ID: 928211673

View in Genome Browser
Species Human (GRCh38)
Location 2:29328371-29328393
Sequence CTCCCTGGGCACAGTCCTGG TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 496
Summary {0: 1, 1: 1, 2: 9, 3: 63, 4: 422}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
928211668_928211673 10 Left 928211668 2:29328338-29328360 CCATCTACTCACGGCACATCTGG 0: 1
1: 0
2: 0
3: 5
4: 75
Right 928211673 2:29328371-29328393 CTCCCTGGGCACAGTCCTGGTGG 0: 1
1: 1
2: 9
3: 63
4: 422
928211667_928211673 11 Left 928211667 2:29328337-29328359 CCCATCTACTCACGGCACATCTG 0: 1
1: 0
2: 1
3: 11
4: 64
Right 928211673 2:29328371-29328393 CTCCCTGGGCACAGTCCTGGTGG 0: 1
1: 1
2: 9
3: 63
4: 422
928211666_928211673 12 Left 928211666 2:29328336-29328358 CCCCATCTACTCACGGCACATCT 0: 1
1: 0
2: 0
3: 7
4: 68
Right 928211673 2:29328371-29328393 CTCCCTGGGCACAGTCCTGGTGG 0: 1
1: 1
2: 9
3: 63
4: 422

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
928211673 Original CRISPR CTCCCTGGGCACAGTCCTGG TGG Exonic
900094960 1:936509-936531 CTGCCTGGTCACAGTTGTGGGGG + Intronic
900325720 1:2107843-2107865 CTCCCTCGACACTGCCCTGGGGG - Intronic
900376989 1:2359380-2359402 CTCCTTGGGCACAGTCCTCTGGG - Intronic
900414822 1:2530138-2530160 CTCCACGGCCACAGTGCTGGGGG + Exonic
900422194 1:2560465-2560487 CTCCCTGTCCAGAGTCTTGGAGG - Intronic
901461540 1:9394841-9394863 CTCCCTGGTCACAGTGCAGGTGG - Intergenic
901800728 1:11706547-11706569 CTGCCTGAGCAGAGTCCTGCAGG + Exonic
902150382 1:14438179-14438201 GTCTCTGAGCACAGTCCTGTGGG + Intergenic
902336704 1:15758546-15758568 CCCCCTTGGCACAGGCCAGGGGG - Intronic
902374988 1:16026415-16026437 CTACCTGAGGACAGCCCTGGGGG + Intronic
902725821 1:18335256-18335278 CTCCCTGGGGAGGGTCCTGTTGG - Intronic
903384803 1:22919308-22919330 CTGTCTGGGCACATTCCTGAGGG - Intergenic
903540393 1:24093255-24093277 CTGCCTTGGCAAAGCCCTGGAGG - Intronic
903540535 1:24093834-24093856 CTCCCTGGGCTCAGAGCTGGGGG + Intronic
903861529 1:26367620-26367642 ACCCCTGGGCACAGACCTGCAGG - Exonic
904215414 1:28914824-28914846 CCCCGTGGGGACGGTCCTGGCGG + Intronic
904410785 1:30323616-30323638 CTTCCTGGTCACAGTGCTGGTGG - Intergenic
904674871 1:32192771-32192793 CTCACTGGGCCCCATCCTGGGGG + Intronic
905558766 1:38909247-38909269 TTCCGTGGGCACAGGCCTGGGGG + Intronic
905868961 1:41392022-41392044 CTCCCTCAGCACAGCCCTGGTGG + Intergenic
905919185 1:41708073-41708095 CTCCCTGTGCACTCACCTGGGGG - Intronic
906248320 1:44292677-44292699 CTGCCTGCCCACAGCCCTGGGGG + Intronic
907883276 1:58571058-58571080 CTGCCTGGGCAGAGACCTAGAGG - Intergenic
907944304 1:59119968-59119990 CTCCCTGGTCACTGTCTTAGTGG + Intergenic
908398977 1:63752471-63752493 CTCCCTGGGCTCTGTGCTGGTGG + Intergenic
908552901 1:65227606-65227628 CTCACTGGGGACAGTCATGATGG - Exonic
909565660 1:77050906-77050928 CTGCCTGGGCACATGCCAGGAGG - Intronic
909685755 1:78346587-78346609 CTTCCTTGGCTCAGTGCTGGTGG - Intronic
911664805 1:100540001-100540023 CTCCGTGCGCTCAGTCCTGCCGG + Exonic
912802619 1:112729999-112730021 CTTCCTGGACACAGTCTTGAGGG - Intergenic
915268383 1:154734527-154734549 CTCGCTGGGCACAGACCCTGTGG - Intronic
918092050 1:181305532-181305554 CTTGCTGAGCACAGTCCTGTGGG - Intergenic
918316622 1:183328053-183328075 CTCTCTGGCCCAAGTCCTGGAGG - Intronic
919539177 1:198827814-198827836 GTCCCTGGGCACAGGACTAGGGG + Intergenic
920682657 1:208084565-208084587 CCAGCTGGGGACAGTCCTGGGGG + Exonic
921064019 1:211609994-211610016 CTTCCTGGACACAGTCCAGTGGG + Intergenic
921163462 1:212489104-212489126 CTCCCTGGGGGCAGACGTGGAGG - Intergenic
922210501 1:223482950-223482972 CTGCCTGGGCTGAGTCCTGAGGG + Intergenic
922473601 1:225891025-225891047 CTCCCTGACCCCAGGCCTGGGGG + Intronic
924501437 1:244642488-244642510 GTCCGTGGGCACAGGCCTGAGGG - Intergenic
924511473 1:244731829-244731851 TACTCTGGGCACAGCCCTGGAGG + Intergenic
924918313 1:248597789-248597811 CTCCATGGGAGCAGTCCTGGGGG + Intergenic
1062819757 10:525891-525913 ATTCCTGGGCACAGACCTGCTGG - Intronic
1062836899 10:641521-641543 CTCCCTGGGTACTGACCAGGTGG - Intronic
1063049339 10:2429817-2429839 TTCCCTGGGCCCTGTGCTGGTGG + Intergenic
1064851593 10:19714574-19714596 GTCCGTGGGCACAGTCCTGGGGG + Intronic
1066067253 10:31771471-31771493 CTCCCTGAGAGCAGTCCAGGTGG + Intergenic
1068196780 10:53727258-53727280 GTCCGTGGGCACAGGCCTGAGGG + Intergenic
1068407122 10:56604627-56604649 GTCCGTGGGCACAGGCCTGAGGG - Intergenic
1069352866 10:67551016-67551038 GTCTGTGGGCACAGGCCTGGAGG - Intronic
