ID: 928215071

View in Genome Browser
Species Human (GRCh38)
Location 2:29354555-29354577
Sequence ATTGAGAAGAAGGATGAAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 892
Summary {0: 1, 1: 0, 2: 4, 3: 78, 4: 809}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
928215071 Original CRISPR ATTGAGAAGAAGGATGAAGA AGG (reversed) Intronic
901105124 1:6749445-6749467 AAGGAGAAGAAGGAGGAGGAGGG - Intergenic
901189071 1:7393843-7393865 CTGGAGAGGGAGGATGAAGAGGG - Intronic
901193153 1:7424643-7424665 ACTGAGAGGAAGGAAGGAGAGGG - Intronic
901429695 1:9205790-9205812 ATTAAGCAGAAGCATGGAGAAGG - Intergenic
901836381 1:11926384-11926406 ACCGAGAAGAAGGAGGAAGCAGG - Exonic
902143110 1:14373447-14373469 ATTGACAAAAAGGCAGAAGAAGG - Intergenic
902272063 1:15311737-15311759 ATTGAGAAAAAGTGAGAAGAAGG - Intronic
902489575 1:16771412-16771434 AAGAAGAAGAAGGAGGAAGAGGG + Intronic
902795163 1:18796131-18796153 ATCCAGAATAAGGGTGAAGAAGG - Intergenic
903105046 1:21070514-21070536 ATTTAGAACAAGAATGAAGTAGG - Intronic
903986132 1:27230387-27230409 AAGGAGAAGAAAGAAGAAGATGG - Intergenic
904794306 1:33047385-33047407 ATTGATAGAAATGATGAAGAAGG + Intronic
904801810 1:33098288-33098310 ATAGACAACAAGGATGACGAAGG + Intronic
905074890 1:35261733-35261755 AAGGAGAAAAAGGAGGAAGAAGG - Intergenic
905319102 1:37103126-37103148 AAAGACAAGAAGGAGGAAGAGGG + Intergenic
905551987 1:38849293-38849315 ATTAAGCAGAAGGATGAGGCAGG - Intronic
905903157 1:41595618-41595640 ATTGGATTGAAGGATGAAGAGGG + Intronic
906118739 1:43373267-43373289 CTTGAGAAAGAGGATGGAGACGG - Intergenic
906180840 1:43817557-43817579 AAGGAGAAGAAGAAGGAAGAAGG - Intronic
906493484 1:46286113-46286135 GGTGAGAATAAGGATGAAAAGGG + Exonic
907342070 1:53742299-53742321 AATTAGGAGAAGGATGAGGATGG - Intergenic
907620489 1:55972993-55973015 AGTGAGAAAAAGGCTGGAGAGGG + Intergenic
907740634 1:57162365-57162387 ATTGCAAAGAAGGAGGAAGCAGG + Intronic
907958839 1:59259058-59259080 ATTGACAAGAAGGAGGCATATGG + Intergenic
908539958 1:65112869-65112891 ATTGAGAAGTAGGACCAGGATGG + Intergenic
908576922 1:65469814-65469836 AATGAGAATGAGGATGAATACGG - Intronic
908656018 1:66389778-66389800 ATGGAGAATAACGATGAAAATGG + Intergenic
908961816 1:69707340-69707362 ACTCAGCAGAGGGATGAAGAGGG - Intronic
909314594 1:74199573-74199595 ATTGAGAAAGATGATAAAGAAGG - Intronic
909419231 1:75444936-75444958 ATTGAGGAGAAAGAAGAAGGTGG + Intronic
909686116 1:78350935-78350957 ATTGAGAAGAACAAAGCAGAAGG - Intronic
910039699 1:82834869-82834891 AGTGAGAAGCAGGAAGAAGAAGG - Intergenic
910082816 1:83361746-83361768 ATTTAGAAGAAGAAATAAGAAGG + Intergenic
910101060 1:83577597-83577619 GTTGAAAACAAGAATGAAGATGG - Intergenic
910217057 1:84853514-84853536 AGAGAGAAGAAGCAGGAAGAGGG - Intronic
910442125 1:87263710-87263732 TTTGTGAACAAGGATAAAGAGGG - Intergenic
910698931 1:90051169-90051191 ATGCAGAGGAGGGATGAAGAAGG - Intergenic
911063060 1:93764335-93764357 ATGGAGAAAGAGGATGAAGGAGG - Intronic
911525368 1:98978349-98978371 ATGGAGAAGAAGATTGAAGATGG - Intronic
911558204 1:99371455-99371477 AATGGGGAGAAGGATGAAGCAGG - Intergenic
911856311 1:102881302-102881324 ATTGATATGAAGAATAAAGAAGG + Intronic
912372898 1:109187443-109187465 TATGAAAAGAAGGATGAATAAGG - Intronic
912867587 1:113271787-113271809 AATGTGAAGGAGGAAGAAGATGG - Intergenic
913367271 1:118053884-118053906 ATTGGGAAGAAGCATGAAGATGG - Intronic
915022051 1:152788192-152788214 AGTGGGAAGGAGGATGAAGTCGG - Exonic
915023011 1:152798674-152798696 AGTGAGAAGGAGGATGAAGTCGG - Intronic
915663958 1:157427889-157427911 ATTAAGAAGAATGAGAAAGAAGG + Intergenic
915728937 1:158039078-158039100 ATTGAGAGGAAGGTTGGACAAGG + Intronic
916051863 1:161042060-161042082 TCTGAGAAGTAAGATGAAGAAGG - Intronic
916077550 1:161210782-161210804 ACTGAGAAGTAGGGTAAAGAAGG - Intronic
916332159 1:163628692-163628714 AAGGAGAAGAAGGAGGAGGAGGG - Intergenic
916368191 1:164057775-164057797 AATGAGAAGAAAGAGGAAGGAGG - Intergenic
916386221 1:164273601-164273623 ATTGATAAGAAGCAAGAAGCTGG - Intergenic
916429132 1:164710850-164710872 ATTGATGAGAAGGATGAACAGGG + Intronic
916567180 1:165991093-165991115 AATGAGGAGGAGAATGAAGAAGG + Intergenic
916652079 1:166842094-166842116 ATTGGGAAGAAGGATGTGGTGGG - Intronic
916882336 1:169032026-169032048 AAGAAGAAGAAGGAAGAAGAAGG - Intergenic
916924869 1:169507555-169507577 ATTGAGGAGGAGGATGGGGAAGG + Intergenic
917196471 1:172471261-172471283 CTTGAGAAGAAGGATAAGAAAGG + Intergenic
917510705 1:175667094-175667116 GTGGTGAAGAAGGATGAGGAAGG - Intronic
917511251 1:175670991-175671013 ATTCAGGTGAAGGATGATGATGG + Intronic
918601360 1:186366270-186366292 AAAGACAAGGAGGATGAAGATGG + Intronic
919350115 1:196440766-196440788 ATTGAGATGAAGGGTAGAGATGG - Intronic
919429529 1:197475366-197475388 GAAGAGAGGAAGGATGAAGATGG - Intronic
919811088 1:201409200-201409222 TTGGAGAAGAAGCATGAAGCAGG + Exonic
920099681 1:203509000-203509022 ATAGAGAAAAAGGAGGCAGAAGG - Intergenic
920213815 1:204348258-204348280 CTTGAGGAGAAGGTTGCAGAGGG - Intronic
920341640 1:205278843-205278865 AGTGAGAAGGAGAATGAGGATGG + Intergenic
920756216 1:208736436-208736458 ATTTAGAAGGAGTAGGAAGAAGG + Intergenic
921485267 1:215708076-215708098 AGTGGGAAGAAGGATGTGGAAGG + Intronic
921780788 1:219160856-219160878 ATTTAGAAGAAGAGTGAAGTAGG - Intergenic
922209486 1:223476670-223476692 AAGGAGGAGAAGGAGGAAGATGG + Intergenic
922367332 1:224878289-224878311 CTTGGGAATAAGGAGGAAGAGGG - Intergenic
923069184 1:230547154-230547176 AGTCAGAAGAAGGAGAAAGAAGG - Intergenic
923368013 1:233282496-233282518 ACTGAGATGAAGGATGAAAGAGG - Intronic
923410151 1:233700070-233700092 AATGAGAGGAAGGTAGAAGAAGG - Intergenic
923530862 1:234811113-234811135 AAGAAGAAGAAGGAGGAAGAGGG - Intergenic
1063800416 10:9570989-9571011 AGTGTGAAGTAGGAAGAAGAAGG - Intergenic
1063811852 10:9720243-9720265 ATTGTGAAGATGGAAGAAGGGGG + Intergenic
1063871168 10:10419447-10419469 CTTGACAACAAGGATGAAGCTGG - Intergenic
1064731516 10:18335908-18335930 TTTGAAGAGAAGGATGAGGATGG - Intronic
1064804352 10:19113593-19113615 AGGGAGAAGAAGGAAGAAAAAGG - Intronic
1065761582 10:28987805-28987827 AAGGAGAAGTAGGAAGAAGAAGG - Intergenic
1065765652 10:29026997-29027019 GAGGAGAAGGAGGATGAAGAAGG + Intergenic
1065826422 10:29576238-29576260 ATTGAGAAGAAGAGTGCACAAGG - Intronic
1066357283 10:34697092-34697114 ATTGAGGAGAAGGAAAAAAAAGG + Intronic
1067394997 10:45907019-45907041 AGTGAGAAGGAGCATGGAGATGG - Intergenic
1067397232 10:45933175-45933197 TTTTAAAAGAAGGATGAAAATGG + Intergenic
1067863317 10:49876150-49876172 AGTGAGAAGGAGCATGGAGATGG - Intronic
1067865554 10:49902276-49902298 TTTTAAAAGAAGGATGAAAATGG + Intronic
1068497606 10:57805277-57805299 GATGTGAAGCAGGATGAAGAAGG - Intergenic
1068967281 10:62925025-62925047 TTTGAGTAAAAGGATAAAGAGGG + Intergenic
1069093949 10:64235727-64235749 ATAGAAAAGAGTGATGAAGAAGG + Intergenic
1069117205 10:64522656-64522678 ATTGAAAAGAATGATGTAGAAGG - Intergenic
1069278905 10:66628660-66628682 CTTGTGAAGAAGCATGAAGAAGG + Intronic
1069372078 10:67758907-67758929 AGTAAGAAGAAGAATCAAGAAGG - Intergenic
1069979354 10:72241551-72241573 ATTGAGACAAGGGATGGAGAAGG + Intergenic
1070326137 10:75390445-75390467 GATGAGAAGAAGGAGGAAGAGGG - Intergenic
1070421722 10:76243989-76244011 ATGGAGAAGAGATATGAAGATGG + Intronic
1070423182 10:76258252-76258274 ACTGAGACGAAGTATGAAGATGG - Intronic
1070470377 10:76773365-76773387 ATTGAGAAGACGAAATAAGAGGG - Intergenic
1071020568 10:81050084-81050106 ATTTAGAAGATGAATGAAAAGGG - Intergenic
1071896517 10:90073895-90073917 ATTGAAAAGTGGGGTGAAGAAGG - Intergenic
1072085630 10:92076755-92076777 AAGTAGAAGAAGGAAGAAGAAGG + Intronic
1072423526 10:95309728-95309750 ATCTAGAAAGAGGATGAAGAAGG + Intergenic
1072856630 10:98953982-98954004 ATTGAGAAGAAATATGAACTGGG + Intronic
1073021561 10:100448968-100448990 AAGGAGAAGAAAGAAGAAGAAGG + Intergenic
1073627773 10:105117470-105117492 CTTGAGAAGAGGGATGGAAATGG - Intronic
