ID: 928213140

View in Genome Browser
Species Human (GRCh38)
Location 2:29338880-29338902
Sequence ATTGAAATGGAGACTGGGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 519
Summary {0: 1, 1: 0, 2: 5, 3: 40, 4: 473}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
928213140_928213148 19 Left 928213140 2:29338880-29338902 CCTTCCCCAGTCTCCATTTCAAT 0: 1
1: 0
2: 5
3: 40
4: 473
Right 928213148 2:29338922-29338944 GCCCAGCACTGGGGTGACAGTGG 0: 1
1: 0
2: 2
3: 43
4: 444
928213140_928213147 10 Left 928213140 2:29338880-29338902 CCTTCCCCAGTCTCCATTTCAAT 0: 1
1: 0
2: 5
3: 40
4: 473
Right 928213147 2:29338913-29338935 CTACAATGTGCCCAGCACTGGGG 0: 1
1: 1
2: 12
3: 96
4: 500
928213140_928213145 8 Left 928213140 2:29338880-29338902 CCTTCCCCAGTCTCCATTTCAAT 0: 1
1: 0
2: 5
3: 40
4: 473
Right 928213145 2:29338911-29338933 TTCTACAATGTGCCCAGCACTGG 0: 1
1: 1
2: 5
3: 25
4: 260
928213140_928213146 9 Left 928213140 2:29338880-29338902 CCTTCCCCAGTCTCCATTTCAAT 0: 1
1: 0
2: 5
3: 40
4: 473
Right 928213146 2:29338912-29338934 TCTACAATGTGCCCAGCACTGGG 0: 1
1: 2
2: 7
3: 65
4: 481

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
928213140 Original CRISPR ATTGAAATGGAGACTGGGGA AGG (reversed) Intronic
900107594 1:990965-990987 TTTGAGATGGAGTCTCGGGAGGG - Intergenic
900919986 1:5663934-5663956 ATGGAGATGGAGACTGAAGAGGG + Intergenic
902429266 1:16350454-16350476 ATAGAAAAGGAGGCTGGGCACGG + Intronic
903778543 1:25808112-25808134 CTTGGAGAGGAGACTGGGGAGGG + Intronic
904344330 1:29858040-29858062 ATTGTGGTGGAGACTGGAGAGGG - Intergenic
904902679 1:33869775-33869797 AGAGAAAGGGAGAGTGGGGAGGG - Intronic
905249447 1:36638616-36638638 CCTGAAATGGAAACAGGGGAGGG + Intergenic
906373483 1:45274447-45274469 AGTGCAATGAAGACTGGAGAGGG + Intronic
906823763 1:48956536-48956558 AGTGGAAGAGAGACTGGGGAAGG + Intronic
907509489 1:54947580-54947602 ATTGAGATGCAGAGAGGGGAAGG + Intergenic
908769240 1:67581290-67581312 ATAGAAAGGGAGTCGGGGGAAGG + Intergenic
909353014 1:74675626-74675648 ATAAAAATCGGGACTGGGGAAGG + Intergenic
910265353 1:85332315-85332337 ATTGTACTGCACACTGGGGAGGG + Intronic
912169529 1:107081682-107081704 CTGGAAATGGAGATTTGGGAAGG - Intergenic
912373120 1:109188813-109188835 TTTGAAATGGAAATTGGGGTGGG + Intronic
913256977 1:116962690-116962712 CTTGAAATTGAGACTGTGGAGGG - Intronic
913278557 1:117163159-117163181 ATTTAAAAGGACACTGGGCAAGG + Intronic
913373328 1:118124954-118124976 TTGGCCATGGAGACTGGGGAGGG - Intronic
913478698 1:119263876-119263898 ATAGAAGGGGAGGCTGGGGAGGG - Intergenic
913609969 1:120501412-120501434 ATGGAAATGGAGGCTGAGGGAGG + Intergenic
913718932 1:121571310-121571332 ATAGAAAAGGAGACTGAGGTAGG - Intergenic
914581219 1:149020829-149020851 ATGGAAATGGAGGCTGAGGGAGG - Intronic
915150750 1:153829395-153829417 AATGAAATTGAAACTTGGGAAGG - Intronic
915955197 1:160215025-160215047 AGGGAAAGGGAGACTTGGGAAGG - Exonic
916757243 1:167784365-167784387 AATGAAATGGAGGGTGGGGAGGG + Intronic
917268830 1:173251036-173251058 ATTGAATCAGAAACTGGGGATGG + Intergenic
917639877 1:176973155-176973177 CTTGAAATTGAGACCAGGGAGGG - Intronic
917727535 1:177841769-177841791 TTTTATATGGAGCCTGGGGAGGG + Intergenic
919169580 1:193937292-193937314 ATAGAAAGGGAAAGTGGGGATGG - Intergenic
920221856 1:204410216-204410238 ATGGAAAAGGAGCCTGGAGAGGG - Exonic
920345017 1:205300849-205300871 GTTGAAAGGGAGTTTGGGGACGG - Intergenic
920362865 1:205431213-205431235 ATTGAACTGAAAACTGGGTACGG - Intronic
921094941 1:211878375-211878397 ATGGAAGTAGAGACTGGGCATGG + Intergenic
921408346 1:214807061-214807083 ATTAAAATGGAGCCTGCAGATGG + Intergenic
921584161 1:216928348-216928370 ATTGAAATGGAGGAGTGGGATGG - Intronic
921852526 1:219946546-219946568 ACTTACATGGGGACTGGGGAGGG - Intronic
922107815 1:222527546-222527568 GGAGAAATGGAGAGTGGGGAGGG - Intronic
922503252 1:226111680-226111702 AGTGAAAGGTAGAATGGGGAAGG - Intergenic
922859203 1:228801483-228801505 ATTAAACTGGTGACTGGGAATGG - Intergenic
923056547 1:230430397-230430419 ATTGAAATGGTGGCGGGGGGTGG + Intergenic
923152354 1:231244811-231244833 AATGAAAAGAAGACTGAGGATGG + Intronic
923238983 1:232062221-232062243 CTGGAAGTGGAGAGTGGGGAGGG + Intergenic
923386167 1:233466862-233466884 ATTGCAAAGGACACTGGGAAAGG - Intergenic
923473410 1:234312194-234312216 CTTGACATGGAGGCTGGGGGTGG - Intronic
924089813 1:240490851-240490873 ATTGTAATGGAGGCTAGGGGTGG - Exonic
924406727 1:243755362-243755384 ATTAAAAAGGAGACCGGGCACGG - Intronic
924549312 1:245060113-245060135 ATTTTAGTGGAGTCTGGGGATGG + Intronic
1063286765 10:4697103-4697125 ATAGAAATGGAGAATGCAGAAGG + Intergenic
1063484191 10:6403723-6403745 ATTGAAATGGAGACAGCTAAAGG + Intergenic
1064155784 10:12902014-12902036 CGTGCCATGGAGACTGGGGAGGG - Intronic