1070163637 10:73881491-73881513 CTGCTTGGGCAGAGACCTGGAGG - Intergenic
1070784625 10:79155822-79155844 CTCCCTGGGCAAAGGCCCAGAGG - Intronic
1072617989 10:97062562-97062584 CTCCCTGGGCCCTGCCCTGCAGG + Intronic
1072695791 10:97601876-97601898 CGCCCTGGCCAATGTCCTGGGGG + Exonic
1073127158 10:101158462-101158484 TTGCCTGGGCAGAGTCCTAGGGG - Intergenic
1073217006 10:101842020-101842042 CTCCCTAGGGACAGTGATGGGGG + Intronic
1073293149 10:102423258-102423280 CTCCATGGGCACAGTAAAGGTGG - Exonic
1074756306 10:116627007-116627029 CTGCCTGGGCCCTGTCCTGTGGG + Intronic
1075182635 10:120225525-120225547 GTCCGTGGGCACAGGCCTGAGGG + Intergenic
1075430443 10:122375268-122375290 CCCCGCGGGCACAGCCCTGGAGG - Intronic
1075565710 10:123502312-123502334 CTCCCTGGCTCCAGTCCTGGAGG + Intergenic
1076052491 10:127346820-127346842 CTGCCTGGGGACTTTCCTGGGGG - Intronic
1076096236 10:127736840-127736862 CTCCCAAGCCACAGCCCTGGGGG + Intergenic
1076129246 10:128001591-128001613 CTGCCTGTGCACTGTACTGGGGG - Intronic
1076227838 10:128794472-128794494 CTCCCTGTGCACAGCACTGAGGG - Intergenic
1076269012 10:129134176-129134198 CTCCCATGGCAGAGACCTGGAGG + Intergenic
1076472740 10:130730048-130730070 CACCATAGGCACAGTCCTGAAGG + Intergenic
1076735293 10:132456247-132456269 CATGATGGGCACAGTCCTGGGGG + Intergenic
1077106172 11:843496-843518 ATCCCTGGGCAGACTCCCGGAGG + Intronic
1077111017 11:862306-862328 CTCCATGGCCACAGTCGGGGAGG - Intronic
1077369490 11:2174778-2174800 CACGCTGGGCACAGGCCTGGAGG + Intergenic
1078018110 11:7632743-7632765 CTCCCTGGGTGCAGCCATGGTGG - Intronic
1078250902 11:9615438-9615460 CTCCCTGGGCACACTGGTTGAGG - Intergenic
1078573222 11:12476953-12476975 ATCCCTGACCACAGGCCTGGGGG - Intronic
1079136855 11:17780282-17780304 CACCCTGGGCAGAGGCCTGTGGG - Intronic
1083641249 11:64146527-64146549 CTCCCTGGGCCCTGTCCCCGTGG - Intronic
1083662248 11:64256828-64256850 CTCCTGGGGCACAGTCCTTTTGG + Intronic
1084206130 11:67594172-67594194 GTCCATGGGCACAGGCCTGGGGG + Intergenic
1084535945 11:69757059-69757081 CTCTCTGGGCACTTTCATGGTGG + Intergenic
1086520429 11:87662471-87662493 ATCCCTGGGCACACTCCAGAAGG - Intergenic
1087917966 11:103831894-103831916 CTCCATGTGCACATTCATGGTGG - Intergenic
1088221074 11:107570434-107570456 TTCCCTGGGCACAGGCCTGGGGG + Intergenic
1088238595 11:107750715-107750737 GTCTGTGGGCACAGGCCTGGGGG + Intergenic
1088821561 11:113461477-113461499 CACCCTGGGCACAGTCAAGCAGG + Intronic
1088989743 11:114942353-114942375 CTCCCTCTGCCCAGACCTGGAGG - Intergenic
1089122056 11:116144493-116144515 GTCCATGGGCACAGGCCAGGAGG - Intergenic
1089462206 11:118659890-118659912 CGCCCTGAACACAGTCCTGTGGG - Exonic
1089466736 11:118690525-118690547 CGCCCTGAACACAGTCCTGTGGG - Intergenic
1090190314 11:124762446-124762468 CTCCCTGCGTCCAGACCTGGAGG - Intergenic
1090591496 11:128275019-128275041 CTCCATGGGCAAGGTACTGGTGG + Intergenic
1090856038 11:130609941-130609963 CTCCCTGGACAGAGTCCTCGGGG - Intergenic
1091049235 11:132352614-132352636 CACACTGGACACAGGCCTGGGGG - Intergenic
1091602901 12:1928713-1928735 CTCTCTGGAAACAGTCCCGGAGG + Intergenic
1091994084 12:4979076-4979098 CTCCCTGGCCTCAGTCCTAGGGG - Intergenic
1092087198 12:5772942-5772964 CTCCTGGGGCACAGGCCAGGTGG - Intronic
1092282386 12:7108205-7108227 CTCCCTGGCCACAGTCCTGGCGG + Intronic
1094567624 12:31614320-31614342 CTCACTGGGGACAGTCATGATGG + Intergenic
1095785175 12:46101892-46101914 GTCCGTGGGCACAGGCCTGAGGG - Intergenic
1096414496 12:51401744-51401766 GTCCCTGGGCACAGGCCTGGGGG + Intronic
1096933389 12:55241729-55241751 GTCCATGGGTACAGGCCTGGGGG - Intergenic
1097794096 12:63844128-63844150 CGCCCTGGGCACAGCCCCGGCGG - Intergenic
1098134719 12:67390046-67390068 GTACCTGGGCAGATTCCTGGGGG + Intergenic
1098356470 12:69617231-69617253 CTCCCTGGGCACAGCCCTTCAGG - Intergenic
1101141768 12:101802634-101802656 TTTCTTGGGCACAGGCCTGGAGG - Intronic
1101455115 12:104824132-104824154 GTCCATGGGCACAGGCCCGGGGG - Intronic
1101455701 12:104827962-104827984 GTCCATGGGCACAGGCCTGGGGG - Intronic
1102086997 12:110149963-110149985 GTCCATGGGGACAGACCTGGGGG + Intronic
1102248594 12:111370430-111370452 CTCTCTGAGGACAGACCTGGAGG + Intergenic
1104268989 12:127265016-127265038 CTCCCTGAGCCCAGTCCTCTTGG + Intergenic
1104372670 12:128237416-128237438 CTCCCTGGGCACAAAGATGGGGG - Intergenic
1105805102 13:23947922-23947944 CTGCTGGGGCACAGTCATGGGGG - Intergenic
1106016101 13:25870378-25870400 GTCCCTGGACACAGGCCTGGGGG + Intronic
1106833479 13:33610460-33610482 CTCCCTGGGCACAGCACCGCAGG + Intergenic