1073941688 10:108706530-108706552 ATTGGGAAGCAGGCAGAAGATGG - Intergenic
1073961996 10:108942647-108942669 ATTGAGAAAGAGGCTGAAGACGG - Intergenic
1074428312 10:113371475-113371497 ATTGTGAAGAAGAAAGAATAGGG - Intergenic
1074429063 10:113377860-113377882 ATTGAGATGAAGTCTGAAGAAGG + Intergenic
1074656524 10:115594902-115594924 CTTGAAAAGAAGGCTCAAGAAGG - Intronic
1074828696 10:117232979-117233001 AATGAGATGAAGGTGGAAGAGGG + Intergenic
1075352402 10:121735384-121735406 ATGCAGAAGAATGATGCAGAAGG + Intergenic
1075660770 10:124194025-124194047 TTTGAGCAGAAGGAAGAAGGAGG + Intergenic
1076338735 10:129728328-129728350 GGTGAGAAAAAGGCTGAAGAAGG + Intronic
1078155593 11:8797447-8797469 AAGGGGAAGAAGGAGGAAGAAGG - Intronic
1078727877 11:13948046-13948068 ATGGAAAAGAGGGATGAGGAAGG - Intergenic
1078737827 11:14036871-14036893 GTTGAGAAGAAGGATGACATAGG + Intronic
1079170399 11:18088717-18088739 ATTGAGAATACTGATGAAGCAGG + Intronic
1079202900 11:18390638-18390660 GTGGGGATGAAGGATGAAGAGGG - Intergenic
1079362581 11:19781509-19781531 ATTGAGAATAATGATGATGAGGG + Intronic
1079449560 11:20588044-20588066 AAGGAGAAGGAGGAAGAAGAGGG + Intergenic
1079645622 11:22860923-22860945 AGTGAGGAGAAGCTTGAAGATGG + Intergenic
1079666212 11:23109202-23109224 ATAGAGAAGGAGGTTGGAGATGG + Intergenic
1079703915 11:23588966-23588988 TTTGTGAAGGAGGAAGAAGAGGG + Intergenic
1079944843 11:26729237-26729259 GTGGAAAAGAAGGATGAGGAAGG - Intergenic
1080757528 11:35216439-35216461 ATTGAAAACAAATATGAAGATGG + Intronic
1081023112 11:37971842-37971864 ATGGAGATGAAGGTGGAAGAGGG - Intergenic
1081233117 11:40611074-40611096 CTTGAAAAGAAGGTTGAAAATGG + Intronic
1081404731 11:42683837-42683859 AATCAGAAGAAAGATGAAGATGG + Intergenic
1082305205 11:50563988-50564010 ATTGAGAACAATGGTGAAAAAGG - Intergenic
1082585369 11:54931221-54931243 ATTGAGATGTATGGTGAAGAAGG - Intergenic
1083100563 11:60301305-60301327 ATTGAGAAGAAATATCAAGTGGG + Intronic
1083225672 11:61282969-61282991 ATGGAGATGAGGGAGGAAGAGGG - Intronic
1083505878 11:63156930-63156952 CTTGAGGAGAAGGAAGAAGCAGG - Intronic
1084711044 11:70843933-70843955 ACTGAGGAGGAAGATGAAGATGG - Intronic
1084951388 11:72667923-72667945 ACTGAGAAGAAGCATGGAGGAGG + Intronic
1085140891 11:74140389-74140411 ATTAAGTAGAAACATGAAGAAGG - Intronic
1085684580 11:78610119-78610141 AAGGAGAAGGAGGAAGAAGAAGG - Intergenic
1085703397 11:78764797-78764819 CTGGAGAAGAAGGAAGTAGAAGG + Intronic
1085865725 11:80289782-80289804 ATAGAGATCAAGGATGAACAGGG - Intergenic
1086302509 11:85442919-85442941 AAGAAGAAGAAGGAGGAAGAAGG + Intronic
1087564836 11:99841652-99841674 AAGGAGAAGGAGAATGAAGAAGG + Intronic
1087661898 11:100998157-100998179 CTCCAGAAGAAAGATGAAGATGG + Intergenic
1087664703 11:101030877-101030899 ATTCAGAAGAAGGAAGATGTAGG + Exonic
1087837595 11:102890459-102890481 ATTCAGAAGAAGGGTGTAGCCGG - Intergenic
1087881719 11:103423966-103423988 ATTGAAAAGAATGAAGTAGATGG + Intronic
1088760525 11:112924797-112924819 AGTGAGAAGAGGGTGGAAGAAGG + Intergenic
1089646446 11:119883116-119883138 AAAAAGAAGAATGATGAAGAAGG - Intergenic
1089879423 11:121759250-121759272 ATTGAGTAGAAGGTGGAAGTAGG - Intergenic
1089949978 11:122516498-122516520 ATTTAGAAGGAGGTTGGAGAAGG - Intergenic
1090042697 11:123304556-123304578 ATGGAGGAGAAGGATGGAGAGGG + Intergenic
1090042914 11:123306410-123306432 ATGGAGGAGAAGGATGGAAAGGG + Intergenic
1090237267 11:125158551-125158573 GGTGAGCAGAAGGATGCAGATGG + Intergenic
1090256082 11:125285336-125285358 ATTGAGAATAAGGATATTGAAGG + Intronic
1090502971 11:127279729-127279751 AAGGAGAAGAAGGAGGAGGAGGG - Intergenic
1091066230 11:132515676-132515698 ATTCAGAAGAAGGAGGAAAAGGG - Intronic
1091413506 12:259970-259992 ATGGAAAAGAAGGAGGAAGATGG - Exonic
1091634781 12:2188790-2188812 CTTTAGAAGAAGGAAGAATAAGG + Intronic
1092078553 12:5693672-5693694 CTGGAGAAGAAGGAAGGAGAGGG - Intronic
1092339523 12:7663458-7663480 ATTGGGAGGAAGGAGGAAGGGGG + Intronic
1092736024 12:11583774-11583796 AGTCAGGAGATGGATGAAGAGGG + Intergenic
1093023007 12:14220312-14220334 ATTGAGAGTCAGGATGCAGAGGG - Intergenic
1093363781 12:18266826-18266848 AATGAGGAGGAGGAGGAAGAAGG - Intronic
1093480225 12:19596774-19596796 ATTGATAAGAATAATGAAGAGGG + Intronic
1093508408 12:19896805-19896827 AAGAAGAAGAAGGAAGAAGAAGG - Intergenic
1093722546 12:22461727-22461749 ATTTATATAAAGGATGAAGAGGG + Intronic
1094088138 12:26616818-26616840 ATTCAGGAGGAGGAGGAAGAGGG - Intronic
1094098063 12:26730328-26730350 GTTTAGAAGCAGGATGAGGAGGG - Intronic
1094272018 12:28627338-28627360 GTTGAGAAGAAGAATGAGTAGGG + Intergenic
1094453926 12:30611306-30611328 TTTGAGGGGAGGGATGAAGAGGG + Intergenic
1095196858 12:39329455-39329477 AAGGAGGAGAAAGATGAAGAAGG + Intronic
1095373842 12:41502748-41502770 ATTGAGACAAAGGAGTAAGAGGG + Intronic
1095480005 12:42625010-42625032 AGGAAGAAGAAGGAAGAAGAAGG - Intergenic
1096025300 12:48355742-48355764 TTAGAGAGGAAGGATGAAAATGG + Intergenic
1096059515 12:48684870-48684892 AGTGAGAAAAAAGATGAAAACGG + Intergenic
1096311484 12:50525045-50525067 ATGGAGAAAAAGCATCAAGAGGG + Intronic
1097263285 12:57731700-57731722 ATAGGGAAGATAGATGAAGAAGG + Intronic
1097409630 12:59235457-59235479 ATGGAGAGGTAGGGTGAAGAGGG - Intergenic
1097892241 12:64789161-64789183 AAGAAGAAGAAGGAAGAAGAAGG - Intronic
1098308640 12:69126031-69126053 AAACAGCAGAAGGATGAAGAAGG - Intergenic
1098582306 12:72114571-72114593 GTGGAGGAGAAGGAAGAAGAGGG + Intronic
1098726108 12:73969825-73969847 AGTAAGAAGGAGGAAGAAGAGGG + Intergenic
1098730053 12:74024670-74024692 ATGGAGGAGATGGAGGAAGAGGG + Intergenic
1098795539 12:74883927-74883949 AGTGAGAATAAGGATGAAATTGG + Intergenic
1099913929 12:88868169-88868191 ATGGAAAATAAGGATTAAGATGG + Intergenic
1100244373 12:92742468-92742490 CTTGAGAAGATACATGAAGAAGG + Intronic
1100438462 12:94593412-94593434 AAGAAGAAGAAGGAAGAAGAAGG + Intronic
1101230489 12:102736404-102736426 GTTCAGAAGAAGTATGAAGAGGG - Intergenic
1101252802 12:102951788-102951810 AATGAGAAGAAGGAGGGGGAAGG - Intronic
1101394744 12:104336582-104336604 ATTTATAATAAAGATGAAGAAGG + Intronic
1101718837 12:107333926-107333948 ATTGTGTAGAAAGATGAAGGAGG + Intronic
1101794108 12:107957020-107957042 AGGAAGAAGAAGGAAGAAGAAGG - Intergenic
1101794109 12:107957030-107957052 AGAAAGAAGAAGGAAGAAGAAGG - Intergenic
1101794110 12:107957040-107957062 AATGAGAAGAAGAAAGAAGAAGG - Intergenic
1102761983 12:115395849-115395871 ATTGAAATGAAGGAAGAAGTTGG - Intergenic
1102974978 12:117200190-117200212 AAGGAGAAGAAGAAAGAAGAAGG - Intergenic
1103804908 12:123564812-123564834 ATTTAAAAGAATGATGAAGTGGG - Intergenic
1103886527 12:124206503-124206525 AATGAGAAGAATGAGAAAGAAGG - Intronic
1104378215 12:128283931-128283953 GTTCAGAAGCAGGAGGAAGAGGG + Intronic
1104597583 12:130130585-130130607 ATTAGGAAGAAGCAGGAAGAGGG + Intergenic
1104738944 12:131158589-131158611 ATAGAGAAGAGGAAGGAAGAAGG - Intergenic
1105894172 13:24704336-24704358 ATTGAGAAGATGCAGGAATAAGG - Intronic
1106464937 13:30005116-30005138 ATTGGGCAGAAGGATGGAGAAGG + Intergenic
1106582027 13:31027088-31027110 CTGGAGAAGAAGGAGGAGGAGGG - Intergenic
1106793414 13:33179834-33179856 ATTCAGAAGAAGGCAGAAGAAGG + Intronic
1106851067 13:33793015-33793037 ATTGAGAACAAAGATCAATATGG + Intergenic
1107003068 13:35573964-35573986 ATTAAGTAGAAGGATAATGATGG - Intronic
1107071427 13:36274041-36274063 ATAGAGAAGGAGAATGAAGTGGG - Intronic
1107162234 13:37244259-37244281 ATTGGGAAGAGGGAAGAAAAAGG - Intergenic
1107250693 13:38357846-38357868 ACTGAGGAGAAGGAAGAGGAAGG + Intronic
1107287249 13:38808018-38808040 ACTAAAATGAAGGATGAAGAGGG - Intronic
1107944454 13:45405440-45405462 ATTGTGAAAAGAGATGAAGATGG + Intronic
1108547161 13:51507595-51507617 AGTGAGATGAAGGTTGTAGAAGG - Intergenic
1110242245 13:73282295-73282317 AGTGAGAAGAAGGCAGAAGGAGG - Intergenic
1110355062 13:74558085-74558107 ATGGAGATCAAGGGTGAAGAGGG - Intergenic