1064754920 10:18565025-18565047 AATGAAATGGAGAATGGAGTGGG - Intronic
1065588397 10:27241559-27241581 ATTTAATAGGAGACTGGGCATGG + Intronic
1068113037 10:52704111-52704133 ATTTAAAGAGAGACTGGGGGTGG + Intergenic
1068120658 10:52779617-52779639 ATTGAATTGGAGGTGGGGGACGG + Intergenic
1068360664 10:55972707-55972729 ATGGGAACAGAGACTGGGGAGGG - Intergenic
1068526091 10:58131578-58131600 ATTGAAATAGATACTGGTGATGG - Intergenic
1068681406 10:59824155-59824177 ATTGAAATTGAGTCTAGGAAAGG + Intronic
1068697365 10:59982204-59982226 ATTAAAATGGTGCCTGGGGCGGG + Intergenic
1068966658 10:62918565-62918587 ATTGAAGTGAAGCCCGGGGAGGG - Intronic
1069234438 10:66052388-66052410 CTTGAAATGAAGGATGGGGAAGG + Intronic
1070889063 10:79928577-79928599 GTTGTAATGGTGACTGGGGTTGG - Intergenic
1071343791 10:84672270-84672292 ATTGAATTGAAGAATGGGAAAGG - Intergenic
1071457856 10:85864515-85864537 TTTAACATGGAGAGTGGGGAAGG - Intronic
1072205016 10:93195894-93195916 TTTGAAATGCACACTCGGGAAGG + Intergenic
1072841506 10:98779339-98779361 ACTGAAATGGACACTTGGGTGGG + Intronic
1073547610 10:104364942-104364964 ATGGGAATAGAGACTGTGGAGGG - Intronic
1073926217 10:108519493-108519515 ATTGAAGATGAGACTGGGGTGGG - Intergenic
1075359055 10:121813327-121813349 GTTGAGATGGAGAATGAGGAGGG - Intronic
1075954583 10:126511447-126511469 CTTGAAATGGATAGTGGTGACGG - Intronic
1078382447 11:10857079-10857101 ATCCAAAAGGAGACTGTGGAAGG - Intronic
1078861218 11:15249043-15249065 AGTGACATGGAGTCTGGGCAGGG + Intergenic
1080133019 11:28818536-28818558 ATTCAAATTGTGACTGGTGAAGG - Intergenic
1080523328 11:33087838-33087860 ACTGAAAAGAAGACTGTGGATGG - Intronic
1081084333 11:38780563-38780585 ATTAAAATATAGACTGGGCACGG - Intergenic
1082299860 11:50492492-50492514 AGGGAAATGGGGAGTGGGGAAGG - Intergenic
1082685341 11:56231645-56231667 ATTGCAAAGGACACTGGTGAAGG + Intergenic
1083239827 11:61379532-61379554 ATTGTAATGCAGGCTGGGCACGG + Intergenic
1087013541 11:93535068-93535090 CGTGGATTGGAGACTGGGGAGGG - Intronic
1087279483 11:96194199-96194221 ATTGAACTGGAGGCTGGGGTGGG + Intronic
1087287223 11:96278014-96278036 ACAGAATTGGAGACTGGGGATGG - Intronic
1087290693 11:96317118-96317140 ACTGAAATGGTGCCTGTGGAAGG + Intronic
1089014869 11:115157596-115157618 AGTGGAAGGGGGACTGGGGAGGG + Intergenic
1089773732 11:120821437-120821459 ATGGAAAGAGAGGCTGGGGAAGG + Intronic
1090303451 11:125668845-125668867 AATAAAATGAAGGCTGGGGACGG - Intronic
1090499795 11:127250360-127250382 TTAGAAATGGAGAGTGGGGAAGG + Intergenic
1091217680 11:133913211-133913233 TTTGCAATGGAGATAGGGGAGGG - Intronic
1092078880 12:5697141-5697163 ATTGAAAAGGAGGCTGGGCATGG + Intronic
1092087889 12:5779345-5779367 ATTTAAATTGAGAATGGAGAAGG - Intronic
1093430729 12:19082091-19082113 ATGGAAATGGAGAATGGTAAAGG + Intergenic
1093966379 12:25331411-25331433 ATTGCAATGGGGACTGGGCAGGG + Intergenic
1094341686 12:29419146-29419168 TTAGAAATGTAGACTGGGCATGG - Intronic
1095520690 12:43061602-43061624 ATTGAAAGGGAGCCTGTGGAAGG - Intergenic
1095592243 12:43916157-43916179 AATGGAATGGAGAGAGGGGAGGG + Intronic
1096604734 12:52756476-52756498 ATTGAAATGGGAACTGTGGAGGG + Intergenic
1097227912 12:57489570-57489592 CTTGAGATGAGGACTGGGGAAGG + Intronic
1098082933 12:66808797-66808819 ATTGAATTGGACCCTGGGGAGGG - Intergenic
1098558993 12:71851401-71851423 AAGGAAATGGAGATTTGGGAGGG - Intronic
1099341874 12:81447573-81447595 ATTGAAATAGAGACTTGCGGAGG - Intronic
1101254219 12:102961797-102961819 AGAGAAATGGAGAGTGGGGGTGG - Intergenic
1101316982 12:103638294-103638316 ATTGAAAGGGAGAATTGGGATGG - Intronic
1101500442 12:105299172-105299194 ATTTAAAGTTAGACTGGGGAGGG + Intronic
1101897589 12:108768150-108768172 ATTGAAATGAAAACTGAGGCCGG - Intergenic
1102535558 12:113577923-113577945 ATGGAGATGGAGATTGGGGGAGG - Intergenic
1102594447 12:113981766-113981788 ATTGGAAGGGAGAATGGGGTGGG + Intergenic
1103295360 12:119881738-119881760 ACTGAAATGGAGGCCGGGCATGG + Intergenic
1103744266 12:123111475-123111497 AATGGAATGGTGGCTGGGGATGG + Intronic
1103749192 12:123147923-123147945 AATGAAAAGGAAAGTGGGGAAGG - Intronic
1103923842 12:124413089-124413111 ATTGAAATGGAGGCTGTGGTGGG - Intronic
1105488230 13:20859176-20859198 ACTGAAAAGGAGGCTGGGCACGG + Intronic
1105663281 13:22523439-22523461 ACTGATATGCAGACTGTGGAAGG + Intergenic
1106289228 13:28345091-28345113 AATAAAAAGGAGACTGGGCACGG - Intronic
1107377501 13:39820530-39820552 ATTGAAAAGGAGGCTTAGGAAGG - Intergenic
1107984584 13:45764546-45764568 GGTGAAATGGAAACTGGGGCAGG + Intergenic
1108104753 13:46997270-46997292 ATGGAAATAGGGAGTGGGGATGG - Intergenic
1108424883 13:50289477-50289499 CTTGAATTGGAGGATGGGGAGGG + Intronic
1110449598 13:75626513-75626535 ATTGAAATTGAGATTTGGGTGGG + Intronic