1107722075 13:43259435-43259457 CTTGCTGGGCTTAGTCCTGGTGG + Intronic
1110484333 13:76020121-76020143 GTCCCTGAGCACAGGCCTGGGGG + Intergenic
1111343996 13:86924860-86924882 GTCCCTGGGCACAGGCCTGGGGG + Intergenic
1112605789 13:100904509-100904531 CTCCCAGTGCACAGGCCTGTGGG + Intergenic
1112901784 13:104365651-104365673 CTCTCTGTGCACAGTCATGGAGG + Intergenic
1113698749 13:112366951-112366973 CTCCCTTGTCACCATCCTGGTGG - Intergenic
1113904276 13:113812036-113812058 CTCCCTGGGCACACTGGTGAGGG + Exonic
1113924053 13:113930541-113930563 TTCCCAGGTCAGAGTCCTGGGGG + Intergenic
1115333849 14:32225811-32225833 TTCCCTGGACAGAGACCTGGAGG - Intergenic
1115345896 14:32343154-32343176 TTCCCTGGGCACAGAGCTAGTGG - Intronic
1116090119 14:40294026-40294048 GTCCGTGGGCACAGGCCTGAGGG + Intergenic
1117046298 14:51816674-51816696 GTCCGTGGGCACAGGCCTGAGGG + Intergenic
1118322965 14:64764117-64764139 CCCCTTGGGGATAGTCCTGGGGG - Intronic
1118781728 14:69013073-69013095 CTCCTTGTGCACAGTCTTGCTGG + Intergenic
1118813439 14:69291985-69292007 CCTCCTGGGCACAGGCCTGATGG + Intronic
1118819738 14:69337543-69337565 AGAACTGGGCACAGTCCTGGGGG - Intronic
1119444236 14:74649988-74650010 CTCCCTGTGCAGGTTCCTGGAGG - Intergenic
1119929880 14:78535244-78535266 TTTACTGGGCAAAGTCCTGGAGG + Intronic
1120778826 14:88467032-88467054 TTCCCTGGGGACAGTGCTGTGGG + Exonic
1120931100 14:89849202-89849224 CTGCCTGGGCACAGACCTAGAGG - Intronic
1120951212 14:90043870-90043892 CTTCCTGGGTAAAGTTCTGGTGG - Exonic
1121022303 14:90587620-90587642 CTCCCTGTGCCAAGTGCTGGGGG - Intronic
1121085844 14:91145530-91145552 CTTCCTGTCCTCAGTCCTGGTGG - Intronic
1122120181 14:99549023-99549045 CTCCCTGGGAAAAGTCGGGGAGG + Intronic
1122424339 14:101596989-101597011 CTCCCTGTGCACCCTCCTCGGGG - Intergenic
1122740821 14:103870639-103870661 CTCCCTGGGCACAATCCCCCTGG + Intergenic
1123988746 15:25667937-25667959 CTCCATGAGCACAGGCCTGACGG + Intergenic
1124338688 15:28876188-28876210 CCCACTGGGCCCAGTCCTGAGGG - Intergenic
1124405210 15:29385740-29385762 GTCCATGGGCACAGGCCTGAGGG - Intronic
1125681092 15:41530658-41530680 CTCTCTGCTCACAGTGCTGGGGG - Intronic
1127744406 15:61951668-61951690 GTCCCTGGGTACAGTTCTAGGGG - Intronic
1128095064 15:64947745-64947767 CACCCTGTGCAGAGGCCTGGAGG - Intronic
1128380432 15:67107985-67108007 CACCCTGGGCACAGCGCGGGAGG - Intronic
1128994661 15:72287775-72287797 CTAGCTGGCCACATTCCTGGTGG + Intronic
1129242504 15:74259876-74259898 CTGCATGGACACATTCCTGGGGG - Intronic
1129270136 15:74415229-74415251 CTCCCTGGGCACAGGCTGTGGGG + Intronic
1129702549 15:77776064-77776086 CTCCCTGGAAACAGCCGTGGTGG - Intronic
1129869883 15:78933365-78933387 CCCCGTGGGCACAATGCTGGTGG + Intronic
1130093243 15:80838341-80838363 CTGCCTCGCCACAGTTCTGGAGG - Intronic
1130093616 15:80840447-80840469 CTGCCTCGCCACAGTTCTGGAGG - Intronic
1130282904 15:82532986-82533008 CTCCCCAGGCTCAGTCATGGAGG + Intergenic
1130554663 15:84914427-84914449 TGCCCTGGGAACAGTCCTGGAGG - Intronic
1131368194 15:91857137-91857159 CTCCCTGGGCAGGTTCTTGGTGG - Intronic
1132109437 15:99091668-99091690 ATCACTGGGCACTGTCTTGGAGG + Intergenic
1132333854 15:101030581-101030603 CTCCCTGAGCACAGTTCCGTGGG - Intronic
1132400482 15:101502001-101502023 TCCCCGGGGCACAGTCCTGGAGG - Intronic
1132559460 16:586828-586850 CTCCCTGGGCACAGGGCTTCAGG + Intergenic
1133170096 16:3977525-3977547 CTCCCTCGCCACCGTCGTGGGGG - Exonic
1133736547 16:8620231-8620253 CTCTCTGTGTACTGTCCTGGGGG + Intergenic
1134044860 16:11093658-11093680 CACCCTGGGCACAGCACAGGTGG + Intronic
1134236258 16:12468630-12468652 CTCCCAGGGCTCAGTCCTTGGGG - Intronic
1134803941 16:17108865-17108887 CTCCACGGGCACAGCGCTGGAGG - Exonic
1137624667 16:49900096-49900118 CTCCCTGGGCTCAGCCCCCGTGG - Intergenic
1138234546 16:55370946-55370968 CTCCCTCGGTAGAGCCCTGGAGG - Intergenic
1139276278 16:65730493-65730515 TTCCTTGAGCAGAGTCCTGGGGG - Intergenic
1139877858 16:70160766-70160788 CTCCCTTGCCACCGTCTTGGTGG + Exonic
1139921260 16:70461780-70461802 CTTCCTGGGCACACTCCCTGGGG + Intronic
1140931369 16:79631134-79631156 CTCCCGGAGCACAGCACTGGTGG + Intergenic
1141199016 16:81882961-81882983 CCCCATGGCCACACTCCTGGAGG + Intronic
1141765112 16:86053002-86053024 CTGCCTGAGCAAAGGCCTGGAGG + Intergenic
1141767304 16:86067090-86067112 GTCCGTGGGCACAGGCCTGGGGG + Intergenic
1142214668 16:88824687-88824709 GCCCCTGAGCACCGTCCTGGGGG - Intronic
1142233542 16:88910899-88910921 CACACTTGGCACAGCCCTGGAGG - Intronic