1110490141 13:76093882-76093904 AGTGTGAAGAAGGGTGTAGAGGG - Intergenic
1110666482 13:78123588-78123610 GTGGAGAAGAATGGTGAAGAAGG + Intergenic
1110682625 13:78334344-78334366 ACTGAGAAGAGGGATGAATGCGG + Intergenic
1110752906 13:79136669-79136691 AGTGAAAGGAAGGAAGAAGAAGG + Intergenic
1110992780 13:82064970-82064992 ATTCAGAAGAAAAATGCAGAGGG + Intergenic
1111198166 13:84899735-84899757 ACTGAGTAGAAGCACGAAGAAGG + Intergenic
1111208651 13:85047311-85047333 ATGGAGAAGAATGATGATGGAGG + Intergenic
1111858972 13:93677175-93677197 AATGAGACAAAGGCTGAAGAGGG + Intronic
1112067102 13:95804500-95804522 ATTGTGAAAAAGAATGAAGTTGG + Intronic
1112069844 13:95837429-95837451 CCTGGGAACAAGGATGAAGAAGG + Intronic
1112636261 13:101221436-101221458 TTTGAGAGGAGGGATGTAGAGGG - Intronic
1112735286 13:102409189-102409211 ATTCAGAAGTAGGAGGAAAAGGG + Intergenic
1114248405 14:20935565-20935587 ATTGACAAGGAGGTGGAAGAAGG - Intergenic
1114413074 14:22518609-22518631 ATGGAGAAGAAGGTTAAAAAAGG + Intergenic
1115318356 14:32050627-32050649 ATTGAAAGAAAGGAAGAAGAGGG + Intergenic
1115681098 14:35739242-35739264 AATGACAAGAAGGAAGAAAATGG - Intronic
1115768992 14:36651158-36651180 TTTGAGAAGGAAGATGAAAAGGG - Intergenic
1116129746 14:40839740-40839762 GCTGAGAAGAAGGAGGAGGAGGG - Intergenic
1116475081 14:45330866-45330888 AAGGAGAAGGAGGAGGAAGAAGG - Intergenic
1116509264 14:45723531-45723553 ATTAAGAACATGGATGAAGCTGG + Intergenic
1116663797 14:47748719-47748741 ACTGAGATGGAGGAGGAAGAAGG - Intergenic
1116897621 14:50332451-50332473 ATTTTGAAGAAGTAAGAAGAAGG - Exonic
1116926966 14:50649162-50649184 TTTGAGAAGAGGCTTGAAGAGGG - Intronic
1118072981 14:62266082-62266104 TTTAAGTAGAAGGTTGAAGAGGG + Intergenic
1119178999 14:72591904-72591926 ATTGAGGAGACGGGAGAAGAGGG - Intergenic
1119193274 14:72698977-72698999 ACTGGGTAGAAGGATGAAGGAGG + Intronic
1119230522 14:72975763-72975785 AGTGAAAGGAAGGAGGAAGAGGG + Intronic
1119304935 14:73600024-73600046 ATTGAGAAGAAGGATATTCAAGG - Intergenic
1120025486 14:79578927-79578949 ATTGAGAGGAAGAAAGTAGAGGG - Intronic
1120515150 14:85461818-85461840 ATAGAGAAAAAGGATGACTATGG + Intergenic
1120531590 14:85638596-85638618 CTTGAGAAGAAGTGTGAAGTAGG - Exonic
1120578650 14:86217756-86217778 ATGGAGGAGGAGGAGGAAGAAGG - Intergenic
1120719076 14:87870902-87870924 AAGAAGAAGAAGGAAGAAGAAGG - Intronic
1120824286 14:88941380-88941402 TTTGAGAAGCATGATGAAGAAGG - Intergenic
1120930739 14:89845761-89845783 AGGGAGAAGCAGGCTGAAGATGG + Intronic
1121880853 14:97499256-97499278 ATTTAGAAGAAGAAGGAAGAAGG + Intergenic
1122307743 14:100776433-100776455 AATGAGAAGCAGGAGGGAGAGGG + Intergenic
1122916200 14:104860122-104860144 ATGGAGATGGAGGATGGAGATGG - Intergenic
1124459636 15:29877623-29877645 AAAGAGAAGAAGAAAGAAGAAGG - Intronic
1125049735 15:35283047-35283069 AAGAAGAAGAAGGAAGAAGAAGG - Intronic
1125227629 15:37413042-37413064 ATTGAGAAGCAGGCAGAAGGGGG - Intergenic
1125384061 15:39117542-39117564 ATTAAAAAAAAGGATAAAGAAGG + Intergenic
1125426812 15:39556981-39557003 ATGGAAAAGAGGGATGAGGAAGG - Intergenic
1126052331 15:44697311-44697333 AAGGAGAAGAAGGAAGAAGAAGG - Intronic
1126273580 15:46849394-46849416 AAAGAGAGGAAGTATGAAGATGG - Intergenic
1126421705 15:48480519-48480541 TATGAGAAGAAGCATGAAGCTGG - Intronic
1126567419 15:50114552-50114574 AGTGAGAAGAGGAAGGAAGATGG - Intronic
1127122105 15:55780596-55780618 AGGGAGAAGAAGAAGGAAGAAGG + Intergenic
1127549001 15:60018410-60018432 AATGAGAAGATGGATGGAGAGGG + Intronic
1127733320 15:61819700-61819722 GCTGAGAGGAAGGATGGAGAAGG - Intergenic
1128095748 15:64953691-64953713 AAGGAGAAGAAGAAAGAAGAAGG - Intronic
1128095809 15:64954493-64954515 GAGGAGAAGAAGGAAGAAGAAGG - Intronic
1128095819 15:64954580-64954602 AAGGAGAAGAAGGAAGAATAAGG - Intronic
1128095843 15:64954846-64954868 AAGGAGAAGAAAGAAGAAGAAGG - Intronic
1128352446 15:66900149-66900171 ACTGAGGATAAGAATGAAGAAGG - Intergenic
1128414512 15:67432267-67432289 ATTGTGAGGAAAGATGAAAATGG + Intronic
1128724284 15:69976267-69976289 ATTGTGAAGGAGCATGCAGAGGG - Intergenic
1129108329 15:73323517-73323539 ATGTGGAAGGAGGATGAAGACGG + Exonic
1130128718 15:81117874-81117896 AAAGAGGAGGAGGATGAAGAAGG - Intronic
1130758574 15:86793176-86793198 ATTGGGAGGAAGGAGGCAGATGG - Intronic
1131066390 15:89437263-89437285 AGGTAGAAGAAGGAGGAAGAGGG - Intergenic
1131701225 15:94938276-94938298 AATGACAAGAGGGATGAATAAGG - Intergenic
1133210856 16:4262738-4262760 CTGGAGATGAATGATGAAGAGGG - Intronic
1133571435 16:7044395-7044417 AGTCAGGAGAAGGATGAAAAAGG + Intronic
1133917127 16:10119215-10119237 ATTCAGTAGGAGGAGGAAGATGG + Intronic
1135002342 16:18787310-18787332 ATGGAAAAGAGGGATGAGGAAGG - Intronic
1135966667 16:27041196-27041218 ATTGAGATGAAGGCTGAATACGG + Intergenic
1136094771 16:27947335-27947357 AAGGAGAAGAAAGAAGAAGAAGG + Intronic
1136539093 16:30918682-30918704 AAGGAGAAGAAGGAAGAAGAAGG - Intergenic
1137229749 16:46552882-46552904 GCTGAGGAGAAGGAGGAAGAAGG - Intergenic
1137512610 16:49114796-49114818 ATTCAGAAAAAGGATCAATATGG - Intergenic
1137625036 16:49902273-49902295 ATGGAGAAGAATGTTGTAGATGG + Intergenic
1137809486 16:51339268-51339290 AGTGAGAAGAAAGAGGGAGAGGG - Intergenic
1138004849 16:53323619-53323641 ATTGGGAAGAACAATAAAGAAGG - Intronic
1138087151 16:54143538-54143560 AAAGAGAAGAAGGAAGAAGCAGG + Intergenic
1138298722 16:55908920-55908942 ATGGAGAGAAAGGAGGAAGAAGG - Intronic
1138301939 16:55937735-55937757 AAAGAGAAGAATTATGAAGAAGG - Intronic
1138775360 16:59716355-59716377 AATGAGTAGAAAGATGAGGATGG + Intronic
1138930563 16:61650402-61650424 ATAGAGAAGAATGATTAAGTTGG - Exonic
1139027380 16:62834863-62834885 ATTGAGAAGAGAGGTAAAGAGGG + Intergenic
1139167552 16:64585954-64585976 ATGGAGACAAAAGATGAAGAAGG - Intergenic
1139343343 16:66286274-66286296 ACTGAGTAGAAGGAGGAAGTGGG + Intergenic
1139625364 16:68184323-68184345 ATAAAGAAGATGGATTAAGATGG + Intronic
1140654935 16:77130759-77130781 TATGAAGAGAAGGATGAAGAAGG + Intergenic
1140806479 16:78536724-78536746 ATGGAGGAGAATGATGACGAAGG + Intronic
1141003963 16:80334985-80335007 CTTTAGGAGCAGGATGAAGATGG - Intergenic
1141227009 16:82127278-82127300 ACTGAGAAGAAGGAATAAAAGGG + Intergenic
1141305672 16:82861563-82861585 ATTGAGGAGGAAGATGAAAAAGG - Intronic
1142191714 16:88721196-88721218 TTTTAGAAGAAGGAAGAAGGAGG - Exonic
1142930719 17:3282022-3282044 ATGGAGAAAAACAATGAAGAGGG - Intergenic
1142963434 17:3565640-3565662 ATCGTAAGGAAGGATGAAGAAGG + Exonic
1143035134 17:3990789-3990811 AATGAGAAGAAAGAAGAAGAAGG - Intergenic
1143391499 17:6561549-6561571 GATGAGGAGAAGGAGGAAGAGGG - Intergenic
1143395408 17:6590988-6591010 AGAAAGAAGAAGGAAGAAGAAGG + Intronic
1143395409 17:6590998-6591020 AGGAAGAAGAAGGAAGAAGAAGG + Intronic
1143794681 17:9327172-9327194 AAGAAGAAGAAGGAAGAAGAAGG + Intronic
1144325937 17:14179931-14179953 TTTGAAATGAATGATGAAGATGG + Intronic
1144474810 17:15576819-15576841 TTTGAAATGAATGATGAAGATGG + Intronic
1145779192 17:27550825-27550847 CTTGAGAAGGAGGATGGGGAGGG + Intronic
1145827283 17:27886591-27886613 ATTGAGGAGAAGGAGGAACCTGG - Intronic
1145893766 17:28438985-28439007 ATTGAGAAGAATTATAGAGATGG - Intergenic
1147043692 17:37737141-37737163 GGTGAGGAGAAGGAGGAAGAGGG - Intronic
1148796184 17:50198003-50198025 CTTGAGAAGAAGGAAAAAGATGG + Intronic
1149354197 17:55822842-55822864 ATTGAGTGGAAGGAAGAGGAAGG + Intronic
1149355300 17:55833377-55833399 ATTCAGAGGAAGTATGTAGAAGG - Intronic
1149497111 17:57126027-57126049 GTTGACAAGAAGGATGAATGAGG + Intergenic
1149524292 17:57341906-57341928 AAAGAGAACAAGGAGGAAGAAGG - Intronic
1150152242 17:62819584-62819606 AAGGAGAGGAAGGATGGAGAGGG - Intergenic
1150683722 17:67303612-67303634 AGTGAAAAGAAGGATGATGAGGG + Intergenic
1150754942 17:67903100-67903122 AAAGAGAGGAAGGATGAGGAAGG - Intronic
1150936762 17:69644064-69644086 ATGGAAAAGAGGGATGAGGAAGG - Intergenic
1150998662 17:70348791-70348813 ATGGAAAAGAGGGATGAGGAAGG - Intergenic
