ID: 928211673

View in Genome Browser
Species Human (GRCh38)
Location 2:29328371-29328393
Sequence CTCCCTGGGCACAGTCCTGG TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 496
Summary {0: 1, 1: 1, 2: 9, 3: 63, 4: 422}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
928211667_928211673 11 Left 928211667 2:29328337-29328359 CCCATCTACTCACGGCACATCTG 0: 1
1: 0
2: 1
3: 11
4: 64
Right 928211673 2:29328371-29328393 CTCCCTGGGCACAGTCCTGGTGG 0: 1
1: 1
2: 9
3: 63
4: 422
928211666_928211673 12 Left 928211666 2:29328336-29328358 CCCCATCTACTCACGGCACATCT 0: 1
1: 0
2: 0
3: 7
4: 68
Right 928211673 2:29328371-29328393 CTCCCTGGGCACAGTCCTGGTGG 0: 1
1: 1
2: 9
3: 63
4: 422
928211668_928211673 10 Left 928211668 2:29328338-29328360 CCATCTACTCACGGCACATCTGG 0: 1
1: 0
2: 0
3: 5
4: 75
Right 928211673 2:29328371-29328393 CTCCCTGGGCACAGTCCTGGTGG 0: 1
1: 1
2: 9
3: 63
4: 422

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
928211673 Original CRISPR CTCCCTGGGCACAGTCCTGG TGG Exonic