1142896357 17:2981535-2981557 CTCCCTGAGGCCAGTGCTGGAGG + Intronic
1143098396 17:4490728-4490750 CTCTTTGGGGCCAGTCCTGGTGG + Intergenic
1143110221 17:4548765-4548787 TGCCCTGGGTACAGTCCTCGGGG + Intronic
1143465608 17:7134269-7134291 GTCCGTGGGCACAGGCCCGGGGG + Intergenic
1144300806 17:13921895-13921917 GTCCGTGGGCACAGGCCTGAGGG - Intergenic
1145991159 17:29080270-29080292 CTACCTGGACCCAGACCTGGAGG - Intronic
1146251402 17:31347613-31347635 CTCACTGGGGACAGTCATGATGG - Intronic
1147153419 17:38531353-38531375 CTCCCTGGCCACTGTTTTGGCGG - Exonic
1147267816 17:39245374-39245396 CTCTCTGGGCACTGTCCTCAAGG - Intergenic
1147324947 17:39665652-39665674 CTCTCTGGGCACAGGCTGGGTGG - Intronic
1147566805 17:41541442-41541464 CTCCATGGGTTCTGTCCTGGGGG - Intergenic
1147720371 17:42536256-42536278 CTCCATGGTCTCAGTCCTGCGGG - Exonic
1147921599 17:43920636-43920658 GTCCGTGGGCACAGGCCTGGGGG - Intergenic
1148127669 17:45245254-45245276 GTCCCTGGACAGTGTCCTGGCGG + Exonic
1148684617 17:49494783-49494805 ATCCCTGGGCAGAGGCCTAGGGG - Intergenic
1148699805 17:49580563-49580585 CACCCTGGGCTCGGTGCTGGAGG + Intronic
1149645132 17:58235377-58235399 TTCCCTGGGAACCGACCTGGTGG - Intronic
1150266057 17:63833095-63833117 CTTCCTGGGCCCAGGGCTGGTGG + Exonic
1150624348 17:66832109-66832131 CTCCCTGATCACAGACCTGAGGG + Intergenic
1151368969 17:73635492-73635514 TTCCCTGGGCACCTCCCTGGAGG - Intronic
1151930789 17:77230304-77230326 CTCACCTGGCACAGGCCTGGTGG - Intergenic
1152217987 17:79045529-79045551 GGCCCTGGGCTCAGTTCTGGAGG + Intronic
1152472545 17:80498474-80498496 CTTCCTGGCCACAGTTCGGGAGG + Intergenic
1152595270 17:81234714-81234736 GTCCCTGGGCCCAGGGCTGGCGG + Intronic
1152615186 17:81334590-81334612 TTCCCAGGCCACAGCCCTGGGGG - Intergenic
1153906031 18:9662086-9662108 CTGTCTGTGCACATTCCTGGTGG + Intergenic
1153990540 18:10395076-10395098 GTCCATGGGCACAGGCTTGGGGG + Intergenic
1155703433 18:28778664-28778686 GTCTGTGGGCACAGGCCTGGGGG - Intergenic
1156760603 18:40584049-40584071 GTCCATGGGCACAGGCCTGAAGG + Intergenic
1157076816 18:44475822-44475844 CACCCTGGGCATTGTCCAGGTGG + Intergenic
1157535089 18:48452092-48452114 GTCCGTTGGCACAGGCCTGGGGG + Intergenic
1157855347 18:51100160-51100182 GTCCATGGGCACAGTCCCGAGGG - Intergenic
1158959704 18:62579421-62579443 CGCCCTTGACGCAGTCCTGGTGG + Intronic
1159868271 18:73731263-73731285 CTCCCTCTGCACAGTGCAGGAGG + Intergenic
1160169949 18:76544745-76544767 CTCCCTGAGAGCAGGCCTGGAGG + Intergenic
1160692018 19:464532-464554 CAGCTTGGGCAAAGTCCTGGAGG - Intronic
1160806336 19:993776-993798 ATCCTTGGGCGCAGTCGTGGAGG + Intronic
1160943104 19:1629252-1629274 GTCCCAGGGGACAGGCCTGGGGG + Intronic
1161055577 19:2189263-2189285 CTGCCCGGGCAGAGGCCTGGTGG + Intronic
1161876308 19:6913727-6913749 CTCCCTGGCCACAGTCTTCCTGG + Exonic
1162064896 19:8119346-8119368 CTCCCTGCCCTGAGTCCTGGCGG - Intronic
1162439982 19:10686913-10686935 CTCCACAGGCACAGGCCTGGAGG - Intronic
1162979674 19:14230485-14230507 CTTCCTGGGCAAACTTCTGGAGG + Intergenic
1164127494 19:22331761-22331783 CTGCCTGGGCACAGCCCTCAGGG - Intergenic
1164143071 19:22491869-22491891 GTCCGTGGGCACAGGCCTGTGGG - Intronic
1165105082 19:33464464-33464486 CTCCCAGGGCTCTGTCCTGTTGG + Intronic
1165144237 19:33721329-33721351 ATACCTGGGCTCTGTCCTGGAGG - Intronic
1165578129 19:36838839-36838861 CTCGCTTGGCACAGTCTTGTAGG - Intronic
1165907677 19:39203703-39203725 CTCCCTAGAACCAGTCCTGGAGG - Intronic
1166621679 19:44306619-44306641 GTCCGTGGCCACAGGCCTGGGGG + Intergenic
1166810271 19:45509896-45509918 TTGGCTGGGGACAGTCCTGGGGG + Intronic
1166940140 19:46357850-46357872 CTCCCTGGACCCAGTCCTTTCGG + Intronic
1168161875 19:54515869-54515891 CTCCAAGGGCACAGACCTGTGGG - Intergenic
925092452 2:1166654-1166676 GTCCATGGGCACAGGCCTGGGGG - Intronic
926125687 2:10270377-10270399 GTCCCTGGGCACCTTCCTGATGG - Intergenic
926167739 2:10532023-10532045 CCGCCTGGGCTCAGTCCTGAAGG - Intergenic
927215942 2:20667824-20667846 CTCCCGGGGCCCAGTCCCAGAGG + Intronic
927514968 2:23666885-23666907 CTCTCTGTGCCCAGCCCTGGTGG + Intronic
927844734 2:26465515-26465537 GTCCCTGGGCACAGTCTTCAGGG - Intronic
928211673 2:29328371-29328393 CTCCCTGGGCACAGTCCTGGTGG + Exonic
928537987 2:32258451-32258473 GTCCGTGGGCACAGGCCTGGGGG + Intronic
929238023 2:39626879-39626901 CTCCCTGTGCACAGGCCTGTCGG + Intergenic
929437705 2:41940865-41940887 CTCTCTGGGCTCCTTCCTGGTGG - Intronic
929583268 2:43097977-43097999 CTCCCTGTGCACTGAGCTGGTGG - Intergenic
929760453 2:44802091-44802113 CCGCCCGGGCCCAGTCCTGGGGG + Intergenic