1151581399 17:74981328-74981350 ATTGGGAAGAAGGCCGAAGAAGG + Intergenic
1151860836 17:76760373-76760395 ATTGAGAAGGAGGAGGAGGGAGG + Intronic
1152198471 17:78931274-78931296 ATAGAGAACAAGAATGCAGATGG + Intergenic
1152370161 17:79882677-79882699 ATTGAGGAGGAGGAGGAGGAGGG - Intergenic
1152594304 17:81230757-81230779 ATTGATGAGGAGGAAGAAGAGGG - Intronic
1152731675 17:81975113-81975135 AAGGAGAAGAAAGAAGAAGAGGG - Intergenic
1152969515 18:148189-148211 ATTGAGAAGAAAGAGGAAGAAGG + Intergenic
1152982742 18:294262-294284 AAAGAGAATGAGGATGAAGAGGG - Intergenic
1153557725 18:6333617-6333639 ATGGAGAAGCAGGATGCAGGTGG + Intronic
1155218565 18:23664017-23664039 ATTGAGAAGAGGGAAGGAGGGGG - Intergenic
1155332183 18:24729653-24729675 TTTGAGATGAAAGATGAAGAAGG - Intergenic
1155868327 18:30994242-30994264 AGTGAAAAGCAGGAAGAAGATGG - Exonic
1155996132 18:32333177-32333199 ATTAAGAGGAGGGAAGAAGAGGG + Intronic
1156107667 18:33685289-33685311 AATGAGGATAAGGATGATGACGG - Intronic
1156392481 18:36663835-36663857 ATTGGCAACAAAGATGAAGAAGG - Intronic
1156846482 18:41671541-41671563 GTGGAGAAGGAGGAAGAAGAGGG + Intergenic
1156979720 18:43270820-43270842 ATTGAAAATAAGGAAGAATATGG + Intronic
1157120792 18:44909163-44909185 ATTGAAAGGAAGGATGAGTAAGG + Intronic
1157170984 18:45404930-45404952 ACTGAGAACAAGGCTGAATAAGG - Intronic
1157214684 18:45773115-45773137 AAGAAGAAGAAGGAAGAAGAAGG - Intergenic
1157229898 18:45906022-45906044 ATTAAGAAGAGGACTGAAGATGG - Intronic
1157303667 18:46500101-46500123 ATGGAAAAGAAGGAAGAGGAGGG - Intronic
1157442843 18:47723512-47723534 ATGGAGAAGGAGGATGGAGCTGG - Intergenic
1157511201 18:48276188-48276210 AATGAGAAGAGGAATGAAGAGGG - Intronic
1157768670 18:50325161-50325183 AAGAAGAAGAAGGAAGAAGAAGG - Intergenic
1158030905 18:52963569-52963591 ATAGTGAAGCAGGATGAAGGTGG + Intronic
1158408056 18:57177934-57177956 AATGCGAAGAAGGAGGAAAAGGG + Intergenic
1159162939 18:64667862-64667884 ATTTAGAGGAAGAATGAAAATGG + Intergenic
1159380420 18:67650236-67650258 ATTTATAAGAACTATGAAGATGG - Intergenic
1159591007 18:70335046-70335068 AAGAAGAAGAAAGATGAAGAAGG - Intergenic
1159708393 18:71721587-71721609 ATTGATAAGATGAATGAAAAAGG - Intergenic
1159834625 18:73324116-73324138 ACTGAGAAGGAGGAAGAGGAAGG - Intergenic
1160090150 18:75819205-75819227 ATGGAGAGGAAGAATGAACATGG + Intergenic
1160676460 19:393912-393934 ATGGAGAAGGATGATGGAGAAGG + Intergenic
1160695228 19:480651-480673 ATGGAGAAGGATGATGGAGAAGG + Intergenic
1160695347 19:481320-481342 ATGGAGAAGGATGATGGAGAAGG + Intergenic
1160925352 19:1542229-1542251 AGGGAGAAGAAGGAAGAAGAAGG - Intergenic
1160950836 19:1666515-1666537 AAGGAGAAGAAGGAAGAAGGAGG - Intergenic
1161869207 19:6857338-6857360 ATTTAATAAAAGGATGAAGATGG + Intronic
1161934343 19:7362297-7362319 AAGGAGAAGGAGGAAGAAGAAGG + Intronic
1162180562 19:8865973-8865995 CTTGAGAGGAAGGAGGAAGAGGG + Intronic
1162183572 19:8887520-8887542 AATGAGAATAATGATGATGATGG - Intronic
1162844725 19:13383366-13383388 ATGGGGAAGATGGAGGAAGAAGG + Intronic
1163174857 19:15557128-15557150 ATGGAGAAGAGGGATGGGGAAGG - Intergenic
1164359164 19:27482248-27482270 ATTGAGACAAAGGAGGAAAAAGG + Intergenic
1164634263 19:29781125-29781147 TTCTGGAAGAAGGATGAAGAGGG - Intergenic
1165423729 19:35734398-35734420 ATTGAGACCATGGTTGAAGAAGG + Intronic
1165468752 19:35990732-35990754 AGGGAAAAGAAGGAAGAAGAAGG + Intergenic
1165603690 19:37080251-37080273 ATTAAGAGGATGGAGGAAGAGGG + Intronic
1165834256 19:38744593-38744615 ATGGAGAAGAAACATGAAGGCGG - Intronic
1166108860 19:40610869-40610891 ATGGAGAAGCAGAATGAGGAGGG + Intronic
1166158726 19:40935839-40935861 ACAGAAAAGAAGGATGAGGAAGG + Intergenic
1166512341 19:43417478-43417500 ATTGACATGGAGGATGAACAGGG - Intronic
1166627099 19:44367709-44367731 AATGAGAATAAGGAAGAAGAAGG - Intronic
1167608206 19:50492929-50492951 AGTAAGAGGAAGGAGGAAGAAGG + Intergenic
1167695829 19:51015256-51015278 ATTGAGGATAGGGATGAGGAGGG + Intronic
1167819952 19:51918611-51918633 ATGGTGAAAAAGGATTAAGAGGG + Intronic
1168495589 19:56845896-56845918 ATGGAAAAGAAGGAAGAATATGG - Intergenic
925258084 2:2506940-2506962 ATTGTGAAATAGGATGAAGTTGG - Intergenic
925386788 2:3467613-3467635 TCTGGGAAGAAGGATGAAGCAGG + Intronic
925628632 2:5866840-5866862 ACGGTGGAGAAGGATGAAGAAGG + Intergenic
925920132 2:8632586-8632608 TTTGAGCAGAAGGATGGAGGGGG + Intergenic
926394848 2:12430406-12430428 AAGGAGAAGAAGGAGGAAGGAGG + Intergenic
927433034 2:23042937-23042959 GATGGGAAGGAGGATGAAGAGGG - Intergenic
927929823 2:27036924-27036946 ATGGTGAGGAAGGAAGAAGAGGG + Intronic
928215071 2:29354555-29354577 ATTGAGAAGAAGGATGAAGAAGG - Intronic
928371826 2:30745436-30745458 ATAGAGAAGATTGATGGAGATGG - Intronic
929905500 2:46042602-46042624 ATTAAGTAGAAGGACCAAGAGGG - Intronic
930437136 2:51359784-51359806 ATTGATAAGAAGGCTTCAGATGG + Intergenic
930550549 2:52829627-52829649 ATTGAGAAAAAGGAGGAATAAGG - Intergenic
930624306 2:53679469-53679491 ATGGAGAAGAAAGATGAGGATGG - Intronic
930945703 2:57072322-57072344 ATTGAGGAGAAGGAAGAGGAGGG - Intergenic
931952713 2:67383073-67383095 AATGAGATGAAGGATGGAGGTGG - Intergenic
932117439 2:69066032-69066054 ATTCAGAATAAAGAAGAAGAAGG + Intronic
932737459 2:74264269-74264291 ATTGAGAAGCAGATTGAGGATGG - Exonic
932783811 2:74581710-74581732 ACTGTGAAGAAAGAAGAAGATGG + Exonic
932917843 2:75876591-75876613 ATTGAGAATCAGGATGTACAGGG - Intergenic
933217633 2:79648616-79648638 ATTGAGCACAAGGTAGAAGAAGG - Intronic
933233056 2:79831034-79831056 ATTGAGAAGAGGAAAAAAGAGGG - Intronic
933367986 2:81378873-81378895 TTTGAGGAGGAGGAAGAAGAGGG - Intergenic
933735555 2:85491169-85491191 ATTGAGAAGGAAGATTGAGAAGG - Intergenic
933855709 2:86412257-86412279 AGGGAGAAGAAGGAAGAAGGAGG - Intergenic
934743727 2:96744575-96744597 CGTGAGAGGAAGGATGGAGAGGG + Intergenic
934974183 2:98788905-98788927 ATTGAGAAGAAGAAAAAACAGGG - Intergenic
934982283 2:98852937-98852959 AGAGAGAAGAAGGAAGGAGAGGG + Intronic
935210403 2:100934997-100935019 AGAGAGAAGAGGGAAGAAGACGG - Intronic
935311901 2:101792627-101792649 AATAAGAAGAAGAAAGAAGAAGG - Intronic
935672735 2:105569849-105569871 AGTGAGGAGCAGGATGCAGAAGG + Intergenic
936061950 2:109300650-109300672 ATGGAGAAGGAAGAGGAAGATGG - Intronic
936731293 2:115384447-115384469 AAGAAGAAGAAGGAAGAAGAAGG + Intronic
936731294 2:115384457-115384479 AGGAAGAAGAAGGAAGAAGAAGG + Intronic
936910610 2:117588696-117588718 ATTGAGGAGAAGAATGAAATAGG - Intergenic
937217392 2:120321339-120321361 AGGGAGAAGAAGGAGGGAGAAGG - Intergenic
937453908 2:122025122-122025144 AAGGAGAAGAAGGTGGAAGATGG + Intergenic
937498280 2:122449383-122449405 AAAGAGAAGAAGGATCAAGATGG + Intergenic
937820958 2:126309907-126309929 AATGAGAATAAAGATAAAGAAGG - Intergenic
938734780 2:134176131-134176153 CTTGAGAGGAAGGCTGAAGGGGG + Intronic
939063356 2:137451137-137451159 TGTCAGAAGAAGGATTAAGAGGG + Intronic
939696898 2:145337453-145337475 ATTGAAAAGAAGAAAGGAGACGG + Intergenic
940218589 2:151327083-151327105 ATAAAGAGGAAGGATGAAAAAGG - Intergenic
940349515 2:152666253-152666275 AACAAAAAGAAGGATGAAGATGG - Intronic
941065965 2:160903123-160903145 AAAGAGAATAAGCATGAAGAAGG - Intergenic
941242214 2:163053555-163053577 AAGGAGGAGAAAGATGAAGAAGG + Intergenic
941642031 2:167999091-167999113 ATTGGGAATAAGGATGGGGAGGG - Intronic
942134468 2:172911206-172911228 ATTGAGAAGAAGCATCATCAGGG - Intronic
942214629 2:173706494-173706516 ATGGAGTAGAAAGAGGAAGAAGG - Intergenic
942898421 2:181086154-181086176 TTGGATAAGAAGTATGAAGAAGG + Intergenic
943088164 2:183340592-183340614 ATGGAGAAGAAGGTTCAGGAGGG - Intergenic
943365703 2:186965779-186965801 GTAGGGAAGAAGGATGAAGAGGG + Intergenic
943650546 2:190453386-190453408 ATTTAGAGAAAGGATGAAGTTGG + Intronic
943703259 2:191009489-191009511 ATTGATTAGAAATATGAAGAAGG - Intronic
944064703 2:195606631-195606653 ATGGAGAAGCAGGAACAAGAAGG + Intronic
944150703 2:196555057-196555079 ACTGAGAATAAGGATAAATATGG + Intronic