1113401933 13:110002311-110002333 AATGACATGGAGCCTGGGGGTGG + Intergenic
1115152180 14:30298185-30298207 CTTGAAATGCAGACTCGGGCAGG - Intergenic
1115752672 14:36506995-36507017 AAAGAAATGGAAAATGGGGAAGG + Intronic
1115833889 14:37375473-37375495 ATTAAAAAGGAGGCTGGGCATGG - Intronic
1116975436 14:51110446-51110468 TGTGAAATGGAGACAGGGCACGG + Intergenic
1117226551 14:53666624-53666646 ATTGAAGATGAGACTGGGAAGGG - Intergenic
1117297121 14:54390827-54390849 ATTGGGATGGAGACAAGGGATGG - Intergenic
1117297918 14:54395924-54395946 AGTTAAATGGGGACTGGAGAAGG + Intergenic
1118078560 14:62330016-62330038 ATGGTAATGGAGGCGGGGGAAGG - Intergenic
1118290246 14:64514043-64514065 ATTGAAATGGAGGGTGGAGAAGG - Intronic
1118736601 14:68705624-68705646 ATTGATGGGGAGAATGGGGAAGG - Intronic
1119461399 14:74807389-74807411 ATTAAAATAGAGACTAGGCATGG + Intronic
1119526971 14:75330580-75330602 TTTCATATGGAGACTTGGGATGG + Intergenic
1120721538 14:87894390-87894412 ATTGATAGGGAGAATGGAGAAGG + Intronic
1121027976 14:90630570-90630592 CTGGAAATGGAGGCTGGTGATGG - Intronic
1121086551 14:91150882-91150904 CTGGAAATGGAGAGTGGTGATGG - Intronic
1121097360 14:91226967-91226989 ATTGAGAAGGAGGCTGGGCATGG + Intergenic
1122217287 14:100212794-100212816 ATTGAAATGGGCCCTAGGGATGG + Intergenic
1122667017 14:103337312-103337334 AATGTAAGGGAGACTGGGCACGG + Intronic
1122916161 14:104859944-104859966 GTCGAAATGGAGAGTGGTGATGG - Intergenic
1123184405 14:106502595-106502617 ATGTCCATGGAGACTGGGGATGG - Intergenic
1124996500 15:34728068-34728090 ATTTAGATGGAGAATGGGGAGGG - Intergenic
1125715667 15:41818639-41818661 ACTGAAATGGAGAGAGGGGAGGG - Intronic
1125800140 15:42438498-42438520 ATAGAATAGGAGAATGGGGAGGG - Intronic
1125927948 15:43578592-43578614 ATATAAATGGAGGCTGGGCATGG + Intronic
1125941091 15:43678163-43678185 ATATAAATGGAGGCTGGGCATGG + Intergenic
1125943769 15:43696836-43696858 GTTCAGAGGGAGACTGGGGAAGG + Intronic
1126234904 15:46372611-46372633 ATAGAAATGGAGACTCCAGAAGG + Intergenic
1126700852 15:51366366-51366388 CTTGAACTGAAGACTGGGCAAGG + Intronic
1127112077 15:55685095-55685117 TTTGAACTGGAATCTGGGGAGGG - Intronic
1127997469 15:64161982-64162004 AGTGAAATTGGCACTGGGGATGG - Intronic
1128277034 15:66362430-66362452 AGAGAAATGGAGGCTGGGCACGG + Intronic
1128284232 15:66423089-66423111 TTTTAAATGGAGGCTGGGCACGG - Intronic
1128751894 15:70155922-70155944 GTTGAAGTGGAGGCTGGGGACGG + Intergenic
1129182356 15:73885285-73885307 ACTGAAGTGGAGAAGGGGGATGG + Intronic
1129786315 15:78312593-78312615 ATAGAGGTGGAGACTGGGGGAGG - Intergenic
1130982677 15:88823533-88823555 TTTGCAATTGAGAGTGGGGAGGG + Intronic
1131161298 15:90106659-90106681 ATTGGGATAGAGCCTGGGGAAGG + Intergenic
1131641082 15:94294715-94294737 TTTGGAAGGGAGACTGGGAATGG - Intronic
1131851755 15:96550883-96550905 ATAGATATGGTCACTGGGGAGGG - Intergenic
1133924962 16:10184583-10184605 GCTGAAATGGAGACAGGAGAGGG + Intergenic
1134239925 16:12498052-12498074 AGGGAAAGAGAGACTGGGGAAGG + Intronic
1134759902 16:16705092-16705114 AATGAAATGCAGGCTGGGCATGG + Intergenic
1134986170 16:18654113-18654135 AATGAAATGCAGGCTGGGCATGG - Intergenic
1135089311 16:19500287-19500309 ACTGAAGTGGAGACAAGGGATGG - Intergenic
1135708795 16:24697743-24697765 TTAGAAATGCAGACTGGGGCCGG + Intergenic
1136517090 16:30774797-30774819 AGAGAAATGGAGATTGGGAAGGG - Exonic
1137926937 16:52548531-52548553 CGTTAAATGGAGACTAGGGAGGG - Intergenic
1138704934 16:58905768-58905790 ATTTTAATGGACAATGGGGAAGG + Intergenic
1139518678 16:67467013-67467035 AGGGAATTGGAGACTTGGGAGGG - Intronic
1139909027 16:70385441-70385463 CTGGAAATGGAGAGTGGTGATGG + Intronic
1140553406 16:75892669-75892691 TTTGAAAGAGAGACTGGGGCTGG - Intergenic
1141117465 16:81322401-81322423 ATTGAAATGGAGGCTCCAGAAGG - Intronic
1141582158 16:85007131-85007153 AATGGAATGGAGGCTGGGCAAGG + Intronic
1141963419 16:87424782-87424804 ATTGAGATGGACAGAGGGGATGG + Intronic
1144612857 17:16739394-16739416 AGTGAAAAGGAGGCTGGGCATGG - Intronic
1144693690 17:17286711-17286733 ATAGAAATGGAGAATGTGGAAGG - Intergenic
1144899928 17:18576193-18576215 AGTGAAAAGGAGGCTGGGCATGG + Intergenic
1145132516 17:20369472-20369494 AGTGAAAAGGAGGCTGGGCATGG - Intergenic
1146970646 17:37068889-37068911 AAAAAAATGGAGACTGGGCATGG - Intergenic
1147550794 17:41440107-41440129 ATTGGGATGGAGGGTGGGGAAGG + Intronic
1147749232 17:42718392-42718414 AAGGAAATGGTGGCTGGGGATGG + Intronic
1148486001 17:47991405-47991427 ATTGCCATGGAGATTGGGGGAGG - Intergenic
1148918050 17:51000724-51000746 ATTGAGATGGAGTCTTGTGATGG - Intronic
1149332259 17:55596254-55596276 ATTTAAATGGTCACTGGGCATGG - Intergenic
1149690145 17:58568586-58568608 ATTGTTATGGAAACTGGGGCAGG - Intronic