930290836 2:49491029-49491051 CTCTCTGGTCACTGTCCTGGGGG + Intergenic
932576465 2:72964967-72964989 GTCCGTGGGCACAGGCCTGGGGG - Intronic
933315184 2:80706620-80706642 GTCCATGGGCAAAGGCCTGGGGG - Intergenic
933611034 2:84435517-84435539 AGCCCTGGGAAAAGTCCTGGAGG + Intronic
934504724 2:94881001-94881023 CTGCTGGGGCACAGTCATGGGGG - Intergenic
934883998 2:98008523-98008545 GTCACAGGGCACAGGCCTGGGGG - Intergenic
937097563 2:119245619-119245641 CTCCCTGGCCACACGCCTGGTGG + Exonic
937318338 2:120946233-120946255 GTCCCTAGGCACAGCCCTGTTGG + Intronic
939078428 2:137630373-137630395 CTGCCTTGGCACAGTCTTGAGGG - Intronic
939778378 2:146413447-146413469 GTCCGTGGGCACAGGCCCGGGGG + Intergenic
941309558 2:163912275-163912297 GTCCGTGGGCACAGGCCTGAAGG - Intergenic
941493076 2:166166634-166166656 CCCACTGGACACAGGCCTGGAGG - Intergenic
941978912 2:171434067-171434089 CTAGCTGGGCAGAGCCCTGGGGG - Intronic
945219390 2:207468596-207468618 CTCCCTGGGCACTCTCCTCCAGG + Intergenic
946832588 2:223741381-223741403 GTCCGTGGGCACAGGCCTGAGGG + Intergenic
947906430 2:233766558-233766580 GTCCATGGGCACAGGTCTGGGGG + Intronic
947911952 2:233807449-233807471 CACCTTGGCCACAGGCCTGGAGG + Exonic
948525281 2:238567409-238567431 GTCCGTGGGCACAGGCCCGGGGG - Intergenic
948568044 2:238898766-238898788 CTGGATGGGCAAAGTCCTGGAGG + Intronic
948860630 2:240751060-240751082 CTCCCTGGGCCCTGGGCTGGGGG - Intronic
948878107 2:240840917-240840939 CTCCCTGTGCTCAGCCCAGGGGG - Intergenic
948906496 2:240982115-240982137 TTCCCCGGGCAGTGTCCTGGGGG + Intronic
1168956555 20:1838436-1838458 CTCCCAGGCCTCAGTCCTGCTGG + Intergenic
1170486037 20:16817033-16817055 GTCCATGGGCACAGGCCCGGGGG + Intergenic
1170938995 20:20833201-20833223 ACCAGTGGGCACAGTCCTGGGGG - Intergenic
1171459663 20:25291482-25291504 ATCCCTGGGCACCGTCCCTGTGG + Intronic
1171529513 20:25843626-25843648 CTCCCTGGGCACAACCCTCCAGG + Intronic
1171531354 20:25855583-25855605 CTCTGTGGGCACACTCCTGCAGG + Intronic
1171547313 20:26012254-26012276 CTCCCTGGGCACAACCCTCCAGG - Intergenic
1172695897 20:36822551-36822573 CTGCCTGAGCACAGCTCTGGAGG + Intronic
1173044072 20:39492703-39492725 AAACCAGGGCACAGTCCTGGTGG + Intergenic
1173228004 20:41173286-41173308 CTCCATGGGCAGTGTCCCGGGGG + Intronic
1173647061 20:44639950-44639972 CTCTCTGGCCACAGTTCTGTAGG - Intronic
1174197876 20:48786179-48786201 CTCCCTGGGAGGGGTCCTGGTGG + Intronic
1175171637 20:57085203-57085225 CTACCTGGGCACAGAGCTGTGGG - Intergenic
1176033059 20:63023148-63023170 TTCCCAGGTCTCAGTCCTGGCGG + Intergenic
1176176931 20:63733120-63733142 CCGCCTGGGCACTGTCCTGAGGG - Intronic
1176248621 20:64109505-64109527 CTCCCTGGGGGCATTGCTGGGGG + Intergenic
1176249764 20:64114934-64114956 GGCCCTGGGCTCAGTGCTGGGGG + Intergenic
1176301970 21:5102754-5102776 AGTCCTGGGCACAGCCCTGGGGG - Intergenic
1176410638 21:6447851-6447873 CCCCCTGCACACAGGCCTGGTGG + Intergenic
1177431517 21:20997418-20997440 CTCCCTCGGTGCACTCCTGGCGG + Intergenic
1178816511 21:35934917-35934939 TTCCCCGGGCAAAGACCTGGAGG - Intronic
1179371518 21:40810262-40810284 CTTCCTGTGCACAGACCTGAGGG - Intronic
1179686132 21:43056173-43056195 CCCCCTGCACACAGGCCTGGTGG + Intronic
1179855060 21:44159146-44159168 AGTCCTGGGCACAGCCCTGGGGG + Intergenic
1181050660 22:20236862-20236884 CTGCTTGGGCCCAGCCCTGGAGG - Intergenic
1181182919 22:21079748-21079770 CTCCCTCGGCACTTTCCTGGAGG + Intergenic
1181277213 22:21694659-21694681 CTCCCTGGGCACAGACCTTAGGG - Exonic
1181743258 22:24938187-24938209 CTCCTTGGGCACAGCCCTTTGGG + Exonic
1182115879 22:27756114-27756136 CTCCCCGGGCCCAGCCCTGCAGG - Intronic
1183044805 22:35211154-35211176 ACCCCTGGGAACAGTCTTGGGGG + Intergenic
1184101883 22:42345095-42345117 CTGCCTGGGGACTGTCCAGGAGG + Intergenic
1184377603 22:44124543-44124565 CTCCCTGGGGGCTGTCCTGGAGG + Intronic
1185127129 22:49017542-49017564 GTCCCTGGGCACAGGCCCTGGGG + Intergenic
1185208381 22:49553194-49553216 CTCCTCGGGCACAGCCCTGTGGG + Intronic
1185335639 22:50269911-50269933 CTCCCAGGCCTCAGGCCTGGTGG + Intronic
949807975 3:7976426-7976448 GTCCATGGGCACAGACCTGAGGG - Intergenic
949859801 3:8494751-8494773 CTTCCTGGGCACAGAGCTGGAGG + Intergenic
950148728 3:10669676-10669698 GTCTCTGGGCACAGTCCCTGAGG - Intronic
950662773 3:14477020-14477042 CTCCCCAGGCACAGTCAGGGAGG + Intronic
951439635 3:22707779-22707801 CTTGCTGGGCAGAGCCCTGGGGG - Intergenic
951555634 3:23917680-23917702 CTCCGTGGGCGCAGTGGTGGGGG + Intronic
952298839 3:32085995-32086017 CTCCTTGGGCACAGGCCTGGAGG + Intergenic