944777158 2:202978441-202978463 ACTGAAAAGATAGATGAAGATGG + Intronic
945497727 2:210529748-210529770 ATTGTGGAGATGGATGAGGATGG + Intronic
945708360 2:213264726-213264748 ATGGACAAAATGGATGAAGAAGG + Intergenic
945977685 2:216283456-216283478 TTTGAGGAAAAGGAAGAAGATGG - Intronic
946128431 2:217585336-217585358 AATGAGAAAAAGGAAAAAGATGG - Intronic
946471016 2:219961026-219961048 ATAAAGGAGAGGGATGAAGAGGG + Intergenic
946528533 2:220546585-220546607 AAGGAGAAGAAGAAAGAAGAAGG - Intergenic
946809119 2:223504188-223504210 AGCAAGAAGAAGGCTGAAGAAGG + Intergenic
947005415 2:225505881-225505903 AATGGGAAGAAGGATGAAGCAGG + Intronic
947227184 2:227852072-227852094 ATTCTGAATAAAGATGAAGAAGG + Intergenic
947830234 2:233134384-233134406 ATTTAGAGGAGGGATGGAGAAGG + Intronic
947907579 2:233776605-233776627 AGTGAGACCAAGGAGGAAGAAGG - Intronic
948344294 2:237282547-237282569 GGAGAGAAGAAGGAAGAAGAAGG + Intergenic
948426730 2:237892780-237892802 ATTGAGGAGAAGGAAGAAGTGGG - Intronic
948670470 2:239565209-239565231 GGTGTGAAGGAGGATGAAGAAGG + Intergenic
1169847083 20:10005607-10005629 GTTGGGAAGAAGGAAGAACACGG - Intronic
1170115985 20:12860026-12860048 CTTGATAAGAGGGATAAAGAAGG + Intergenic
1170691871 20:18623664-18623686 ATTCAGATGAAAGATGCAGACGG - Intronic
1171875258 20:30569550-30569572 AATGAGAATAAGGAAAAAGAAGG + Intergenic
1172001242 20:31779176-31779198 ATTGATGAGGAGGATCAAGACGG - Intronic
1172251533 20:33482854-33482876 AGTGACGAGAAGGATAAAGATGG - Intergenic
1172347346 20:34213157-34213179 ATGGAGGAGAAGGAGCAAGAAGG - Intronic
1173856663 20:46254670-46254692 ATTGAGAAGAAAAGTAAAGAAGG + Intronic
1174011660 20:47454639-47454661 AAGAAGAAGAAGGAAGAAGAAGG - Intergenic
1175438637 20:58974000-58974022 AAGAAGAAGAAGGAAGAAGAAGG + Intergenic
1175503321 20:59465496-59465518 ATGGGGCAGAAGGAGGAAGAAGG - Intergenic
1176893559 21:14348407-14348429 ATTGAGAAAAGGAAAGAAGACGG + Intergenic
1176900637 21:14437651-14437673 CTTGAGAACAAGAATGATGAAGG + Intergenic
1176936815 21:14876865-14876887 ACAAAGAAGAAGGAAGAAGAAGG - Intergenic
1177007021 21:15686160-15686182 TTTGGAAAGAAGGAAGAAGATGG + Intergenic
1178165696 21:29973603-29973625 ATTGAGAAGGAGGAAGGGGAGGG - Intergenic
1178225542 21:30713381-30713403 CTGGAGAGGAAGGATAAAGAAGG + Intergenic
1178643204 21:34363351-34363373 AGGAAGAAGAAGGAAGAAGAAGG - Intergenic
1178643205 21:34363361-34363383 AGGAAGAAGAAGGAAGAAGAAGG - Intergenic
1178643206 21:34363371-34363393 AGGAAGAAGAAGGAAGAAGAAGG - Intergenic
1178809401 21:35867620-35867642 ATTGAGAAGAAGCAGGGAGGTGG + Intronic
1179228373 21:39476711-39476733 ATTGAGAAGTAGTAGGAATACGG - Intronic
1179262341 21:39768966-39768988 TGTGAGAAGAAGGGTGAAAAAGG - Intronic
1180055327 21:45356031-45356053 ATTCAGAAGACAGAGGAAGAGGG + Intergenic
1181170112 22:21003362-21003384 AAGGAGGAGAAGGAGGAAGAAGG - Intergenic
1181710800 22:24686822-24686844 TTTGAAAAGAAAGATGGAGAGGG + Intergenic
1181734482 22:24870922-24870944 ATTGAGACAAAGGAAGAAAAGGG - Intronic
1182985447 22:34712073-34712095 ATTGGGAAGAAAGATGGACATGG - Intergenic
1184238925 22:43201536-43201558 ATAGAAAAGAAGGAGGAGGAAGG + Exonic
1184345969 22:43913155-43913177 AAGAAGAAGAAGGAAGAAGAAGG - Intergenic
1184345971 22:43913229-43913251 AGGAAGAAGAAGGAAGAAGAAGG - Intergenic
1184345972 22:43913239-43913261 AAGAAGAAGAAGGAAGAAGAAGG - Intergenic
1184952454 22:47853645-47853667 AGGAAGAAGAAGGAAGAAGAAGG + Intergenic
949269602 3:2199254-2199276 ACTGGGAAGAAGGAAGTAGAGGG - Intronic
949503555 3:4704910-4704932 ATTGAAAAGCAGGATGCACAGGG - Intronic
949792522 3:7808967-7808989 ATTAAGAAGAAGGATGACACAGG + Intergenic
949828793 3:8191640-8191662 AAGAAGAAGAAGGAAGAAGAAGG - Intergenic
950747797 3:15104565-15104587 AATGAGAAAAAGGATGAGGCTGG + Intergenic
950765803 3:15272135-15272157 TTTGTGAAGAAGGTTAAAGAAGG + Intronic
952185532 3:30963825-30963847 ATAGAGAGAAAGGATGAAGTTGG - Intergenic
953121409 3:40046177-40046199 AATGAGAAGAAGGAACTAGAAGG + Intronic
953173567 3:40529266-40529288 AGTGAGAAGTAGAAGGAAGAAGG - Intronic
953174988 3:40542760-40542782 ATAGAGAAGAAAGAAAAAGAAGG + Intronic
953390288 3:42529972-42529994 ACTGAGAAGAGGGTGGAAGAGGG - Intronic
953508811 3:43513824-43513846 ATTTAAAAGAAGGAAGAAAAGGG + Intronic
953919900 3:46944585-46944607 ATTGGGAAGGAGGGAGAAGATGG - Intronic
954005315 3:47585940-47585962 ATGGAGAAAATGAATGAAGAAGG - Exonic
954082860 3:48222623-48222645 ACAGTGAAGAAGGATGCAGAAGG + Intergenic
954783862 3:53079240-53079262 AATGAGAAGGAGGAAGAGGAAGG + Intronic
955986880 3:64582771-64582793 ATTGTGAATAGGTATGAAGAAGG - Intronic
956340150 3:68213386-68213408 ATTAAGCAGAAGGATGCAAAAGG - Intronic
956664640 3:71631044-71631066 AATGGGAAGAGGGATGAGGAAGG - Intergenic
956840240 3:73133318-73133340 ATTGAGGAAAAGGAGAAAGAAGG - Intergenic
957120340 3:76082428-76082450 AATGAGAAGCAGGAACAAGAGGG + Intronic
957200329 3:77126671-77126693 ATTGAGAAAAAGAAGGAATATGG + Intronic
957261392 3:77906519-77906541 ATGGAGAAGGAGGCTGAAGAAGG + Intergenic
957729634 3:84117097-84117119 AGAGAGAATAAGGATGAAGAAGG - Intergenic
957980191 3:87499069-87499091 ATTTAAAAGAAGGTTGAACATGG + Intergenic
958716982 3:97795705-97795727 ATTGAAAATAAGGATGAACGTGG + Intronic
958877735 3:99635039-99635061 ATGGAGAGGAGGGATGAGGAGGG - Intergenic
958915888 3:100049664-100049686 GCTGAGAAGGAGGAGGAAGAAGG - Intronic
958931410 3:100211930-100211952 AAAAAGAAGAAGGAAGAAGAGGG + Intergenic
959577719 3:107952286-107952308 ATTTAGAAGAAGAATAAGGAGGG + Intergenic
959603670 3:108219372-108219394 CTTGAGAACAAGGAAAAAGAAGG + Intronic
959795881 3:110427863-110427885 ATGGAGAAGAAGGAGGCTGAGGG - Intergenic
959931672 3:111990972-111990994 ACTGAAAAGAAAAATGAAGAGGG - Intronic
960072359 3:113445338-113445360 ATTGAGAAACAGAATGAAGAAGG - Exonic
960195861 3:114767493-114767515 ATTGAAAAGAAAAAGGAAGAAGG + Intronic
960427825 3:117530790-117530812 AAGGAGAAGAAAGATGAAGAGGG - Intergenic
960456780 3:117882198-117882220 ATGGAGAAGTAGGATAAACAAGG - Intergenic
960539409 3:118847253-118847275 ATTGAGAGTCAGGATGCAGAGGG - Intergenic
960547539 3:118933811-118933833 ATTGAGAAGCAGGAAGTAGAAGG - Intronic
961206259 3:125084465-125084487 ATTGAAAAGAAAGTTGAATAAGG + Intronic
961460078 3:127044541-127044563 CTTGGGAAGAAGGAAGAAAAGGG + Intergenic
961474774 3:127139883-127139905 ATTAAGAAAGAGGATCAAGAGGG - Intergenic
961704194 3:128771624-128771646 ATTTAGTAGAAGGCTGAAGGAGG + Intronic
962458070 3:135583538-135583560 ACTGTGAAGAAGTTTGAAGAGGG + Intergenic
962462024 3:135622952-135622974 CTTTAGTAGAAGGATGAAGTAGG + Intergenic
962537959 3:136348176-136348198 ATTTATTAGAAGCATGAAGAAGG + Intronic
963526370 3:146419731-146419753 ATTGTGAAGATGGAGGAAGGAGG - Intronic
964082399 3:152775270-152775292 GTGGAGAAGAATGATGAAGCAGG - Intergenic
964311355 3:155396623-155396645 ACTGAGAAGGAGGAAGAGGAGGG + Intronic
964374412 3:156035469-156035491 AAAGAGAAGAAGGAAGAAGAAGG - Intergenic
964713337 3:159695510-159695532 AGTGAGAAGAGAGATGAAGGTGG - Intronic
965184035 3:165439819-165439841 GATGAGAAGAATGAGGAAGAAGG + Intergenic
965711734 3:171562693-171562715 AGGAAGAAGAAGGAAGAAGAAGG - Intergenic
965711735 3:171562703-171562725 AGGAAGAAGAAGGAAGAAGAAGG - Intergenic
965711736 3:171562713-171562735 AAGAAGAAGAAGGAAGAAGAAGG - Intergenic
965882414 3:173401486-173401508 AATAAGAAGAAGGAAGAGGAGGG + Intronic
965951098 3:174309077-174309099 ATAGAGCAGAAGTGTGAAGATGG + Intergenic
966985884 3:185179960-185179982 GCTGAGAAGGAGGATGGAGAAGG + Intergenic
967139027 3:186537809-186537831 CTTGAAGAGAAGAATGAAGAAGG - Intergenic
967152117 3:186660112-186660134 ATAGAGAAGAAGCATCCAGACGG + Intergenic
967414956 3:189206141-189206163 AAAGAGAAGAAAGATAAAGAAGG - Intronic
967488550 3:190062123-190062145 ACTGTGATGAAGGATTAAGAAGG - Intronic
967580330 3:191145734-191145756 AGTGGGTAGAAGGAGGAAGAGGG - Intergenic
968022272 3:195403492-195403514 ATCCAGATGAAAGATGAAGATGG + Intronic