1149747724 17:59115346-59115368 ATTTAAATTTAGACTGGGCATGG - Intronic
1149862095 17:60127672-60127694 AGTGGAAGGGAGATTGGGGAAGG + Intergenic
1150737011 17:67749608-67749630 ATTGAAACTGAGGCTGGGCATGG - Intergenic
1151165331 17:72198480-72198502 GTGGTAATGGAGAGTGGGGAGGG - Intergenic
1151390605 17:73784471-73784493 AAGGAACTGGAGACAGGGGAAGG - Intergenic
1151656482 17:75498619-75498641 ATGGAAATGAAGACTGGGGAAGG - Exonic
1152428714 17:80235138-80235160 ATTCAAATTGAGGCTGGGCACGG - Intronic
1152503837 17:80733485-80733507 CTAGAAATGGAAACAGGGGAAGG - Intronic
1152524741 17:80881526-80881548 AATGAAAAGGAGGCTGGGTATGG + Intronic
1152637197 17:81435030-81435052 AGAGAAATGGGGGCTGGGGACGG - Intronic
1153749367 18:8212876-8212898 ATTGGAATGGAGACGGGTGGTGG - Intronic
1154094600 18:11400665-11400687 TTTGCAATAGAGACTGGGAAAGG - Intergenic
1154959289 18:21291759-21291781 AGAGAAATGGAGGCTGGGCATGG + Intronic
1155947470 18:31872127-31872149 ATAGACATTGAGACTTGGGAGGG - Intronic
1156696396 18:39773288-39773310 ATAGGAATGGAGACTGTGGCAGG - Intergenic
1157512052 18:48282862-48282884 ACTGAAATGGGGCCTGAGGATGG + Intronic
1157631022 18:49095865-49095887 ACTGCAATGGAGTCTGGGGAAGG - Intronic
1157928424 18:51791660-51791682 AGTGATATGTGGACTGGGGATGG - Intergenic
1158050572 18:53212960-53212982 ATTGAAAGGCAGGCTGGGCATGG - Intronic
1158389586 18:57034235-57034257 TTTGAAATGGAGCTTGGGGCTGG - Exonic
1158668543 18:59454612-59454634 ATTAAAATGGACACTAGGTAAGG - Intronic
1159909771 18:74134713-74134735 CTAGAAATGCAGACTAGGGATGG + Intronic
1160157607 18:76445452-76445474 AGTGAACTGGGGCCTGGGGAAGG - Intronic
1160177808 18:76610424-76610446 TTGGAAATGGAGAGTGGTGACGG - Intergenic
1160770908 19:830679-830701 AAGGAAATGGAGTCAGGGGAGGG - Intronic
1166072253 19:40394309-40394331 AGTGAGATGGTCACTGGGGAAGG - Exonic
1166317245 19:41996165-41996187 GTTGCCATGGAGACTGGGAAAGG + Intronic
1166419184 19:42622023-42622045 ATGAAAATGGAGTCTGGGCATGG + Intronic
1166810538 19:45511804-45511826 ATTGAAATGGTGGCTGGGCCTGG + Intronic
1166836564 19:45670984-45671006 TTTGGGATGGAGACTGGGAAGGG + Intronic
1167228156 19:48263845-48263867 AATGAAATGCAGGCTGGGCACGG + Intronic
1168072069 19:53958952-53958974 AATGAAATGGAGAGCGGGTAGGG - Intergenic
926423477 2:12719628-12719650 TTTGAAATGGTCACTGGGCACGG + Intronic
927466752 2:23342463-23342485 ATTGAATTGGAGAAAGGAGAAGG + Intergenic
927740679 2:25566780-25566802 ATTTCAATGGAGACAGGGGGTGG + Intronic
927775902 2:25902937-25902959 ATAGAAATGTAGGCTGGGCACGG - Intergenic
928213140 2:29338880-29338902 ATTGAAATGGAGACTGGGGAAGG - Intronic
928482883 2:31701012-31701034 ATTAAAAAGGAGACTGGGCACGG + Intergenic
928536690 2:32247990-32248012 ATAGACATGGAGACTTGGAAAGG + Intronic
929992644 2:46802722-46802744 AGTGAAATGAAGATTGAGGATGG - Intergenic
930016763 2:46976017-46976039 AATAAAATGGAGGCTGGGCACGG - Intronic
930138815 2:47930994-47931016 ATAGAGATGGATACTGGTGATGG + Intergenic
930979054 2:57499395-57499417 ATTGAAATGGACATTGTGTAAGG - Intergenic
931577838 2:63738141-63738163 AATGCAATGGGGACTGGTGAGGG - Intronic
931895737 2:66727487-66727509 ATTACAATGGAGACCGGGAATGG + Intergenic
932296607 2:70629116-70629138 AATGAAATGAAGGCTGGGCATGG + Intronic
932884827 2:75540101-75540123 ATAGGTATGGAGCCTGGGGAAGG + Intronic
933000355 2:76913827-76913849 ATTGAAATAGCGGCTGGGCATGG - Intronic
933215825 2:79629070-79629092 ACGGAAGTGGAGAGTGGGGAAGG - Intronic
933771707 2:85748834-85748856 GTGGAAAGGGAGAGTGGGGAGGG - Intergenic
934583809 2:95470743-95470765 CTTTAAAAGGAGACTGTGGATGG - Intergenic
934595643 2:95605971-95605993 CTTTAAAAGGAGACTGTGGATGG + Intergenic
934787133 2:97019509-97019531 TTTTAAAAGGAGACTGTGGATGG - Intergenic
935982397 2:108640241-108640263 AAGGACATGGAGCCTGGGGAAGG - Intronic
937130619 2:119509741-119509763 ATGGAAATGGATACTGGGGATGG - Intronic
937525251 2:122760601-122760623 GATGAAATGGAGGCTGGGGAGGG - Intergenic
937698321 2:124834570-124834592 ATGGCAATGGAGACAGGGGCTGG + Intronic
938386900 2:130873062-130873084 ATTCCCCTGGAGACTGGGGAAGG - Intronic
939010297 2:136838620-136838642 TTTGAAAGGGAGGATGGGGAAGG - Intronic
940394757 2:153175109-153175131 ATTGAAATTGAGTCTAGGGAAGG + Intergenic
940888458 2:159011958-159011980 TTAGGAATAGAGACTGGGGATGG - Intronic
941049039 2:160710688-160710710 AATAAAATGGAGACTGGGTATGG - Intergenic
941508141 2:166373425-166373447 ATTGATATGGAGGCTGTGGCAGG + Intronic
941782615 2:169461059-169461081 ATAAAAATGGTGACTGGGGAGGG + Intergenic
942073336 2:172335079-172335101 ATGCAAATGGGGCCTGGGGAGGG - Intergenic
942739126 2:179153951-179153973 AATGAAAACGAGACTGGGCACGG + Intronic
943172357 2:184418793-184418815 AATGAAATGGAGACTCAGAAGGG + Intergenic
943884473 2:193198038-193198060 ATTGTATTGGAGACTGTGGGAGG - Intergenic