953734224 3:45477533-45477555 CTCCCTGGGGACAATCTTTGTGG - Intronic
953774361 3:45802880-45802902 AGCCCTGGGCACAGTCCTACAGG - Intergenic
953876855 3:46671487-46671509 CTTCCTGCTCACAGCCCTGGAGG - Exonic
954366317 3:50148033-50148055 CTGTGTGGCCACAGTCCTGGGGG - Intergenic
954472197 3:50707631-50707653 GTCCTTGGGCACAGTGGTGGTGG + Intronic
955216609 3:56989509-56989531 CCCCCTGGGCACAGACCTGCTGG - Intronic
957136503 3:76295324-76295346 CTCTATGGGCATAGTCCTGGTGG - Intronic
960501666 3:118445348-118445370 GTCCATGGGCACAGGCCTGAGGG + Intergenic
961135668 3:124508284-124508306 CTCCCTGGTCACAACCCTGGAGG + Intronic
961387057 3:126528673-126528695 CCCCTTGAGCACAGTCCTGTCGG - Intronic
962095182 3:132285535-132285557 GTCCGTGGGCACAGGCCTGGGGG + Intergenic
963239926 3:142992705-142992727 GTCCATGGGCACAGGCCCGGGGG + Intronic
965486424 3:169284131-169284153 CTCCTTGGGCAGAGTCTTGATGG - Intronic
966107306 3:176351790-176351812 CTCCATGGGCACCGGACTGGAGG - Intergenic
966502333 3:180657324-180657346 CTCCCTGGTCACATTCATAGTGG - Intronic
966595320 3:181720294-181720316 ATCCCTGGGCATCGTCCTGAAGG + Intergenic
968595074 4:1478033-1478055 CCCCCTGGGCACAGCCAGGGTGG + Intergenic
968706640 4:2081392-2081414 CTGCCTGGGCCCAGTTCTTGCGG + Intronic
968917419 4:3502629-3502651 CTCCCCGGGCACTCTGCTGGAGG - Intergenic
969808290 4:9627712-9627734 CTACCTAGACAGAGTCCTGGGGG + Intergenic
970234578 4:13945364-13945386 GTCTGTGGGCACAGGCCTGGAGG + Intergenic
970574296 4:17412346-17412368 ATCCATGGGCACAGGCCTGAGGG + Intergenic
973057505 4:45679111-45679133 GTCTGTGGGCACAGGCCTGGGGG + Intergenic
973150912 4:46887358-46887380 TACCCAGGGCTCAGTCCTGGAGG + Intronic
974250145 4:59375230-59375252 GTCCATAGGCACAGGCCTGGGGG + Intergenic
974250690 4:59379045-59379067 GTCCCTGGGCAGAGGCCTGGGGG + Intergenic
974596330 4:64017649-64017671 GTCCGTGGGCACAGGCCTGAAGG + Intergenic
974669760 4:65014454-65014476 ATCCCAGGGCACAGGCCTCGGGG + Intergenic
975928785 4:79492380-79492402 TTTCCTGGGCAGAGTCCAGGGGG - Intergenic
976203928 4:82606727-82606749 CTCCCGAGGCACTGCCCTGGAGG - Intergenic
977766673 4:100806345-100806367 GTCCATGGGCACAGGCCCGGTGG + Intronic
979492659 4:121346274-121346296 GTCCATAGGCACAGACCTGGGGG + Intronic
980716431 4:136636141-136636163 GTCCAAGGGCACAGGCCTGGGGG - Intergenic
980891467 4:138819485-138819507 CTCTCCGGGCCCAGACCTGGTGG + Intergenic
982004328 4:151049657-151049679 GTTCGTGGGCACAGGCCTGGGGG + Intergenic
984097179 4:175447877-175447899 GTCCATGGGCACAGGCCCGGGGG - Intergenic
985844918 5:2336837-2336859 CTCCCTGGGCAAACTCCTCCTGG - Intergenic
985854794 5:2416485-2416507 GTCCATGGGCACAGGCCTGAGGG - Intergenic
986314346 5:6576318-6576340 CTCCCTGGAGACACTCCTGTGGG - Intergenic
986364812 5:7019622-7019644 GTCCATGGGCACAGGCCTAGAGG + Intergenic
986365382 5:7023373-7023395 GTCCATGGGCACAGGCCTGAGGG + Intergenic
986422757 5:7600709-7600731 CTGGCTGGGCACAGTGCAGGTGG + Intronic
987212081 5:15693522-15693544 GTCCATGGGCACAGGCCTGAGGG - Intronic
987524515 5:19030397-19030419 GTCCCTGGGCACAGTCCCGAAGG + Intergenic
988038160 5:25853799-25853821 GTCCCTGGGCACAGGCCAGGAGG + Intergenic
988354141 5:30151260-30151282 CACCCTGGGCATTGCCCTGGTGG + Intergenic
989275706 5:39586195-39586217 GTCCGTGGGCACAGGCCTGAGGG - Intergenic
990624543 5:57596957-57596979 CTCCGTGGGCACAGATGTGGGGG - Intergenic
990638055 5:57751066-57751088 GTCCGTGGGCACAGGCCCGGGGG + Intergenic
990792419 5:59496413-59496435 GTCCGTGGGCACAGGCCTGGGGG + Intronic
992495128 5:77284948-77284970 CTCACTGGGCACATTCCTATTGG + Intronic
994705954 5:103206877-103206899 CTCCCTGTCCGCAGTCCTTGAGG - Intronic
996566107 5:124881024-124881046 GTCCCTGGGCACAGGGCTGGGGG + Intergenic
997466825 5:134093806-134093828 CTTCCTGGGCTCAGTCCTCTGGG - Intergenic
997475035 5:134137866-134137888 CTGCTTGGGCAAAGTCTTGGGGG + Intronic
997615252 5:135241785-135241807 CTCCCTGGTCACTTTCCTGGTGG + Intronic
999714806 5:154352197-154352219 CTGCCTGGGAACAGTCCCTGAGG - Intronic
999928518 5:156405786-156405808 CTCCCTGGCTATAGGCCTGGGGG + Intronic
1001045511 5:168368532-168368554 TTCTCTGGGCACAGTGCAGGTGG + Intronic
1001181096 5:169521596-169521618 GTCCCTGGGCACAGGCCTGGAGG - Intergenic
1001716991 5:173824452-173824474 CTCCCTGTAAACAGTCCAGGGGG - Intergenic
1002044915 5:176536473-176536495 CTCCCCAGGCATAGTGCTGGGGG + Intronic
1002475771 5:179464886-179464908 GTCCGTGGGCACAGGCCTGAGGG + Intergenic
1002477061 5:179473015-179473037 GTCCGTGGGCGCAGGCCTGGGGG + Intergenic