968344954 3:197995091-197995113 ATTGAGCAGGAGGAAGAGGAGGG - Intronic
970163016 4:13208331-13208353 ATTGAGAATAAGGAAAAACAAGG + Intergenic
970197736 4:13569206-13569228 ACAGAGAAGAGGAATGAAGAGGG + Exonic
970282877 4:14478026-14478048 AATGAGACAAAGGATTAAGATGG + Intergenic
970344752 4:15142841-15142863 ATTCAGAAGAAAGATAACGATGG + Intergenic
970432653 4:16002918-16002940 ATTGAAAAGGAGGAAGAGGAGGG + Intronic
970966624 4:21935491-21935513 ATTGAGAAGAAGCATTTAGTGGG - Intronic
971684272 4:29744767-29744789 ATTGAGAAAAAGGGGGAAAAAGG + Intergenic
971823821 4:31595494-31595516 CCTGAGAAGAAGGAAAAAGAGGG - Intergenic
972400236 4:38694924-38694946 CTTAAGAAGAAAGATGAAGTGGG - Intronic
972427610 4:38948911-38948933 AGAGAGAAAAAGGATAAAGATGG - Intergenic
972482432 4:39510093-39510115 ATTAAGAAAAAGGGTAAAGAGGG + Intronic
972861467 4:43174100-43174122 TAAGAGAAGAAGGAAGAAGAGGG + Intergenic
972947438 4:44273538-44273560 ACTGGGAAAAAAGATGAAGATGG + Intronic
973269282 4:48244782-48244804 TTTGAGAAGAAGGATGTTGCAGG - Intronic
973899199 4:55450430-55450452 AAAGAGAAGAAGAATGAAGTTGG + Intronic
974232689 4:59137273-59137295 CTTAATAAGAAGGATGCAGAGGG - Intergenic
974792260 4:66707382-66707404 ATTTTGAAGATGGAAGAAGAAGG - Intergenic
974844314 4:67332737-67332759 ATTGGGAAGAATAATAAAGAAGG + Intergenic
975050104 4:69852474-69852496 ATGGGGAAGAAGGAAGAAGCGGG - Intronic
975941756 4:79656565-79656587 ATAGTAAAAAAGGATGAAGAAGG - Intergenic
975969644 4:80017675-80017697 AATAGGAAGAAGGATGAGGAAGG + Intronic
976423086 4:84868233-84868255 ATTAAGAAGAAGAAAGAAAAAGG - Intronic
976830743 4:89310745-89310767 ACAGAGGAGAAGGATGAATAAGG - Intergenic
977280875 4:95038224-95038246 TTTGAGGAACAGGATGAAGAAGG + Intronic
977643453 4:99383788-99383810 ATTGAGAAGAAGGTCTTAGAAGG + Intergenic
977874652 4:102134709-102134731 ATTGAACAGATTGATGAAGATGG + Intergenic
977927059 4:102713298-102713320 AGGGAAATGAAGGATGAAGATGG - Intronic
978235815 4:106458543-106458565 AGGAAGAAGAAGGAGGAAGAAGG + Intergenic
978264777 4:106810417-106810439 AGGAAGAAGAAGGAAGAAGAAGG - Intergenic
978431630 4:108639308-108639330 AGAGAGAAGAAAGCTGAAGATGG - Intergenic
978804921 4:112789759-112789781 CTAGAGAAGAAGGAAGAATAAGG + Intergenic
979025707 4:115571853-115571875 ATGGAGAAGAAGGATGTACATGG + Intergenic
979231027 4:118349127-118349149 ATTGAGAAAAATGAGGAAGTTGG - Intronic
979534080 4:121799899-121799921 ATTGTGAAGAAGGAGGAAAGTGG - Intergenic
979768372 4:124490939-124490961 AATAAGAAGAAGGAAGAAGAAGG + Intergenic
979900850 4:126216014-126216036 AATGAAAGGAAGGATGACGAAGG + Intergenic
979909773 4:126348419-126348441 ATTGAGAAAAAACATGAAAAAGG - Intergenic
980190694 4:129520552-129520574 AAGAAGAAGAAGGAGGAAGAGGG + Intergenic
980218887 4:129888884-129888906 ATTGAGAACAGCTATGAAGAGGG + Intergenic
980425640 4:132624470-132624492 ATAGAGAAGAAGGAGAAGGAAGG - Intergenic
980425673 4:132624657-132624679 AATAAGAAGAAGGAAAAAGAAGG - Intergenic
980807843 4:137836954-137836976 ATTGAAGAGAGGGATCAAGATGG + Intergenic
980904685 4:138936898-138936920 ATAGAGAGAAAGGATGAAAATGG + Intergenic
981000940 4:139828659-139828681 ATGGAGACGAAGGTTGAAAATGG + Intronic
981532495 4:145765681-145765703 GCTGAGAGGGAGGATGAAGAGGG + Exonic
981733373 4:147922801-147922823 AATCAGGAGAAGGATGAAGAAGG - Intronic
982049652 4:151488046-151488068 GTTGAGAAGAGAGATGATGAAGG - Intronic
982226244 4:153170127-153170149 AAGGAGAAGGAGGAGGAAGAGGG + Intronic
983091469 4:163507765-163507787 ACTGAGAAGGAGGAGAAAGAAGG + Intronic
984128667 4:175844888-175844910 CCTAAGAAGAGGGATGAAGAGGG + Intronic
984680673 4:182605635-182605657 AATGGGAAGAAACATGAAGAGGG + Intronic
984864849 4:184272625-184272647 ATCAAGAAGAAGGAGGAAAAAGG - Intergenic
985608948 5:875857-875879 ACAGAGATGAAAGATGAAGATGG + Intronic
985679992 5:1250920-1250942 AAAGAGAAGAAGAAGGAAGAAGG - Intergenic
986391053 5:7288684-7288706 AAGAAGAAGAAGGAAGAAGAAGG - Intergenic
987191279 5:15480877-15480899 GTTGAGGAGGAGGATGAGGATGG + Intergenic
987736283 5:21847587-21847609 ATGCAGAAGAAGGAAGCAGAAGG - Intronic
988089602 5:26519532-26519554 AGGGAGAAGAAGGAGGAGGAGGG + Intergenic
988307461 5:29511216-29511238 ATTAAGAATAAGAATAAAGATGG - Intergenic
988554169 5:32222004-32222026 ATTGTGAAGAACAATGATGATGG + Intergenic
988901235 5:35734579-35734601 ATTGAGAAGAAGGAAGATTTAGG - Intronic
989146376 5:38254671-38254693 CTAGAGAGGAAGCATGAAGAGGG + Intergenic
989756221 5:44958788-44958810 ACGGAGAAGAAGGAAAAAGAAGG - Intergenic
990470655 5:56112200-56112222 AATGAGCAGAAGGATGGAGGAGG + Intronic
991137846 5:63204277-63204299 ATTAAGAAAAAGGAGAAAGATGG - Intergenic
991336614 5:65555283-65555305 AATGAGGTCAAGGATGAAGAGGG + Intronic
991398488 5:66229125-66229147 GTTGAGAAGGAGGAGGAGGAGGG + Intergenic
991552247 5:67851836-67851858 ATTGATAAGAGGGAAGGAGACGG + Intergenic
991651381 5:68858390-68858412 CTTGAGGAGAGGGATGGAGATGG + Intergenic
992078456 5:73213242-73213264 AAGAAGAAGAAGGAAGAAGAAGG + Intergenic
992101502 5:73412031-73412053 ATAGAATAGAAGGCTGAAGAAGG - Intergenic
992422641 5:76621972-76621994 ATGGAAAAGAGGGATGAGGAAGG - Intronic
992701652 5:79346998-79347020 ATTGCAAACAAGGATGAAAAAGG - Intergenic
992770150 5:80040055-80040077 ACTGGGAAGAAGGGAGAAGAAGG - Exonic
993271750 5:85806055-85806077 AGAGAGAAGAGGAATGAAGAGGG + Intergenic
993482125 5:88437145-88437167 AGTGTGTAGAAGGATGTAGAAGG - Intergenic
993551307 5:89277257-89277279 GTTGAGAGGAAGGCTGAAGAAGG - Intergenic
993815371 5:92538154-92538176 AATGAGATGAAGAATAAAGAAGG - Intergenic
994178209 5:96734984-96735006 ATTGAGAAGGAAGAGGAAGGTGG + Intronic
994371574 5:98973317-98973339 AATGAGGAGAAGGAAGAAGGAGG + Intergenic
994457041 5:100023861-100023883 AGTGACAAAATGGATGAAGAAGG - Intergenic
994816532 5:104593631-104593653 TTTGAGAGGAGGGATGTAGATGG - Intergenic
994956669 5:106541734-106541756 AATAAGAAGTAGGAGGAAGAGGG - Intergenic
995143272 5:108758018-108758040 ATTTTGAAAGAGGATGAAGATGG + Intronic
995594315 5:113731492-113731514 ATTGAGAGCAAGGAAGAACAGGG - Intergenic
995638597 5:114225350-114225372 ATATAGAAGAAGCATCAAGAAGG + Intergenic
995709361 5:115019355-115019377 ACTGTGATGAGGGATGAAGATGG - Intergenic
995747264 5:115416996-115417018 TTTGAGAAAATTGATGAAGATGG + Intergenic
996037231 5:118771924-118771946 ATTGGGAAGTAGGGTGAAGGAGG + Intergenic
996156549 5:120109810-120109832 CTTGAGAGGAAGGATGAAAAGGG + Intergenic
996529989 5:124518443-124518465 ATTGAGGAGGAGGCTGCAGATGG + Intergenic
996606568 5:125329977-125329999 AAGAAGAAGAAGGAAGAAGAAGG + Intergenic
996857053 5:128020000-128020022 ATTGAGAATAACACTGAAGATGG - Intergenic
998410465 5:141906712-141906734 AGGAAGAAGAAGGAAGAAGAAGG + Intergenic
998781707 5:145664365-145664387 ACTAAGAAGCAGAATGAAGAAGG + Intronic
1000126958 5:158254845-158254867 AGAGAGAAGAAAGATGGAGAAGG + Intergenic
1000238911 5:159390698-159390720 ATGGAGAAGAACTATGAAGTGGG + Intergenic
1000759800 5:165208091-165208113 ATTGCAGAGAAGGAGGAAGAAGG + Intergenic
1001149005 5:169210468-169210490 ATTGACAAAAACCATGAAGAAGG + Intronic
1001297661 5:170510069-170510091 AATGAGGAGATGGAGGAAGAGGG - Intronic
1001343045 5:170864612-170864634 ATTGAGAAGAAGTAAGAGGTAGG + Intronic
1001469541 5:172001099-172001121 ATAGAGAAGAAAGATGGGGAGGG - Intronic
1001594807 5:172891341-172891363 ATGGAGAAGAGGGAAGAGGATGG - Intronic
1001853999 5:174995041-174995063 ATGGAGAATAAGTATAAAGATGG + Intergenic
1002380578 5:178825351-178825373 GATGAGATGGAGGATGAAGAAGG - Intergenic
1003037752 6:2659855-2659877 ATGGAGAAGAAGGAGCCAGACGG + Intergenic
1003253066 6:4449443-4449465 GTGGAAAAGAAGGATGAGGAAGG + Intergenic
1004184544 6:13410802-13410824 AGTGAGGAGAAAGAGGAAGAAGG + Intronic
1004706952 6:18133485-18133507 ATTGGGAAGAAGGAGGAATGTGG - Intronic
1004716089 6:18217691-18217713 ATTATGAAGTAGGATCAAGAAGG - Intronic
1004881133 6:20009624-20009646 CTTGAAAGGGAGGATGAAGAGGG - Intergenic
1005033021 6:21529082-21529104 ATTGAAAAGGAGAAAGAAGAAGG - Intergenic
