTACCTGGCATTGG + Intronic
1140425312 16:74856284-74856306 AAACAGGGTAAACTGGGCATGGG - Intergenic
1141215435 16:82019354-82019376 TATCTGGGAATACTTGGCACTGG + Intergenic
1147136491 17:38436897-38436919 AAGCTGGGTAGAATTGCCACAGG + Intronic
1148632421 17:49121561-49121583 GAGGTGGGTATACTGGGCACTGG + Intergenic
1151569160 17:74917501-74917523 GAGCTGGCTATGCTTGGGATGGG + Exonic
1151880001 17:76889125-76889147 CAGCTCGGTGTACCTGGCATGGG - Intronic
1153676281 18:7458557-7458579 AAGCTGAGTAGACTTAGTATTGG + Intergenic
1156974329 18:43198806-43198828 AAGCTGGGTATATTTGTATTGGG + Intergenic
1157567316 18:48688338-48688360 AAGCTGGGTATACTTGCGATGGG + Intronic
1162447534 19:10732647-10732669 AGGCTGGGTGTCCTTTGCATGGG + Intronic
1166251342 19:41573020-41573042 AAGCTTGGTCTACCTGGCACAGG - Intronic
1167982300 19:53284952-53284974 AAGCTGGGTCTTCTTGCCTTGGG - Intergenic
1167983845 19:53299021-53299043 AAGCTGGGTCTTCTTGCCTTGGG + Intergenic
925238834 2:2303793-2303815 AAGGTGGCTATCCTTGGCAATGG - Intronic
928208543 2:29305602-29305624 AAGCTGGGTATACTTGGCATGGG - Intronic
929618031 2:43327620-43327642 AAGCTGGGTTTAGGTGGCACAGG + Intronic
931134828 2:59386563-59386585 AAGCTGGTTTTTCTTGACATGGG - Intergenic
937353796 2:121185586-121185608 AAGCTGGGTGACCTTGGCCTTGG - Intergenic
939708795 2:145488971-145488993 AAGCTGGAAATCCTTGGAATGGG + Intergenic
945385954 2:209201231-209201253 AAGGTTGTTATACTAGGCATTGG + Intergenic
1171225927 20:23442179-23442201 TAGCTGGGTGATCTTGGCATGGG + Intronic
1172707991 20:36896951-36896973 ATGCAGGGTATATTTGGCAGTGG - Intronic
1173859173 20:46270825-46270847 GAGCTGGGTTGACTTGGCAGTGG + Intronic
1179622611 21:42627177-42627199 AAGTTGTGTATACGTGCCATAGG + Intergenic
1184327775 22:43803519-43803541 AAGCTGGGTATAGTTTGGCTTGG + Intronic
949813498 3:8033500-8033522 AAGGTGGCTATACTTGACAATGG - Intergenic
952998116 3:38904935-38904957 AAGCTGGCTAGACTTGGGATGGG - Intronic
955150166 3:56359298-56359320 AAGCTGTATATTCTTGGCATGGG - Intronic
963440097 3:145329767-145329789 AAGCTGGCTATAATGGTCATAGG + Intergenic
964661073 3:159121074-159121096 AGGCTGGGTATATTTGTCTTGGG - Intronic
967420740 3:189269558-189269580 GTGCTGGGGATACTTGGCAGAGG + Intronic
971033742 4:22669798-22669820 AATATGGGTATGCTTGGCCTTGG + Intergenic
973267316 4:48223845-48223867 AACCTTGGTACACTAGGCATAGG + Intronic
978017637 4:103766425-103766447 AAGCTTGGTTTATTTGACATTGG - Intergenic
980762472 4:137253795-137253817 AAGATGGGAATACTAGGCACTGG - Intergenic
982605964 4:157516215-157516237 AAGTTGGGTCTATTTGGGATTGG - Intergenic
985385394 4:189441108-189441130 AAGCTGGGTCTATTTGACCTTGG + Intergenic
987435947 5:17894320-17894342 TAGCTGGGTAGTCCTGGCATGGG - Intergenic
991900210 5:71453160-71453182 AAGCTGTGTAGACCTGGCAGTGG + Intergenic
995231312 5:109767380-109767402 TTGCTGGGAATACTTGGCAGAGG + Intronic
1000760914 5:165223367-165223389 ATGTTGGATATATTTGGCATAGG + Intergenic
1009607599 6:65894550-65894572 TAGCTGGGTATATTTGGCTCAGG - Intergenic
1010608531 6:77922800-77922822 AATCTGAGAATACTTGGCAAGGG - Intronic
1012556789 6:100522939-100522961 AAGGTGTGTAGACTTTGCATGGG + Intronic
1023494234 7:40777647-40777669 AAGCTGGGTCTGCTTGGGACTGG + Intronic
1023990357 7:45124920-45124942 AAAATGGGTATTTTTGGCATGGG - Intergenic
1027481336 7:78701310-78701332 ACACTGGGTACATTTGGCATGGG + Intronic
1028292534 7:89083999-89084021 AAGCTGGGGATAGATGGAATAGG + Intronic
1028649427 7:93134761-93134783 AAGCTGGTTAAACTTCTCATAGG - Exonic
1032949543 7:136891792-136891814 ATGCTGGCTATGCTTAGCATGGG - Intronic
1033042823 7:137933796-137933818 CAGCTGGGTGTCCTTGGCAGTGG + Intronic
1037086591 8:14858499-14858521 AAGTTGGATATAGTTGGCAAAGG + Intronic
1042999076 8:74735077-74735099 AAGTTGGGTAAACTGGGCAGAGG - Intronic
1048124561 8:131619035-131619057 AATCTAGGTATTCTTGGCTTTGG - Intergenic
1057038517 9:91830613-91830635 AAACTGGGTATAGTGGGCAATGG + Intronic
1058387191 9:104451323-104451345 AAGATGGTTATACTTAACATAGG - Intergenic
1061586302 9:131571221-131571243 AGGGTTGGTATACTTGTCATGGG + Intergenic
1187954606 X:24504875-24504897 AAGGTGGGTATACTTGACTAAGG + Intronic
1188680290 X:32995503-32995525 AAGATGAGTGTTCTTGGCATTGG + Intronic
1191220765 X:57985727-57985749 CAGCTGGGAAAGCTTGGCATTGG - Intergenic
1193252586 X:79309399-79309421 AAGCTGGCCATACTTGCCATTGG + Intergenic
1195260078 X:103123179-103123201 AAGCTGGTCATACCTGGCACTGG + Intergenic