1002596956 5:180329927-180329949 CTCCCTGGGCCCTGTCCTCTGGG + Intronic
1002962166 6:1925768-1925790 GTCCGTGGGCATAGGCCTGGGGG - Intronic
1003809964 6:9768314-9768336 GTCCATGGGCACAGGCCTGGGGG + Intronic
1004342366 6:14818858-14818880 CTCCCAGGGCAGGGTGCTGGGGG - Intergenic
1005461139 6:26071302-26071324 GTCCCTGGGCACAGGCCTGGGGG - Intergenic
1005532576 6:26722543-26722565 ATCCATGGGCACAGGCCCGGCGG - Intergenic
1005538219 6:26779122-26779144 ATCCATGGGCACAGGCCCGGCGG + Intergenic
1006610109 6:35289542-35289564 TTTCCTGGGCAGGGTCCTGGTGG - Intronic
1006772063 6:36561929-36561951 CTCCCTGAGCAGAGACCTGAAGG - Intergenic
1007606952 6:43124137-43124159 TTCCCAGACCACAGTCCTGGGGG + Intronic
1008215784 6:48786767-48786789 ACTCCTGGGCACAGTCTTGGGGG + Intergenic
1008662437 6:53681963-53681985 AGCCCTGGGCCCAGTCCTGGAGG + Intergenic
1008727727 6:54442056-54442078 GTCCATGGGCACAGGCCTAGGGG + Intergenic
1009006856 6:57798709-57798731 GTCCATGGGCACAGGCCCGGCGG + Intergenic
1009009069 6:57821472-57821494 GTCCATGGGCACAGGCCCGGCGG + Intergenic
1010532668 6:76988465-76988487 GTCCATGGGCACAGGCCTGAGGG - Intergenic
1011696929 6:89921355-89921377 CTGCCTGGGCACACTGCTTGAGG + Intergenic
1011916363 6:92511382-92511404 CTCCCTGATCTCAGGCCTGGAGG + Intergenic
1012724901 6:102798739-102798761 GTCCCTGGGCACAGGCCCGAGGG - Intergenic
1013112945 6:107078883-107078905 GTCCATGGGCACAGGCCTGAGGG - Intronic
1014247322 6:119082097-119082119 GTCCATGGGCATAGGCCTGGGGG + Intronic
1016563376 6:145423494-145423516 CCCCCTGGCCACAGTGCTTGTGG + Intergenic
1017771495 6:157648312-157648334 TGCCCTGGACACAGTCATGGTGG - Intronic
1018669273 6:166166554-166166576 CTCGCTGGTCCCAGACCTGGCGG + Intronic
1018794472 6:167175136-167175158 GTCCCTGGGCACAGGCCCGGGGG + Intronic
1018821847 6:167379931-167379953 GTCCCTGGGCACAGGCCTGGGGG - Intronic
1019481746 7:1270157-1270179 CGACCTGGGCACGGTCCTGGGGG + Intergenic
1019605996 7:1910509-1910531 CACGCTGGGCACTGCCCTGGGGG + Intronic
1019777225 7:2918998-2919020 CTACCTGTGCTCAGTCCTTGGGG + Intronic
1019945682 7:4327330-4327352 TTCCCTGGGCCCAGTGGTGGAGG + Intergenic
1022191196 7:28018229-28018251 CGGCCAGGGCACAGGCCTGGAGG + Intronic
1022326402 7:29336044-29336066 CTCACTGGGGACAGTCGTGATGG + Intronic
1022502777 7:30893050-30893072 CTCACTGGGCACAGACAGGGTGG - Intergenic
1022589779 7:31650635-31650657 CTGCTTAGTCACAGTCCTGGAGG - Intronic
1022805957 7:33823000-33823022 CTCCCTGACCACAGGCCTAGTGG + Intergenic
1023174129 7:37419037-37419059 CTCTGCGGGCTCAGTCCTGGGGG - Intronic
1024178476 7:46864089-46864111 CTCCCAGGGCACAGTGAAGGTGG - Intergenic
1024297568 7:47857690-47857712 CTTGCTGGGCACAGTCCTGCTGG - Exonic
1024367938 7:48544531-48544553 CTCCCTGAACACAGTTTTGGGGG - Intronic
1024440198 7:49408078-49408100 GTCCATGGGCACAGGCCTGAGGG - Intergenic
1024643924 7:51355743-51355765 GTCCATGGGCACAGGCCCGGGGG + Intergenic
1025176605 7:56805346-56805368 CTCGCTGGACACAGTCCTGTGGG - Intergenic
1025695187 7:63771040-63771062 CTCGCTGGACACAGTCCTGTGGG + Intergenic
1025997600 7:66537837-66537859 CTCCTTGGGCACTGTCTGGGAGG - Intergenic
1026847488 7:73706070-73706092 CTCTCGGGGCAGAGTCCTGGGGG - Intronic
1026900672 7:74035366-74035388 GTCCCTGGGGCCATTCCTGGTGG + Exonic
1027257932 7:76443130-76443152 TTCCCTGGGCACCCTCCTTGGGG - Intergenic
1028346872 7:89793838-89793860 GTCCGTGGGCACAGGCCTGAGGG + Intergenic
1029519211 7:101049464-101049486 CTGCCTGGGCACAGTAATGCAGG - Intronic
1030058875 7:105607324-105607346 CTCCCTGCACACAATCCTGAGGG + Exonic
1030219080 7:107078430-107078452 ATGCCAGGGCACAGGCCTGGGGG + Intronic
1031406809 7:121396206-121396228 CTCCCAGCGCTCAGTCCTGCCGG + Exonic
1031936756 7:127742993-127743015 ATCACTGGGCACAGTTATGGAGG + Intronic
1032080308 7:128855308-128855330 CACCCTGGGCACAAACCTGGAGG - Exonic
1032195538 7:129786287-129786309 TTTCCTGGGCACACTCCTGAGGG + Intergenic
1032299000 7:130669077-130669099 CTCCCCGGGCGCGGTTCTGGTGG + Exonic
1032399124 7:131611426-131611448 CTCCCTGGACACAGGGATGGGGG + Intergenic
1032491797 7:132329427-132329449 ACCCTTGGGCAGAGTCCTGGGGG - Intronic
1032673382 7:134106462-134106484 GTCCTTGGGCACAGGCCTGAGGG + Intergenic
1033244534 7:139707062-139707084 CTTCCCAGGCACACTCCTGGAGG + Intronic
1033870557 7:145749900-145749922 GTCTGTGGGCACAGACCTGGGGG + Intergenic
1034313401 7:150109965-150109987 ATACCTGGGGACAGTCATGGAGG + Intergenic
1034400098 7:150856535-150856557 CTTCCTGGGCAGAGTCCCCGGGG - Exonic
1034540391 7:151754639-151754661 CTCACAGGGCACAGCCCTGAGGG + Intronic
1034793460 7:153990699-153990721 ATACCTGGGGACAGTCATGGAGG - Intronic
1035048251 7:155983258-155983280 CTCCCTGGGGTCAGTCCTGGAGG + Intergenic
1035570001 8:666592-666614 GTCCCTGGTCACGCTCCTGGTGG + Intronic
1037893231 8:22635162-22635184 ATCCCTGGGCAGAGTCCTGAAGG - Intronic
1037952307 8:23027456-23027478 CTGCCTGAGCACAGCACTGGGGG - Intronic
1038402304 8:27293957-27293979 CTTCCTGGGTACTGGCCTGGAGG - Intronic
1038547567 8:28437419-28437441 CTCCCTGGGAAGAATCCTGGGGG - Intronic
1039494297 8:37969150-37969172 CTGCCAGGGCATAGCCCTGGAGG - Intergenic
1039501523 8:38021550-38021572 CTTCCTGGGACCATTCCTGGGGG + Intergenic
1040299771 8:46181831-46181853 CACACTGGGGACAGTCCTCGTGG + Intergenic
1040300650 8:46186285-46186307 TGCCCTCGGGACAGTCCTGGGGG + Intergenic
1040305988 8:46212047-46212069 CTCACACGGGACAGTCCTGGGGG - Intergenic
1040864306 8:52032790-52032812 CATTCTGGGCACAGCCCTGGTGG - Intergenic
1045942443 8:107755064-107755086 GTCCATGGGCACAGGCCCGGGGG - Intergenic
1046051581 8:109029305-109029327 ATCCCTGGGCACAGTGTTTGTGG - Intergenic
1046439141 8:114236239-114236261 GTCCGTGGGCACAGGCCTGAGGG - Intergenic
1049191046 8:141287827-141287849 CTCCCAGGGCACAGTCCACAGGG + Intronic
1049348053 8:142149220-142149242 CTCCCTGTGCTCAGCCCAGGAGG + Intergenic
1051666358 9:19470277-19470299 CACCCTGGCCACATCCCTGGAGG + Intergenic
1051748669 9:20319084-20319106 CTCCCTAGGCACACTTCTGTCGG - Intergenic
1052566581 9:30160824-30160846 GTCCATGGGCACAGGCCAGGGGG + Intergenic
1052805276 9:33007855-33007877 CAGCCTGGGCTCAGTCTTGGTGG - Intronic
1053525455 9:38825899-38825921 GTCCATGGGCACAGGCCTGAGGG - Intergenic
1054197684 9:62050326-62050348 GTCCATGGGCACAGGCCTGAGGG - Intergenic
1054640669 9:67538046-67538068 GTCCATGGGCACAGGCCTGAGGG + Intergenic
1054949487 9:70834339-70834361 CTCCCTTTGCCCAGTCCTGAGGG + Intronic
1055054439 9:72010862-72010884 GTCCATGGGCACAGGCCTGGGGG + Intergenic
1056573313 9:87834889-87834911 GTCCGTGGGCACAGGCCCGGGGG + Intergenic
1057091644 9:92263550-92263572 ATCCCTGACCACTGTCCTGGGGG + Intronic
1059433242 9:114262190-114262212 ATTCATGGGCACAGGCCTGGCGG - Intronic
1060732840 9:126049068-126049090 CTCCCTGGGCCCAGGACAGGAGG - Intergenic
1060742191 9:126106504-126106526 CTTCATGGGCACAGTCTTGTAGG - Intergenic
1060815991 9:126635436-126635458 CTGCCTGGGCAAAGGCATGGAGG + Intronic
1061050511 9:128191989-128192011 CTCCGTGGGCAAACTCCTGACGG - Intronic
1061152655 9:128837675-128837697 CCCCCTGGGCAAGGTACTGGAGG - Exonic
1061382752 9:130268246-130268268 CTCTCTGGGCACTGAGCTGGTGG + Intergenic
1061573844 9:131494162-131494184 CTCCTTGAGCTCTGTCCTGGAGG + Intronic
1061925445 9:133803934-133803956 CCCCCTGAGCACAGTCCTGCAGG - Intronic
1061997227 9:134192678-134192700 TGCCCTGGGGTCAGTCCTGGTGG + Intergenic
1062008339 9:134252914-134252936 CACCCTGTGCACCGTGCTGGGGG + Intergenic
1062009079 9:134257438-134257460 CCCCCGGTGCACAGTGCTGGGGG - Intergenic
1062110170 9:134777832-134777854 CTCCCTGCCCTGAGTCCTGGGGG - Intronic
1062379813 9:136281790-136281812 CACCCTGGGCACACTGTTGGGGG - Intronic
1062443453 9:136583702-136583724 CACCCTGGGCAAAGGCCAGGGGG - Intergenic
1062522301 9:136963391-136963413 CTCCCAGGGCAGAGTCCCCGTGG - Intergenic
1185853329 X:3509292-3509314 GTCCATGGGCACAGGCCTGAGGG - Intergenic
1186355350 X:8784150-8784172 CTGCCTGAGCAGAGTCCTGCAGG - Intergenic
1187138458 X:16570810-16570832 GTCCGTGGGCACAGGCCTGGGGG - Intergenic
1187276014 X:17817191-17817213 CACCCTGTGCACAGTGCTGGGGG + Intronic
1187347760 X:18481968-18481990 CTCACTGGGCATAGAGCTGGGGG + Intronic
1187365375 X:18661982-18662004 GTCCGTGGGCACAGGCCTGGGGG + Intronic
1187911026 X:24111318-24111340 CTGCCTGGGGACAGGCGTGGTGG + Intergenic
1189959559 X:46311442-46311464 CAACCTGGGAACAGTGCTGGGGG + Intergenic
1190535276 X:51420450-51420472 GTCCGTGGGCACAGGCCTGAGGG + Intergenic
1192183666 X:68931475-68931497 ATCCTTGGTCAGAGTCCTGGGGG + Intergenic
1193497957 X:82237437-82237459 CTCCATGGGCAGAGCCCTGAGGG - Intergenic
1194536415 X:95109523-95109545 CTCCATGGGGACAGGCCTGGGGG + Intergenic
1195742230 X:108076553-108076575 TTCCCTGGGCACTGTCCTTGTGG - Intronic
1196025916 X:111041329-111041351 GTCCTTAGGGACAGTCCTGGGGG + Intronic
1198588850 X:138153599-138153621 CTCCCTCGACACAGTACTGAAGG - Intergenic
1200099995 X:153685553-153685575 CTCCTGGGACAGAGTCCTGGAGG + Intronic
1201352164 Y:13055659-13055681 TTCCCTGAGCACATTCCTGTTGG - Intergenic
1201947905 Y:19531569-19531591 TTTGCTGGGCTCAGTCCTGGTGG - Intergenic