1005089501 6:22042190-22042212 AGTGGGGAGAGGGATGAAGAAGG - Intergenic
1005128299 6:22473589-22473611 AGTTAGAAAAAGGTTGAAGAAGG + Intergenic
1005330875 6:24749042-24749064 TTTGAGACTAAGGATGGAGATGG + Intergenic
1005690502 6:28300384-28300406 ATTGAGAAGACCTATGCAGAGGG - Intronic
1005857029 6:29870435-29870457 ATTGAGAAGCAGGAGGGTGAAGG + Intergenic
1005862848 6:29914586-29914608 ATTGAGAAGCAGGAGGGTGAAGG + Intergenic
1005925193 6:30438586-30438608 AGTGAGAGGAGGGATGAAAAGGG - Intergenic
1006343282 6:33459126-33459148 ATTGGGAAAGGGGATGAAGAGGG + Intergenic
1006606085 6:35259031-35259053 ATTGAAAAGGACGATGTAGAGGG - Intronic
1007041055 6:38722810-38722832 ATGGAGAAGGATGCTGAAGATGG + Exonic
1007436508 6:41816517-41816539 ATTGAGAAGAGAGCTGAGGATGG - Intronic
1007452609 6:41951603-41951625 AGAGAGAAGCAGGAAGAAGAGGG + Intronic
1007618487 6:43196803-43196825 ATTGAGAAGCATCATGAGGATGG - Exonic
1007954350 6:45902650-45902672 CTTTCTAAGAAGGATGAAGATGG + Exonic
1008347986 6:50453136-50453158 AATAAGAAGAAGGAAGAAAAGGG + Intergenic
1008397623 6:51027224-51027246 ATAGAGAGGAAGGGAGAAGAGGG + Intergenic
1008652067 6:53573841-53573863 ATTTAAAAGAAGGATGAGGCAGG + Intronic
1009441440 6:63684398-63684420 CTTGAAATGAAGGATGAAGATGG + Exonic
1009599394 6:65778905-65778927 ATTAAGCAGAATGAGGAAGATGG - Intergenic
1009738453 6:67710434-67710456 ATTCTGAAGATGGAGGAAGAGGG - Intergenic
1010977522 6:82332537-82332559 ATAGAGAAGAAGAAGGGAGAAGG - Intergenic
1011566497 6:88679034-88679056 GCTGAGAAGGAGGAGGAAGAGGG - Intronic
1011712823 6:90071946-90071968 ACTGAGGAGGAGGAAGAAGAGGG + Intronic
1011786319 6:90849228-90849250 AGTCAGAAGAAGGATGGAGAAGG + Intergenic
1012218493 6:96618619-96618641 AGTGAAAAGAAAGAGGAAGAAGG + Intergenic
1012449493 6:99339847-99339869 ATAGGGAACAAGGAAGAAGAGGG + Intronic
1013429315 6:110041696-110041718 AATGAACAGAAGCATGAAGAAGG - Intergenic
1013749551 6:113387435-113387457 ATTGCAAATAAGTATGAAGATGG + Intergenic
1013841400 6:114399117-114399139 AGGGAGAAGAAGGAGGAAGAAGG - Intergenic
1013892771 6:115044892-115044914 ATTGAGAGGAAGCATGGAAAGGG - Intergenic
1013899642 6:115139274-115139296 ACAGAGAAGAAGGATAAAGAGGG + Intergenic
1014240443 6:119012257-119012279 AATGAGAAGAAGAATCAATAGGG + Intronic
1014317304 6:119883952-119883974 CTTGAGAAGAAGGATGAGTCTGG + Intergenic
1014552617 6:122806660-122806682 CTGGAGAAGAAGAATGAACATGG - Intronic
1014619366 6:123646572-123646594 GCTGAGGAAAAGGATGAAGAGGG + Intergenic
1014961442 6:127691118-127691140 ATGGAGATGAAGGATAATGATGG - Intergenic
1015569803 6:134609188-134609210 ATTGAGAAGAATGGTGGTGAAGG - Intergenic
1015666524 6:135636118-135636140 AGGGAGAAGAAGAAGGAAGAAGG - Intergenic
1016251189 6:142044713-142044735 ATTGATAGGAAGGAGGAAGCAGG + Intergenic
1016341938 6:143071740-143071762 GAAGAGAAGAAGGAGGAAGAGGG - Intronic
1016794723 6:148105753-148105775 ATGGAGGAGAAGGAGGAAGATGG + Intergenic
1017275128 6:152557270-152557292 ATGGAAAAAAAGGATGAAAAGGG + Intronic
1017318589 6:153062055-153062077 ATTGAGAAGGTGGAGCAAGATGG + Intronic
1017602914 6:156102952-156102974 AATGGGAAGAAAGATGAAAATGG - Intergenic
1018038118 6:159898810-159898832 AGTAAGAAGAAAGAAGAAGAAGG - Intergenic
1018153207 6:160960058-160960080 ATTTAGAATGAGGAAGAAGAAGG + Intergenic
1018199330 6:161380624-161380646 AGTGGAAAGAAGGAAGAAGAAGG - Intronic
1018214566 6:161514446-161514468 ATGGGGAAAAAGGGTGAAGAAGG + Intronic
1018252251 6:161882677-161882699 GATGTGAAGATGGATGAAGAAGG + Intronic
1018267801 6:162043758-162043780 ATTGACAAGAAGGAAGCAGCAGG + Intronic
1019327636 7:446116-446138 ATGGAGAGGGAGGAAGAAGAGGG + Intergenic
1019629129 7:2037239-2037261 ATTTAGAAGAATGGAGAAGATGG + Intronic
1019841509 7:3450808-3450830 AGAGAGAAGAGGGATGAAGATGG + Intronic
1020561292 7:9730767-9730789 AATGAGAAGAAAGCTGGAGATGG + Intergenic
1021029633 7:15715413-15715435 GTTGAGAAGAACGAGTAAGAGGG - Intergenic
1021344687 7:19510612-19510634 ATTGACAAGAAGGAAGAATGGGG + Intergenic
1021410156 7:20320933-20320955 GATGAGAAGAAGAATGAAGTAGG + Intergenic
1022262173 7:28716869-28716891 ATTGACAATAAGGACTAAGAGGG - Intronic
1022306709 7:29153454-29153476 GAGGAGAAGAAGGAAGAAGAGGG - Intronic
1022684012 7:32577793-32577815 ATTGAAAAGAAGGCTGAAGAAGG + Intronic
1022762534 7:33371433-33371455 ATTGAGATGTAGGATGAAGGAGG + Intronic
1022771693 7:33480327-33480349 ATACAGAAGAAGGATAAAGAGGG + Intronic
1023097155 7:36672976-36672998 AAGCAGAAGAAGGATGAACACGG + Intronic
1023207692 7:37768736-37768758 AATGAAAAGAAGTAGGAAGAAGG + Intronic
1023214664 7:37848837-37848859 ATTCAGCAAAAGGAAGAAGAGGG - Exonic
1023220818 7:37918969-37918991 TGTGAGAAGAAGGATTAGGATGG - Intronic
1023784208 7:43689998-43690020 ATAGAAAACAAAGATGAAGATGG + Intronic
1024198990 7:47087827-47087849 ATTCTGAAGAAGGAGAAAGAGGG + Intergenic
1024557471 7:50615763-50615785 AGTGAGAAGAAGGTGGGAGATGG - Intronic
1024846255 7:53646173-53646195 AAGGAGGAGAAGGAGGAAGAAGG - Intergenic
1025228135 7:57181183-57181205 AATGAGGAGGAGGAGGAAGAGGG - Intergenic
1026547445 7:71336007-71336029 AGAAAGAAGAAGGAAGAAGAAGG - Intronic
1027299651 7:76817952-76817974 ATTTAGAAGAAGAAATAAGAAGG + Intergenic
1027359878 7:77396749-77396771 ATTCAGCAGAAGTATTAAGATGG - Intronic
1027367396 7:77472743-77472765 AAGGAGAGGAAGGATTAAGAGGG + Intergenic
1027453958 7:78364032-78364054 ATAGAGAAGAAGGAGGAGGGAGG - Intronic
1028654637 7:93190481-93190503 ATTGAGAAGACAGAAGAAGAAGG + Intronic
1028898175 7:96065324-96065346 ATGGAGAAGAAGGAGGACTATGG - Intronic
1028921374 7:96314101-96314123 AAGGAGAAGGAGGAGGAAGAAGG + Intronic
1029008168 7:97231736-97231758 ATTGAAAAGAATGGTGAAGCTGG + Intergenic
1029423678 7:100484153-100484175 ATGGAGAAGGGGGATGAAGCAGG + Intronic
1029455417 7:100668438-100668460 AGGGGGAAGAAGGAAGAAGATGG + Intergenic
1029799630 7:102933074-102933096 ATGGAGAAGAAAGAAGAAAAGGG + Intronic
1029930580 7:104366287-104366309 TTTGAGAAGATGGAGGAAGAGGG + Intronic
1030015282 7:105213204-105213226 ATAGAGCAGGTGGATGAAGAAGG + Intronic
1031165927 7:118226636-118226658 ATGGAGGAGGAGGAAGAAGAGGG + Intronic
1031264406 7:119566147-119566169 ATAGAAAAGAAGGATGAAAGTGG + Intergenic
1031484670 7:122312091-122312113 CTTGCGAAGACGGATGAGGAGGG + Intergenic
1031595460 7:123644751-123644773 ATTAAGAAGAATGATGTGGAAGG - Intergenic
1031878373 7:127167739-127167761 TCTGAGAAGAAGGAGGGAGATGG - Intronic
1031889648 7:127279179-127279201 ACTGAGGAGGAGGAGGAAGACGG - Intergenic
1032548957 7:132766638-132766660 ACTGAGAACAAAGATGAATAAGG + Intergenic
1032801344 7:135319513-135319535 ATTCAGAAGATGTTTGAAGAAGG + Intergenic
1033071569 7:138208087-138208109 GTTCAGAACAAAGATGAAGACGG - Intergenic
1033230213 7:139591481-139591503 ACAGGGAAGAAGGAGGAAGAGGG - Intronic
1033445837 7:141421203-141421225 ATTTAGAAGCATGATGGAGAAGG - Intronic
1033522514 7:142175518-142175540 AATGAGATGAGGAATGAAGAGGG + Intronic
1034721964 7:153301630-153301652 ATAGAGAAGAAGGCTGAATTGGG + Intergenic
1034865084 7:154634703-154634725 AAAGAGAAGAAGGAAGAAGAAGG - Intronic
1035257157 7:157637737-157637759 TTTCAGAAGAAGGATGAGGAGGG + Intronic
1035419682 7:158717224-158717246 TAGGAGAAGAAGGAAGAAGAAGG - Intergenic
1035419718 7:158717432-158717454 GAGGAGAAGAAGGAAGAAGAAGG - Intergenic
1035419745 7:158717571-158717593 GAGGAGAAGAAGGAAGAAGAAGG - Intergenic
1036938617 8:13030235-13030257 ATAGAAAAGGAGCATGAAGATGG - Intronic
1037277726 8:17199735-17199757 AGAAAGAAGAAGGACGAAGAAGG - Intronic
1037469627 8:19194680-19194702 ATAAAGAAGAAGAATGACGAGGG + Intergenic
1037920034 8:22799350-22799372 ATTGAGAATAAGGCTGGAAAGGG - Intronic
1038596517 8:28890816-28890838 ATTGAGAGGAGGGAGGAAGCAGG + Exonic
1039317344 8:36387998-36388020 AAGGAGAAGGAGGAAGAAGAAGG - Intergenic
1039390855 8:37179866-37179888 AGAGAGAAGAAGAAAGAAGAGGG - Intergenic
1042305624 8:67328839-67328861 TTTGAAAAGAAGGAGAAAGAAGG + Intronic
1042553478 8:70014780-70014802 AAGGAGAAGAAAGAAGAAGAAGG - Intergenic
1042560580 8:70070247-70070269 ACTGAGAAGAAGGAAGGAAAGGG - Intronic
1042707950 8:71681428-71681450 TTTGAGTAGAAGGGAGAAGATGG - Intergenic
1042908240 8:73796751-73796773 ATTTAGAAAAAGGATGGCGATGG - Intronic
1043765579 8:84127614-84127636 ATTAAGAAGAATAATGTAGAAGG - Intergenic
1043835306 8:85038512-85038534 AATGAGAAGTGGGAGGAAGAAGG - Intergenic
1043917129 8:85936158-85936180 ATGGGGAAGAAGGAAGAAAAAGG - Intergenic
1044068620 8:87727544-87727566 AGAGAGAAGAAGAATGAAGGAGG - Intergenic
1044789811 8:95835876-95835898 ATTGGGTAGAACCATGAAGAGGG + Intergenic
1044822974 8:96170125-96170147 AATGAAAAGAGGGAGGAAGATGG - Intergenic
1044903268 8:96971853-96971875 ATTGTGAAGAAGGATTAAAATGG + Intronic
1044953153 8:97452915-97452937 ATTGGAAAGAAGAAAGAAGAAGG + Intergenic
1045009132 8:97942834-97942856 AGTGAGAAGAAACATGAAAAAGG - Intronic
1045074088 8:98543229-98543251 AGCTGGAAGAAGGATGAAGAGGG + Intronic
1045147914 8:99368429-99368451 TTTGAAGAGAAAGATGAAGATGG - Intronic
1045840040 8:106569246-106569268 ATTGAGAAGAAAGAAGAAGGGGG - Intronic
1046518646 8:115296097-115296119 TTTCAGAAGATTGATGAAGAAGG - Intergenic
1046525713 8:115379998-115380020 AGAGAGAAGAAGGAGGAAGGAGG + Intergenic
1047126109 8:121962441-121962463 AGTGAGAAGTAGGGTGGAGAGGG - Intergenic
1047866478 8:129029492-129029514 ACGGGGAAGAAGGAGGAAGAAGG - Intergenic
1047880686 8:129189643-129189665 TTTGAGAAGATGGATGAACAAGG + Intergenic
1048986549 8:139737997-139738019 ATTGAGAGGAAGGACGCAGCAGG + Intronic
1049004570 8:139846516-139846538 AATAAGAAGAAAAATGAAGATGG + Intronic
1050058564 9:1680779-1680801 ATTAAGAAGAAGGAGGGACATGG + Intergenic
1050119756 9:2296101-2296123 CTTGAAAAGCAGGAAGAAGACGG + Intergenic
1050610221 9:7344507-7344529 ATTGAGACGGAGGCTGAAGGAGG + Intergenic
1050663243 9:7906869-7906891 TGGGAGAGGAAGGATGAAGATGG - Intergenic
1050714654 9:8509173-8509195 ATTGAGAAGCAAGAGGCAGAGGG + Intronic
1051159762 9:14193937-14193959 ATTGAGAGAGAGGATGTAGAGGG - Intronic
1051666978 9:19474823-19474845 ATTGATAAGGAGGAGGAGGAGGG - Intergenic
1052406837 9:28072033-28072055 ATGTAGAAGGAGGATGAAGATGG - Intronic
1052844229 9:33320894-33320916 ATTGAGAAAAAGGATTAAGTAGG - Intronic
1052929152 9:34042107-34042129 ATTGAGAATAAGACTGAAAATGG + Intronic
1052942924 9:34144706-34144728 TTTGATTAGAAGGGTGAAGAAGG + Intergenic
1053580548 9:39399494-39399516 ACTGAGAAGAAGGAGAAGGAGGG - Intergenic
1053845044 9:42227568-42227590 ACTGAGAAGAAGGAGAAGGAGGG - Intergenic
1054102135 9:60958299-60958321 ACTGAGAAGAAGGAGAAGGAGGG - Intergenic
1054584224 9:66948564-66948586 ACTGAGAAGAAGGAGAAGGAGGG + Intergenic
1055000990 9:71448171-71448193 AAGGTGAAGAAGGATTAAGAGGG + Intergenic
1055660105 9:78494735-78494757 AGCTAGAAGAAGGAGGAAGAAGG + Intergenic
1055716407 9:79122756-79122778 AAGGAGAAGAAGGAGGAGGAGGG + Intergenic
1056506929 9:87266240-87266262 CTTGAGAGGAAGGCTGAAGAAGG - Intergenic
1056513353 9:87327100-87327122 AGGAAGAAGAAGGATGAGGAGGG + Intergenic
1056697627 9:88873345-88873367 AAGAAGAAGAAGGAAGAAGAAGG + Intergenic
1057185543 9:93055642-93055664 ATGGAGAAGGAGGGTGAGGAAGG + Intergenic
1057459607 9:95248767-95248789 CTTGACAAGAGGGTTGAAGAAGG + Intronic
1057761411 9:97877655-97877677 CTGGAGAAGAAGAAAGAAGATGG + Intergenic
1057847506 9:98536893-98536915 ACTGAGGAGCAGGATGGAGAAGG - Intronic
1058059900 9:100484224-100484246 ATTTAGAAAAAAGATGATGATGG - Intronic
1058144973 9:101400433-101400455 ATTGAGACAAAGGATGGGGAAGG - Intronic
1058273371 9:103005349-103005371 GATGAAAAGAAGGATGAGGATGG + Exonic
1058357726 9:104104029-104104051 ACAGAAAAGAAGGATGAAAAAGG - Intronic
1058563027 9:106249883-106249905 AGGAAGAAGAAGGAAGAAGAAGG - Intergenic
1058805744 9:108589800-108589822 ATGGAGAACAAGAGTGAAGAAGG + Intergenic
1058805792 9:108590378-108590400 ATTGAGCAACAGCATGAAGAAGG - Intergenic
1058961424 9:109995900-109995922 ATGGAGAGGAAGGATGAGGCAGG + Intronic
1059046035 9:110867968-110867990 ACTGAGACGAAAGATGAAGGTGG - Intergenic
1059160674 9:112032099-112032121 AAGGAGAAGGAGGAGGAAGAAGG + Intergenic
1059309271 9:113377130-113377152 AGTGAGACGAAGGAGGGAGAGGG - Intergenic
1059940831 9:119358162-119358184 AATGAGAATAAGGATGAAGAGGG + Intronic
1060123144 9:121015281-121015303 ATAAAGAAGAAGGATTAAAAAGG + Intronic
1060497879 9:124131252-124131274 ACTGAGATAAAGGAAGAAGAAGG + Intergenic
1061148880 9:128817774-128817796 TTTGAGGACAAGGATGCAGACGG - Intergenic
1062638461 9:137503907-137503929 AGAAAGAAGAAGGAAGAAGAAGG + Intronic
1062638474 9:137504074-137504096 AAGAAGAAGAAGGAAGAAGAAGG + Intronic
1185619531 X:1444982-1445004 AGAGAGAAGAGGGAAGAAGACGG - Intronic
1185815174 X:3148334-3148356 TTGGAGAAGAAAGATGAAGAGGG + Intergenic
1185830057 X:3292881-3292903 AGGAAGAAGAAGGAAGAAGAAGG + Intergenic
1185937874 X:4279541-4279563 ATTGAGAAGGAAGAAGAGGAGGG - Intergenic
1185958494 X:4519244-4519266 AGTCAGAAGAAGGTGGAAGAAGG - Intergenic
1186576805 X:10775339-10775361 ATTGGAAAGAAGGAGGAAGATGG + Intronic
1186618375 X:11213268-11213290 ATTGATAAAAAGGATGCAGCTGG - Intronic
1186795802 X:13045016-13045038 ATTGATAAAAAGGATGCAGCTGG - Intergenic
1187344138 X:18447624-18447646 ATGGAGAACAAGGATGACAATGG - Intronic
1187672738 X:21684965-21684987 ACCCAGATGAAGGATGAAGAGGG - Intergenic
1188004938 X:25010777-25010799 AAAGAGAAGAAGGAAGAAGGAGG - Intronic
1188310461 X:28610878-28610900 ATTGAGCAGCAGGATGTAGAGGG + Intronic
1189112208 X:38303093-38303115 GTTGAAAAGAAGGAGGAAGAAGG - Intronic
1189327759 X:40123255-40123277 AGTGAGAACAAGGATTGAGAAGG + Intronic
1189783765 X:44541706-44541728 AATCAAAAGAAGGATGAGGAGGG + Intronic
1190072879 X:47293264-47293286 AGAGAGAAGAAGGAGGAAGAAGG + Intergenic
1190463141 X:50698826-50698848 AATGAGAGGAAGGGTGAAGGGGG + Intronic
1190795039 X:53733056-53733078 ACTGAGGAGGAGGAAGAAGAGGG - Intergenic
1191109872 X:56796089-56796111 AGGGACAAGAAAGATGAAGAGGG - Intergenic
1191785572 X:64914083-64914105 AGAGAGAAGAAGGAAGAGGAGGG - Intergenic
1191821800 X:65318383-65318405 AAGAAGAAGAAGGAAGAAGAAGG - Intergenic
1192273777 X:69609666-69609688 AGTAAGAAGAAGGAGAAAGAAGG - Intergenic
1192605043 X:72507532-72507554 GTTGTGAGGAAGGATGGAGATGG - Intronic
1193103012 X:77636968-77636990 AAAAAGAAGAAGGAAGAAGAAGG + Intronic
1193103030 X:77637055-77637077 AGAAAGAAGAAGGAGGAAGAAGG + Intronic
1193772967 X:85609556-85609578 ATTGAGAAGTAGGATGGTGGTGG + Intergenic
1194049027 X:89045301-89045323 AAGGAGAAGGAGGAAGAAGAAGG - Intergenic
1194440097 X:93921530-93921552 ATAGAGAAGCAGTGTGAAGAAGG - Intergenic
1194663122 X:96647987-96648009 ATTCAGTTGAAGGATGAAGGAGG - Intergenic
1194948198 X:100093045-100093067 ATTGAGAAAAAGGAATAAAAAGG + Intergenic
1195965315 X:110424774-110424796 GGTGAGAACAAGGATCAAGAAGG + Intronic
1196345627 X:114653658-114653680 ATAAAGAAGAAAGATGAACAAGG - Intronic
1197514722 X:127411530-127411552 AACGAGAAGAAGGAGCAAGATGG - Intergenic
1197816277 X:130501854-130501876 AATGAGAAGAAGGAATGAGAGGG - Intergenic
1198077648 X:133209950-133209972 CTTGAGAAGTAGTCTGAAGAAGG + Intergenic
1198479792 X:137030929-137030951 GTGGAGAATGAGGATGAAGAGGG - Exonic
1199013424 X:142783260-142783282 ATTGAAAAGGAGGAGGAAGGGGG + Intergenic
1199109926 X:143919733-143919755 AGAGAGAAGGAGGAAGAAGAAGG + Intergenic
1199178729 X:144825815-144825837 ATTGAAAAGCAGAAAGAAGATGG - Intergenic
1199609908 X:149604425-149604447 TATGAGAAGAAGGATGCACAAGG - Intronic
1200494971 Y:3871608-3871630 AGTGAGCAGAAGCAGGAAGATGG + Intergenic
1201146283 Y:11067085-11067107 AGGGAGAAGAAGGGAGAAGAAGG + Intergenic
1201146385 Y:11067399-11067421 AGGGAGAAGAAGGGAGAAGAAGG + Intergenic
1201300204 Y:12498611-12498633 AATAAGAAGAAGGAGGAGGAGGG - Intergenic
1201721396 Y:17101688-17101710 ATTGAGAAGGAAGAAGAGGAGGG - Intergenic
1202142163 Y:21736311-21736333 TTTGAAAAGAAGGAAGAAGAGGG - Intergenic
1202144702 Y:21767491-21767513 TTTGAAAAGAAGGAAGAAGAGGG + Intergenic
1202189981 Y:22231647-22231669 AGAGAGAAGATGGAGGAAGAAGG + Intergenic