944343259 2:198629666-198629688 ATAGAAATGGAGAAAGTGGACGG - Intergenic
944876927 2:203971918-203971940 ATTGAAATGGAGGCTTTGGGTGG + Intergenic
945975729 2:216269124-216269146 ATTGATATGGGGTCAGGGGAAGG - Intronic
946725051 2:222654093-222654115 CTAGAAATGGAGACTGGGATGGG + Intronic
947561586 2:231158646-231158668 CCTGGGATGGAGACTGGGGAGGG - Intronic
1169117259 20:3073573-3073595 ATTGAAACGTTGACTGGGCACGG - Intergenic
1169489857 20:6062224-6062246 ATTGGAAAGGAGAGTGGAGATGG + Intergenic
1169519827 20:6359041-6359063 ATTGGATTGAAAACTGGGGAGGG - Intergenic
1170326494 20:15160053-15160075 ATGTAAATGGAGACAGGGCATGG + Intronic
1170805046 20:19622159-19622181 ACTTGAAAGGAGACTGGGGATGG + Intronic
1171316519 20:24200369-24200391 ATTGAAGGGAAGACTGAGGAGGG - Intergenic
1172584404 20:36072397-36072419 AATGAAATGGAGAATAAGGAAGG + Intergenic
1173000859 20:39104648-39104670 ATCGAGATGGAAAATGGGGAAGG + Intergenic
1173019525 20:39255468-39255490 ATTAAAATTGAGGCTGGGCATGG - Intergenic
1173065464 20:39706430-39706452 TTTGTAATGGAAACTGGGGGTGG + Intergenic
1173865489 20:46309743-46309765 ATGGAGATGGAAATTGGGGAAGG - Intergenic
1174428388 20:50449553-50449575 ATAGAAGAGGATACTGGGGATGG - Intergenic
1175148939 20:56917858-56917880 ATGGGAATTGGGACTGGGGAGGG - Intergenic
1175196224 20:57245021-57245043 TTTGAAAGGGAGACAGGGGCTGG - Intronic
1175287677 20:57848386-57848408 ATTGACATGGAGAATGGGCTTGG - Intergenic
1175616640 20:60405359-60405381 TTTGGAATGGAGAAGGGGGAAGG + Intergenic
1178166042 21:29978790-29978812 ATTAAAATGGGGACTGAAGATGG - Intergenic
1179170885 21:38971905-38971927 ATAGAAACGGAGAGTAGGGAAGG - Intergenic
1180142916 21:45903161-45903183 AGGCATATGGAGACTGGGGAAGG + Intronic
1181826535 22:25520771-25520793 ATAGAAAGGCAGACTGGAGAAGG + Intergenic
1182008600 22:26981842-26981864 ATGCCAATGGACACTGGGGAGGG + Intergenic
1183035832 22:35140518-35140540 ATTCAAATTGAGGCTGGGCATGG + Intergenic
1183932597 22:41244843-41244865 CTGGAAATGGAGAGTGGTGATGG - Intergenic
1184124100 22:42474725-42474747 ATTTAAAAGGTGACTGGGGCTGG + Intergenic
1184204904 22:42995896-42995918 ATTTTTCTGGAGACTGGGGAAGG - Intronic
1185277771 22:49957144-49957166 ATTGGCTTGGAGACTGGGGGTGG + Intergenic
1185306418 22:50119820-50119842 ACTGAAATGGAGAGCTGGGAGGG + Intronic
1185358974 22:50393681-50393703 ATGGGAATGGTTACTGGGGAGGG + Intronic
949317640 3:2774311-2774333 GATGAAATGGAGATTGGGGTGGG - Intronic
949437592 3:4046365-4046387 ACTGCAAGGGAGACTGGGGCAGG - Intronic
949549358 3:5099435-5099457 ATTAAAATGCAGGCTGGGCACGG - Intergenic
949592375 3:5507943-5507965 ATGGAAAAGGAGACTCAGGAAGG + Intergenic
949940212 3:9148923-9148945 ATGAAACTGGAGACTGGGTATGG + Intronic
950029844 3:9845086-9845108 CTCAAAGTGGAGACTGGGGAGGG - Intronic
950210010 3:11116353-11116375 ATGGAAATGGTGACTGGGAGGGG - Intergenic
950894174 3:16433095-16433117 ATTAAAATGAAGTCTGGGAAAGG - Intronic
951125118 3:18975539-18975561 ATAGAAAGAGAGACTGGGGTAGG - Intergenic
951280897 3:20748137-20748159 ACTGATGTGGAGACTGTGGAAGG + Intergenic
951362021 3:21736703-21736725 ATAGAGAAGTAGACTGGGGAGGG + Intronic
951727668 3:25777828-25777850 CCTGAAATGGAACCTGGGGAGGG + Intronic
952009555 3:28884776-28884798 ATTGAAATGGAGCATATGGATGG + Intergenic
952174284 3:30844471-30844493 ATTCAAAGGGACAGTGGGGAAGG + Intronic
952247781 3:31614408-31614430 ATGGACAAGGAAACTGGGGAGGG - Intronic
952669182 3:35945696-35945718 TTTGAAAAGGAGGGTGGGGAGGG + Intergenic
952800431 3:37285606-37285628 ACTGAATTTGAGACTTGGGAAGG - Intronic
953299813 3:41762267-41762289 ATTGGAAGGGAGAGTGGGGGTGG - Intronic
953703069 3:45211455-45211477 ATGGAAATGGTTAGTGGGGAGGG + Intergenic
953803807 3:46050815-46050837 CTTGAAATGGCCACTGGGGAAGG + Intergenic
953942300 3:47110886-47110908 AGGGGAAAGGAGACTGGGGAAGG - Intronic
954156444 3:48687424-48687446 ATTGCAATGGGGACTAGGGCTGG + Intergenic
955485173 3:59427890-59427912 ATTGAAATGGGGATCAGGGAAGG + Intergenic
955547399 3:60045808-60045830 ACTGAAATGGAGAATGGATAAGG + Intronic
955993993 3:64659175-64659197 ACTTAAATGGAGGCTGGGCACGG + Intronic
956257702 3:67302094-67302116 ATTAGAATGGAGGCTGGGGGGGG - Intergenic
956638783 3:71394808-71394830 ATTGAACTGGAGGCTGGGCGCGG + Intronic
957303282 3:78421084-78421106 ATTCTAATAGGGACTGGGGAGGG + Intergenic
957515629 3:81247309-81247331 ACAGGAATGGGGACTGGGGAAGG - Intergenic
957576003 3:82009217-82009239 ATTGGACTGGAAAGTGGGGAGGG + Intergenic
960811971 3:121634451-121634473 CTTGGATTGGAGAGTGGGGAAGG + Intronic
960974695 3:123162792-123162814 CTTTAAAGGGAGATTGGGGAGGG - Intronic
961351230 3:126305629-126305651 ACTGCAAGGGAGACTGGGAAAGG + Intergenic
962784852 3:138758307-138758329 CTGGAAATGGATACTGGTGATGG + Intronic
963205606 3:142631084-142631106 AATGAAATTGAGACTGGGCATGG + Intronic
963493698 3:146033555-146033577 ATTGAGATGAAAACTGGGGGAGG + Intergenic
963503407 3:146156890-146156912 GGTGAAATGGAGATTTGGGATGG - Intronic
963524004 3:146393316-146393338 ATAGAAATGTAGGCTGGGCACGG - Intronic
963806915 3:149732145-149732167 ACTGAAATGGAGACAAGAGAGGG + Intronic
963988563 3:151626811-151626833 AGTGAAATGGTGAGTGGAGAAGG + Intergenic
964228161 3:154431000-154431022 GTTTAAATGGAAACAGGGGAAGG + Intergenic
964813731 3:160694339-160694361 AGGGAAATAGAGACTAGGGAAGG + Intergenic
967676323 3:192302903-192302925 ACTGAAATAGATGCTGGGGAAGG - Intronic
967691375 3:192477621-192477643 ATTGAAATGGAGAATGGGAGTGG + Intronic
967754028 3:193148244-193148266 ATTCAACTGCACACTGGGGATGG + Intergenic
968587296 4:1426077-1426099 ATTGAAGAGGAGGCTGGGGCGGG - Intergenic
969251570 4:5971834-5971856 ATTGAAATGTTCACTGGGGTTGG - Intronic
969861545 4:10039727-10039749 ATTGGACTGGAGAGTGGAGATGG - Intronic
970244611 4:14046855-14046877 GTTACAATGGAGACTGTGGAAGG + Intergenic
970348915 4:15181344-15181366 ATTGGAATTGACACTGTGGAAGG + Intergenic
972066283 4:34949667-34949689 ATTGAAATGAAGTCTGGGAGTGG + Intergenic
972067999 4:34976184-34976206 ATGGAAATGGAGACTGAGGAGGG + Intergenic
972202196 4:36726596-36726618 ATTAAAATGGAGACCAGGGCCGG - Intergenic
972937261 4:44152307-44152329 ATTGAAATGGATACTGGTTCTGG - Intergenic
973931669 4:55799303-55799325 ATTGAGATGGATAGTGGTGATGG + Intergenic
974887585 4:67839532-67839554 ATTTACATAGAGACTGGAGATGG + Intronic
976332377 4:83847022-83847044 ATTAAAATGTACACTAGGGAGGG - Intergenic
976422224 4:84858994-84859016 AAAGAAATGGAAACAGGGGAAGG + Intronic
976894037 4:90085635-90085657 CTGGAAATGGAGAGTGGTGATGG - Intergenic
977067811 4:92341481-92341503 ATTGCAATGTAGGCTGTGGATGG - Intronic
977383839 4:96312091-96312113 ATTGAAATGTGTGCTGGGGAGGG + Intergenic
977463423 4:97355235-97355257 GTAGAAAAGGAGACTGGGCACGG + Intronic
977989760 4:103426879-103426901 AGTGAAATTGAGAATGGGAATGG + Intergenic
978278734 4:106984274-106984296 CTAGAAATGGAGAGTGGTGATGG - Intronic
979529692 4:121756595-121756617 ATAGAAATGGAGTGTGGGGTTGG + Intergenic
980843758 4:138299408-138299430 ATTGAAATCATGACTGTGGAAGG - Intergenic
981093645 4:140757078-140757100 AATGGAATGGAGAGGGGGGAGGG - Intergenic
981104371 4:140864013-140864035 ACTGAAATGGCCACTGGGCATGG + Exonic
981630502 4:146813689-146813711 AATGAAATAGAGGCTGGGCATGG + Intronic
981774177 4:148346083-148346105 GCTGAAATGGAGAGAGGGGAGGG + Intronic
981830095 4:148989499-148989521 CTGGAAATAGAGCCTGGGGAAGG + Intergenic
983413074 4:167423037-167423059 ACTGAAAGGCAGACTGGAGAGGG + Intergenic
983752502 4:171293598-171293620 ATAGAAATGGAGGCTGAGTAAGG + Intergenic
985363853 4:189205646-189205668 ATTGAAATTGTGGCTGGGCATGG + Intergenic
985720633 5:1486835-1486857 CTGGAAATGGAGACGGGGAAAGG + Intronic
986477712 5:8152775-8152797 ATTTAAATGGGGCCAGGGGATGG + Intergenic
987546111 5:19312131-19312153 ATAGAAGTGAAGACTGTGGAAGG - Intergenic
987783668 5:22470706-22470728 ATAGAAAAGAAGACTGGGCAAGG - Intronic
987878363 5:23710468-23710490 ATTGGCATGGAGCCAGGGGATGG + Intergenic
988203233 5:28097171-28097193 AATGAAATGGTGGCTGGGGATGG - Intergenic
989286960 5:39711995-39712017 ATAGAAACAGAGACTGGAGATGG - Intergenic
989959668 5:50396758-50396780 ATAGAAAAGGAGACTGAGGTAGG + Exonic
991349342 5:65704749-65704771 ATTGAGATGGTGATTAGGGAGGG - Intronic
991498820 5:67255421-67255443 ACTTTAATGGAGAATGGGGAGGG + Intergenic
991719738 5:69484301-69484323 ATAGAAATGTTGACTGGGCATGG - Intergenic
991941609 5:71858434-71858456 ACGGAAATGGTGACTGGGAAAGG + Intergenic
992878061 5:81077217-81077239 CTTGAAATTGAGACAGGGAAGGG + Intronic
993854367 5:93055158-93055180 ATAGAGATGGAGAATGGGAATGG - Intergenic
993907382 5:93638520-93638542 ATAGAAATGCAGGCTGGGCACGG + Intronic
994094840 5:95839268-95839290 GGGGAAATGGAGACTGGGGTTGG + Intergenic
996114944 5:119607789-119607811 ATTAAATTGGAGTCTGGGGATGG - Intronic
996893585 5:128453716-128453738 GCTGAAATGCAGAGTGGGGAAGG + Intronic
996963205 5:129276181-129276203 ATAGAAAAGGAGGCTGGGCATGG - Intergenic
997050649 5:130375735-130375757 ATTGAAATTGAGGCTTGGGTGGG + Intergenic
1000931547 5:167257941-167257963 AATGAAATGAAGACTAGGAAAGG + Intergenic
1003937611 6:10991858-10991880 AGTGAAATGGTGACTGTGGAAGG - Intronic
1004069460 6:12285228-12285250 ATTTAAATAGAGAGTGGGAAGGG + Intergenic
1004324977 6:14666226-14666248 AGTGGGTTGGAGACTGGGGAAGG - Intergenic
1004489211 6:16098175-16098197 ATTGCAAAGGAGACTGGGAAAGG + Intergenic
1005071490 6:21866301-21866323 GGTGAAATGGACACTGGGAATGG + Intergenic
1005429090 6:25735299-25735321 AATGAAATGGAGAATGAGCAAGG + Intergenic
1005648294 6:27863459-27863481 ATTAAAATGGAGAAAGAGGAAGG - Intronic
1005965524 6:30723838-30723860 AAAGAAATGGAGACGTGGGAAGG - Exonic
1006133904 6:31884318-31884340 GATGCAATGGAGCCTGGGGAGGG + Intronic
1006177576 6:32131621-32131643 CCTGGAATGGAGACTGGGGGCGG + Intergenic
1006553117 6:34841363-34841385 ATAGAAATATAGACTGGGGCTGG - Intronic
1006660799 6:35642260-35642282 GTTGAAATTGAGACTGGGCTAGG - Intronic
1007419030 6:41708229-41708251 GTGGAACTGGCGACTGGGGAAGG + Intronic
1007825634 6:44598757-44598779 ATTGAAAAAGAGACGAGGGAGGG + Intergenic
1008705432 6:54152636-54152658 ATTCAAATTGAGATTTGGGAGGG + Intronic
1008851519 6:56028052-56028074 ATTGAAATGAGGGGTGGGGATGG + Intergenic
1009941754 6:70298079-70298101 GTTGACAAGGAGACTAGGGATGG - Intronic
1009975406 6:70666508-70666530 ATTTAGATGGGGACTGGGGAGGG - Intergenic
1010162624 6:72875894-72875916 ATAGAAATGTAAACTGAGGAAGG - Intronic
1010949977 6:82024116-82024138 ATGCAAATGGAGAGTGGTGATGG - Intergenic
1012154930 6:95807063-95807085 TTAGGAATGGAGAGTGGGGAAGG - Intergenic
1012307112 6:97672386-97672408 ATTGCAATGGAGAGAGGGGGAGG - Intergenic
1015966874 6:138703069-138703091 AATGAAATGCAGACTGGGCATGG + Intergenic
1016706662 6:147116712-147116734 AAGGAAATTGAGGCTGGGGAGGG - Intergenic
1017128732 6:151090286-151090308 AGGGAAAGGGAGACTGGGGGTGG - Intronic
1018182316 6:161234823-161234845 ATTGAACTGGACACTGAAGAAGG - Intronic
1018511381 6:164527828-164527850 ATGGCAATGGACACTGTGGATGG - Intergenic
1019397429 7:829304-829326 GATGTAATGGAGACTGGGAATGG + Intronic
1020348428 7:7190636-7190658 CTTGAAAGGGGAACTGGGGAAGG - Intronic
1020438013 7:8186547-8186569 ATACAAATGGAGACAGGGGATGG + Intronic
1021172548 7:17415294-17415316 TTGGAAATAGAGACTAGGGAGGG - Intergenic
1022673335 7:32476383-32476405 ATTTAAAGGCAGCCTGGGGATGG - Intergenic
1022676641 7:32506615-32506637 ATTGAAAATGAAACTGGGCAAGG + Intronic
1024432408 7:49303993-49304015 ATTCATATGGAGGCTGGGCATGG - Intergenic
1024479085 7:49845490-49845512 ACTGAAATGTAGAATGGTGAAGG + Intronic
1025910195 7:65822226-65822248 AAAGAAATGGAGGCTGGGCATGG - Intergenic
1026256013 7:68712015-68712037 ATTAAAATGGAGCCTGCAGATGG - Intergenic
1026715400 7:72784846-72784868 ATTGAATTGGAGAATGGGTTAGG - Intronic
1026863481 7:73809043-73809065 AGGGAAATGGCAACTGGGGAGGG - Intronic
1027428522 7:78085981-78086003 ATAGAAATGGAGGCTCCGGAAGG - Intronic
1027760824 7:82277034-82277056 AGAGAAATGGAGGCTGGGCAGGG - Intronic
1028254091 7:88570791-88570813 ATTAAAAAAGATACTGGGGATGG - Intergenic
1030222314 7:107109993-107110015 ACTGAAATGGCCACTGAGGAGGG + Intronic
1030503416 7:110388004-110388026 AATGATTTGGAGACTAGGGAAGG + Intergenic
1030796357 7:113792513-113792535 AATGAAATAGAGGCTGGGGCAGG - Intergenic
1031297525 7:120021500-120021522 GTTGAAAGTGGGACTGGGGATGG - Intergenic
1032116956 7:129125796-129125818 TTAGAAATGGAGTCTGAGGAGGG + Intergenic
1032494584 7:132351613-132351635 ATTGTAATGGAGAAGGTGGATGG - Intronic
1032977931 7:137247001-137247023 TTTGAATTGGACACTGGGGTAGG - Intronic
1034465461 7:151226003-151226025 ATAGAAATGGAAACTGAGAAAGG + Intronic
1035068766 7:156125957-156125979 TTGGAAATTGAGACTGGAGAAGG - Intergenic
1035818382 8:2564791-2564813 GTTGAAAGAGAGAGTGGGGATGG + Intergenic
1035960043 8:4126558-4126580 TGTGGGATGGAGACTGGGGACGG + Intronic
1036414629 8:8535578-8535600 ATGGAAAAAGAGACTGGGGTGGG + Intergenic
1036581658 8:10081051-10081073 ATTAAAATGGAGGCAGGGCAGGG + Intronic
1036767687 8:11559084-11559106 ATTGAATAGGAGACAGCGGAGGG - Intronic
1038278710 8:26143336-26143358 ATTGATGTGGAGAATGGTGATGG - Intergenic
1038717063 8:30000564-30000586 ATTGGAATGGAGGCTGGGCCGGG - Intergenic
1038757222 8:30352783-30352805 AAAGAAATGGAGACGTGGGAAGG - Intergenic
1039020531 8:33199915-33199937 ATAGAAATAGAGACTGAGAAGGG + Intergenic
1039438542 8:37578484-37578506 TTTGAAAGGGAGAGTGGAGAGGG - Intergenic
1039453239 8:37692460-37692482 ATTGAACTGGAGGCTGGGGAAGG + Intergenic
1040012520 8:42674308-42674330 ACTCACATGGTGACTGGGGAAGG - Intergenic
1040385762 8:46914115-46914137 ATTAGCAGGGAGACTGGGGAGGG - Intergenic
1040607843 8:48952093-48952115 TTTGAAATGGTCACTGGGCATGG + Intergenic
1040629265 8:49190808-49190830 AAAGAAAGGGAGAGTGGGGAGGG - Intergenic
1040706776 8:50137785-50137807 ATTGCACTGGACACTGAGGATGG + Intronic
1040838044 8:51753191-51753213 ATTGAAATGGACAATGGAAAGGG - Intronic
1040856829 8:51957298-51957320 ATTAAAATGGAGAATGGAGGAGG + Intergenic
1041938230 8:63358155-63358177 AATGAAAGGAAGACTGTGGAAGG - Intergenic
1042386339 8:68179488-68179510 ATTGAAAACAACACTGGGGAAGG + Intronic
1042695856 8:71554691-71554713 ATTGGATAGGAGACTGGGGGAGG + Intronic
1042778803 8:72467224-72467246 ATTGAAAGGATGACTGAGGATGG - Intergenic
1044244658 8:89928494-89928516 AGAGAAATGGTGTCTGGGGAAGG + Intergenic
1044406434 8:91832214-91832236 ATTGAATTAGAGACTGGAGTGGG + Intergenic
1044449486 8:92317524-92317546 TTAGAAATGGAGCCTGGAGATGG + Intergenic
1045228520 8:100276403-100276425 TTAGGAATGGGGACTGGGGAGGG + Intronic
1045601286 8:103720064-103720086 ATTGAAATGAAGGGTGTGGAAGG + Intronic
1045837088 8:106535259-106535281 ATCGCCTTGGAGACTGGGGAAGG - Intronic
1045857606 8:106782050-106782072 TCTGCAATGGAGACTGAGGAAGG + Intergenic
1046595988 8:116261729-116261751 ACTGCAAAGGAGACTGAGGAAGG + Intergenic
1046703995 8:117430179-117430201 ATTGAAGTGGGTCCTGGGGATGG + Intergenic
1048891277 8:138950366-138950388 TTTTAAATGGGGGCTGGGGAAGG - Intergenic
1049780424 8:144426267-144426289 ACTGAAATGGAGACTGGGACTGG - Intronic
1050631753 9:7566768-7566790 ATTGACATGAAGATTGGGGGTGG - Intergenic
1051451984 9:17207162-17207184 ATTGCAATGGAAACAGGAGAAGG - Intronic
1053242993 9:36511717-36511739 ATAGAAATGCAGGCTGGGCATGG - Intergenic
1054864671 9:69987852-69987874 ATTGATATGCATATTGGGGAGGG - Intergenic
1054944618 9:70782985-70783007 ATTTAAATAGAGACTGAGCATGG - Intronic
1055409828 9:76017179-76017201 TGGGAAATGGAGCCTGGGGAGGG - Intronic
1055514904 9:77024138-77024160 AACGAAGTGGAGACTGGAGAAGG + Intergenic
1056688032 9:88782848-88782870 CTGGAAATGAAGAATGGGGAAGG + Intergenic
1058459614 9:105170800-105170822 GTGGAAATGGAAACAGGGGAAGG + Intergenic
1058763774 9:108161877-108161899 TTCAAAATGGAGACAGGGGAGGG + Intergenic
1059178865 9:112193020-112193042 ATTGCTAGGGAGGCTGGGGAAGG - Intergenic
1059202845 9:112434113-112434135 GCTGAAATGGAGGGTGGGGAAGG + Intronic
1059266032 9:113031470-113031492 ATGGAGATGGAGAATGGTGATGG + Intergenic
1059471268 9:114506040-114506062 CTTGCAATGGAGACTGGGAAGGG - Intergenic
1060566339 9:124595748-124595770 CATGAAATGGAGACATGGGAAGG - Intronic
1060692510 9:125676675-125676697 ATGGAAATGGACAGTGGTGACGG + Intronic
1061004029 9:127918288-127918310 TTTGAAATGGAGACCAGGGCAGG - Intergenic
1061107512 9:128543091-128543113 AATGGAATGAACACTGGGGACGG + Intergenic
1061459246 9:130723098-130723120 ATTAAAATGGCTACTGAGGATGG + Intronic
1061797028 9:133091699-133091721 ATGGAAATAGAGAGTGGTGATGG - Intergenic
1062632632 9:137472294-137472316 AATGAGATGGAGGCTGGGTACGG + Intronic
1185747101 X:2582569-2582591 ATTTTAATGGAGAATGTGGAGGG + Intergenic
1186224160 X:7379326-7379348 ATTGAGGTGGAGAGTGGGGAGGG + Intergenic
1186590202 X:10922294-10922316 ATTGGAATGGAGAGGGGGAAGGG + Intergenic
1186927821 X:14354645-14354667 GTTGTCATGGTGACTGGGGAAGG + Intergenic
1187206389 X:17185685-17185707 GTTGGAATGGAGAGAGGGGAGGG + Intergenic
1187324339 X:18272759-18272781 AATGGATTAGAGACTGGGGAAGG + Intronic
1188308687 X:28589650-28589672 ATTGAAATGATGACTGTGAACGG + Intronic
1188331633 X:28878912-28878934 GTTGAAATTGAGACTTGGAAAGG + Intronic
1188372532 X:29386409-29386431 ATTGAGAGGCAAACTGGGGAAGG - Intronic
1188737048 X:33729901-33729923 AATGGGATGGAGAGTGGGGATGG - Intergenic
1188948118 X:36333716-36333738 CTTGAAATGGAGATTATGGAGGG - Intronic
1189182459 X:39017105-39017127 ATTAGCATGGAGAGTGGGGAGGG - Intergenic
1189706302 X:43762254-43762276 ATTGGAATAGCCACTGGGGAAGG - Intergenic
1190109297 X:47579575-47579597 TTTGAAATGGAGAGTGGGAGGGG - Intronic
1190233150 X:48597726-48597748 GTTGCTATGGCGACTGGGGAGGG + Intronic
1190700079 X:52981299-52981321 CCTGAAATGGAGACTTGGGCTGG - Intronic
1190842190 X:54155536-54155558 ATTGAAAAGCAAACAGGGGAAGG + Intronic
1191701380 X:64046299-64046321 ATTGAAATGGAGAGAGAGTATGG + Intergenic
1192106820 X:68325845-68325867 ATGGATATGGAGACGGGAGATGG - Intronic
1192106824 X:68325864-68325886 ATGGACACGGAGACTGGAGATGG - Intronic
1192116629 X:68417871-68417893 ATTGAATTGGCCACTGGGCAAGG - Intronic
1192445574 X:71208658-71208680 AATAAAAGGGAGACTGGGCATGG + Intergenic
1193262150 X:79420700-79420722 CTTGAAATGGATAATGGTGATGG - Intergenic
1194398866 X:93419087-93419109 GTTGCAAGGGAGACAGGGGAAGG + Intergenic
1194985134 X:100481980-100482002 AATGAATTGGATACTGGGGATGG - Intergenic
1196286598 X:113888841-113888863 ATTGAAATGGGGGTTGGAGAGGG - Intergenic
1197540474 X:127753692-127753714 AATGAAATGGAAAGTGGGGAAGG - Intergenic
1197784950 X:130189929-130189951 ATTAAAATGGAGGCTGGGCGTGG - Intergenic
1198193799 X:134339147-134339169 CTGGAAATGGAGACTGGTGATGG + Intergenic
1198452499 X:136781251-136781273 AGTGAAAAGGATGCTGGGGAGGG + Exonic
1199479686 X:148284474-148284496 ATGGAAATGGTGGCTAGGGAAGG + Intergenic
1199547553 X:149022207-149022229 CTTGAAATGAGGACTTGGGATGG + Intergenic
1200076041 X:153551644-153551666 CTGGAATTGGAGACTGGTGATGG + Intronic
1200827170 Y:7657692-7657714 ACTGAAATGGGGAGTGGGGGTGG - Intergenic
1201593641 Y:15641935-15641957 ATTGAGATGGAGAGTGGGGAGGG + Intergenic
1201690194 Y:16755138-16755160 TTTGAAAAGGACACTGGGTAAGG + Intergenic