ID: 928216651

View in Genome Browser
Species Human (GRCh38)
Location 2:29367043-29367065
Sequence TTGTATTTTCAAAAAGAGGA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 796
Summary {0: 1, 1: 0, 2: 7, 3: 58, 4: 730}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
928216651_928216653 -9 Left 928216651 2:29367043-29367065 CCGTCCTCTTTTTGAAAATACAA 0: 1
1: 0
2: 7
3: 58
4: 730
Right 928216653 2:29367057-29367079 AAAATACAAGCCGAGATATAAGG 0: 1
1: 0
2: 0
3: 6
4: 156
928216651_928216656 29 Left 928216651 2:29367043-29367065 CCGTCCTCTTTTTGAAAATACAA 0: 1
1: 0
2: 7
3: 58
4: 730
Right 928216656 2:29367095-29367117 TATCCATTTAATAATTTATCTGG 0: 1
1: 0
2: 1
3: 39
4: 468

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
928216651 Original CRISPR TTGTATTTTCAAAAAGAGGA CGG (reversed) Intronic
901748406 1:11390003-11390025 TTGTGTTTTCTTAAAGAGTAAGG + Intergenic
902702003 1:18178870-18178892 TTAGATTCTCAAAGAGAGGAAGG - Intronic
904639096 1:31908950-31908972 TTGTATTTTCAGAAAAAGAAGGG - Exonic
904721084 1:32509052-32509074 TTTTGTTTTCAAAACCAGGAAGG + Intronic
905065506 1:35177772-35177794 TAGAATTTTTAAAAAGTGGATGG - Intronic
905515388 1:38558580-38558602 TTGCATTTTTTAAAAGAGGAGGG - Intergenic
905571435 1:39009434-39009456 TTGTATTTTTCAATAGAGAAGGG + Intergenic
905699673 1:40001974-40001996 TTTTTTTTTTAAAAAAAGGAGGG - Intergenic
906333664 1:44909280-44909302 GTGAGTTTTCAGAAAGAGGATGG - Intronic
906386371 1:45372240-45372262 TTATTTTTTCAAAAATAAGATGG - Intronic
906422650 1:45683731-45683753 TTGTATTTTATTAGAGAGGAGGG - Intronic
907950087 1:59174511-59174533 TAGTAGTTTCCCAAAGAGGAAGG - Intergenic
908298657 1:62738999-62739021 GTGTATATTCTAAAAAAGGAAGG - Intergenic
908326740 1:63030335-63030357 TATTTTTTTCAAAAAGATGAAGG + Intergenic
908343810 1:63210780-63210802 TTTTCTTTTAAAAGAGAGGAGGG + Intergenic
908709598 1:67000296-67000318 TTTTTTTTTAAAAAAAAGGAGGG + Exonic
908727197 1:67189388-67189410 TTGGATTTTAAGAAAGAAGATGG - Intronic
909169557 1:72277672-72277694 TTCTCTTTTTAAAAAGAGCAGGG - Intronic
909469868 1:76014810-76014832 GTATAATTTCAAAGAGAGGAAGG + Intergenic
909534173 1:76717211-76717233 AACTATTTCCAAAAAGAGGAAGG + Intergenic
909754851 1:79212394-79212416 TTATATTTTAACAAAGTGGATGG + Intergenic
910516077 1:88061460-88061482 TTTTCTTTTGAAAAACAGGAAGG - Intergenic
910582575 1:88844683-88844705 TTGTATTTTTAAAAATAAGGCGG - Intergenic
910603079 1:89052054-89052076 TTTTACTTTCAATAACAGGATGG - Intergenic
910637682 1:89427516-89427538 TTTTATTTTCAATAACAGGGTGG + Intergenic
910987237 1:93017288-93017310 TTGTATTTTCTAATAGAGACGGG - Intergenic
911145074 1:94543594-94543616 TACTATTTTCAAGAAGAGGGAGG + Intergenic
911273203 1:95828691-95828713 TTATATTTTCAAAAAGAATTTGG + Intergenic
911356914 1:96834004-96834026 ATGTATTTACAAAAAAAGGAAGG - Intergenic
911779132 1:101853281-101853303 TTGTAATTTCCACAAGAGAAGGG - Intronic
911862597 1:102971854-102971876 TTGTTTTTTGAAGAAGAGGATGG - Intronic
911964397 1:104348315-104348337 TCATATTTTCAAGAAGAGAAGGG + Intergenic
912079663 1:105919532-105919554 TGGCTTCTTCAAAAAGAGGAAGG - Intergenic
912570845 1:110619813-110619835 TTGTATTTTTAGAATGCGGAAGG - Intronic
913214403 1:116608416-116608438 TAGTATTGTAAAGAAGAGGAAGG - Intronic
915233339 1:154462544-154462566 TTGTATTTTTTAATAGAGGTGGG + Intronic
915375236 1:155388621-155388643 TTGTATTGAGCAAAAGAGGAAGG - Intronic
915774347 1:158466246-158466268 TTGTATCTTCCAACGGAGGAAGG - Exonic
916475089 1:165161686-165161708 TTGTATTTTTAAAAATGGAATGG - Intergenic
916662968 1:166939034-166939056 TTGTATTTTTCAAGGGAGGAGGG + Intronic
916728559 1:167545629-167545651 TTGTATTTTCATAAAGAGGGTGG - Intronic
917005805 1:170416014-170416036 TTGTGTTTTCCCAAAAAGGAAGG - Intergenic
917514707 1:175697860-175697882 TTATATCTGCAAAATGAGGATGG - Intronic
917832047 1:178901572-178901594 TTGTATTTTTCAAAAAAGAAGGG - Intronic
918114918 1:181487538-181487560 TAGCATTTTTAAAAAGAGTATGG - Intronic
918422684 1:184379991-184380013 TTGTATTATAAAAAGGAGAAAGG - Intergenic
918769156 1:188531294-188531316 AAGTAATTTCAAAAAGAGGTGGG + Intergenic
919360379 1:196585307-196585329 TTATCTCTTCAAAGAGAGGATGG + Intronic
919447223 1:197722250-197722272 TTGTATTTTCTGAATGAGAAAGG + Intronic
919973347 1:202594874-202594896 TTTTATTTTAAAAAGGGGGAAGG - Exonic
920405350 1:205705090-205705112 TTTTCTTTTTAGAAAGAGGAAGG + Intergenic
920625069 1:207588968-207588990 TTGTATTGTAAACCAGAGGAGGG + Intronic
921604736 1:217139594-217139616 TTATATTTTCAAAAAGTTCAGGG - Intergenic
922111704 1:222564666-222564688 TTTTCTTTTAAAAAATAGGAAGG + Intronic
922183394 1:223253976-223253998 GTGGATTTGCAAAAATAGGAGGG + Intronic
922315452 1:224437639-224437661 TTGTATTTTTAAAAATAAGGTGG + Intronic
922944430 1:229499595-229499617 TTTTATTTTTAAATAGAGGTGGG - Intronic
923124564 1:231023632-231023654 TTTTCTTTTCACATAGAGGAGGG - Intronic
923559862 1:235030826-235030848 TTGTATTTTTACAAAGAGACAGG - Intergenic
924226331 1:241924857-241924879 TTGGATTTTCAGCAGGAGGAGGG + Intergenic
924334094 1:242969467-242969489 CTGTGTTTTCAAAAAAAGGGTGG + