ID: 928214989

View in Genome Browser
Species Human (GRCh38)
Location 2:29353974-29353996
Sequence CTCTTGTGCTTAAGGACCAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 96
Summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 87}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
928214989_928214992 -10 Left 928214989 2:29353974-29353996 CCTTTGGTCCTTAAGCACAAGAG 0: 1
1: 0
2: 1
3: 7
4: 87
Right 928214992 2:29353987-29354009 AGCACAAGAGAGCCTGAGGCTGG 0: 1
1: 0
2: 6
3: 66
4: 857
928214989_928214993 -9 Left 928214989 2:29353974-29353996 CCTTTGGTCCTTAAGCACAAGAG 0: 1
1: 0
2: 1
3: 7
4: 87
Right 928214993 2:29353988-29354010 GCACAAGAGAGCCTGAGGCTGGG 0: 1
1: 0
2: 2
3: 21
4: 247
928214989_928214994 -8 Left 928214989 2:29353974-29353996 CCTTTGGTCCTTAAGCACAAGAG 0: 1
1: 0
2: 1
3: 7
4: 87
Right 928214994 2:29353989-29354011 CACAAGAGAGCCTGAGGCTGGGG 0: 1
1: 0
2: 4
3: 33
4: 428
928214989_928214996 8 Left 928214989 2:29353974-29353996 CCTTTGGTCCTTAAGCACAAGAG 0: 1
1: 0
2: 1
3: 7
4: 87
Right 928214996 2:29354005-29354027 GCTGGGGCATTTCTGTCACTTGG 0: 1
1: 0
2: 2
3: 13
4: 181

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
928214989 Original CRISPR CTCTTGTGCTTAAGGACCAA AGG (reversed) Intronic
901369549 1:8784933-8784955 CTCTACTGCTTAAGCAACAAAGG + Intronic
902894545 1:19469992-19470014 CTCTTGTGCTCAAGCCACAATGG - Intronic
905163482 1:36059269-36059291 TTCTTGTAATTAAGAACCAATGG - Exonic
906045344 1:42825817-42825839 TTCTTGTGCGTAAGGAGAAAGGG - Intronic
906504111 1:46364896-46364918 CACATGTGCATAAGGACCATGGG + Intronic
908178638 1:61581461-61581483 GTCTTCTTCTTAAGCACCAAGGG + Intergenic
909295902 1:73948501-73948523 TTCTTGTGCCTGAGGACCAAGGG - Intergenic
910005686 1:82393826-82393848 CTCTTTTGCTTAAAGACTTAAGG + Intergenic
912203502 1:107484477-107484499 ATCTTGTGCAAAAGTACCAATGG - Intergenic
912567607 1:110599527-110599549 CTCTTGTGCATAAGCCCAAAGGG - Intronic
921549422 1:216515515-216515537 CTGTTGTTCTTAAGGACAAATGG - Intronic
923804165 1:237240033-237240055 CTCTTGTGCTTAAGCACTAATGG - Intronic
1065779900 10:29157596-29157618 CTCTGGGGCTTAAGGCACAATGG - Intergenic
1066034024 10:31462532-31462554 CTTTAGTTCTTAAGGACCGATGG + Intronic
1070342184 10:75507821-75507843 CTTCTGTGCCTAAGGACAAATGG - Intronic
1071238758 10:83680499-83680521 CTCCTGTGCTTCAGCACCAGGGG - Intergenic
1072338939 10:94427388-94427410 CTCTGTTGCTTTAGGACCAATGG - Intronic
1077833584 11:5902569-5902591 GTCTTGGGCTTAAGGACTCAGGG + Intronic
1080957818 11:37121242-37121264 CTCATTTTCTTAAGGACAAAGGG - Intergenic
1082089911 11:48080836-48080858 CTCTTGGCCTTAGGGCCCAAGGG - Intronic
1082210452 11:49495184-49495206 CTCTTGTGCTTGCAGTCCAAGGG + Intergenic
1082915289 11:58427884-58427906 CTCTCAGACTTAAGGACCAATGG + Intergenic
1085242869 11:75073154-75073176 CTCTTGCGCTAAAGGACCCCCGG + Intergenic
1086192441 11:84095466-84095488 CCCATGTCCTTAAGGACTAATGG + Intronic
1086922344 11:92601767-92601789 CTCTGGTGCAGAAGGACAAACGG - Intronic
1088133672 11:106527249-106527271 CTCTTTGGCCTAAGGACAAAAGG - Intergenic
1092974784 12:13734140-13734162 CTCATGTGATTAAGTACCTATGG - Intronic
1097030344 12:56085317-56085339 CTCTATTGCTTAGGGAGCAATGG - Intronic
1098029689 12:66240974-66240996 GTCTTATGTTTAAGGTCCAAGGG + Intronic
1101052856 12:100881854-100881876 CTCTTGTGATACAGGCCCAAAGG + Intronic
1101402021 12:104396848-104396870 TTTTTCTGCTTAATGACCAATGG - Intergenic
1101543760 12:105690027-105690049 CTCTTCTGCTTAAGTCCCATTGG - Intergenic
1104235933 12:126936633-126936655 CTCTTGGGCTTCAGGGCCACAGG - Intergenic
1106218708 13:27726301-27726323 CTTATTTGCTTAAGAACCAATGG - Intergenic
1112157171 13:96830892-96830914 GGCTTGTGCTAAAGGACAAAAGG + Intronic
1127040927 15:54975536-54975558 CTCTTGTGATTAAGCACGTAGGG + Intergenic
1127849691 15:62901891-62901913 TTCCTGTGCCTAAGGACCCACGG + Intergenic
1138941490 16:61795976-61795998 TCCTTGTGCTTAAAGAGCAAAGG - Intronic
1142956782 17:3528092-3528114 ATCTTGTGCGTCAGGGCCAAGGG + Exonic
1145886332 17:28384774-28384796 ATCTTGTGCTCGAGGTCCAAGGG + Intronic
1157417826 18:47520825-47520847 CTCTTGCTCTCATGGACCAATGG - Intergenic
1160097296 18:75886580-75886602 CTTTTGTGCTTCAAGACCTAAGG - Intergenic
1163581032 19:18138862-18138884 CTGGTGTGTTTAAGGACCACGGG - Intronic
1166640729 19:44493068-44493090 TTCTTGTGCGTGAGGACTAAAGG - Intronic
928214989 2:29353974-29353996 CTCTTGTGCTTAAGGACCAAAGG - Intronic
928867793 2:35938240-35938262 CTTTTGTGCTAAAAGACCACAGG + Intergenic
929953663 2:46437780-46437802 CTCTTGTTCTAAAGTATCAATGG - Intronic
930257151 2:49105472-49105494 CTTTTGTGCTTAAAAAACAAAGG + Intronic
933569768 2:83995866-83995888 CAATTCTGCATAAGGACCAAGGG + Intergenic
941442128 2:165551452-165551474 CACTTGTGATTTAGCACCAAGGG - Intronic
945956042 2:216086724-216086746 CTCTTCTTCTTAACCACCAATGG - Intronic
1169649551 20:7851809-7851831 CTCTTGTGCCTAGGTACCAAGGG + Intergenic
1172490278 20:35330976-35330998 CTCCTGTGCTTTAGGTCCCAAGG - Intronic
1174138100 20:48394313-48394335 CTTTTGTGGTTAAATACCAAAGG - Intergenic
1174439584 20:50539743-50539765 CTCCTGGGCTTGAGGAACAAAGG + Intronic
1178055809 21:28797223-28797245 CTCCTGTTCTGAAGGAACAAAGG + Intergenic
1180501743 22:15935996-15936018 CTCTTGTGCTGAAAAACTAACGG - Intergenic
1180898610 22:19355163-19355185 CTTTGGTTCTTAAGGACCAAAGG + Intronic
950396456 3:12737746-12737768 CTCTTGTTCTTAAGGAGAAGTGG - Exonic
954108831 3:48423172-48423194 CTCTCCTGCTCAAGAACCAAAGG + Intronic
961802583 3:129463794-129463816 CTCTTTTGCTTCATGATCAAAGG - Intronic
965448742 3:168809897-168809919 ATCTTGTTCTTCAGGAGCAATGG + Intergenic
967480741 3:189969970-189969992 CTCTTTGGCTTGAAGACCAAAGG + Intronic
967986073 3:195096154-195096176 CTTTTCTGCTTAAGGTCAAAGGG - Intronic
970673563 4:18422774-18422796 CTCTTGGCCTTAAGGAACAAGGG - Intergenic
976203159 4:82599418-82599440 CTCTGGTGCTTTTAGACCAATGG + Intergenic
978453346 4:108860926-108860948 CTCTGGAGCTCAGGGACCAAGGG - Exonic
978532673 4:109730244-109730266 CTCTTGTGAACCAGGACCAAGGG - Intergenic
990013688 5:51031345-51031367 TTCTTTTGCTTAAGGAGGAAGGG + Intergenic
991629179 5:68637153-68637175 CTCTTGAGCTAATGGACCTATGG + Intergenic
992429176 5:76691100-76691122 GTCTAGTGCTTAAGGACGACGGG - Intronic
993317768 5:86432941-86432963 ATCTTATCCTTAAGGTCCAAAGG + Intergenic
1002309591 5:178306519-178306541 CGGTTGTGCTGAAGGACCCATGG + Intronic
1008534745 6:52499363-52499385 TTCTTTTGCTTAAGGGCCTATGG - Exonic
1017092490 6:150772494-150772516 CTCTTGTGCAGTAGGACCACAGG - Intronic
1020580135 7:9987478-9987500 CTCCTCTGCTAAAGGAACAAAGG + Intergenic
1023488639 7:40713629-40713651 CTGTTGTGGTTAAGGCCCAAAGG - Intronic
1031441338 7:121798319-121798341 CTGTTGTGCTTAAGCACAATGGG + Intergenic
1032327515 7:130944863-130944885 CTCTTGTGTTTAAGAATTAAAGG - Intergenic
1034055698 7:148032703-148032725 CTCTTCTGCTTAGCGCCCAAGGG - Intronic
1034707978 7:153163520-153163542 CTGCTGTGCATATGGACCAATGG + Intergenic
1034750231 7:153561473-153561495 CTCTTGTGTTTAACAAGCAAAGG - Intergenic
1034880563 7:154759423-154759445 CTCTTGTGCCTAAAGCACAAGGG + Intronic
1035611707 8:970435-970457 CACCAGTGCTTAAGGACAAATGG + Intergenic
1038795495 8:30705810-30705832 CTCCTGTGCTTAAGGACTGCAGG + Intronic
1046101101 8:109615050-109615072 CTCTTTATCTTAATGACCAAAGG + Intronic
1049012969 8:139899910-139899932 CTCTTGTGCCTAATTTCCAAAGG + Intronic
1052308413 9:27037725-27037747 ATTTTGTTCTTAAGGACCCAGGG - Intronic
1186665698 X:11714822-11714844 CTCTTGGGCTGAAAGAACAAAGG + Intergenic
1192078134 X:68021067-68021089 CACTGGTGCTTAAGAACCAGAGG - Intergenic
1192078135 X:68021068-68021090 CTCTGGTTCTTAAGCACCAGTGG + Intergenic
1193091735 X:77501069-77501091 CTATTGTGTTTCAGGACCTATGG - Intergenic
1196410422 X:115412550-115412572 CTCACGTGCTGAAGGACGAAAGG + Intergenic
1196645227 X:118110812-118110834 CTCTTGTGCTAAAGAAGCATAGG + Intronic
1196762759 X:119214419-119214441 CTCTTGTTCTTCCAGACCAAGGG - Intergenic
1199760747 X:150902373-150902395 CTCTGGTCCCTAAGGATCAATGG - Intergenic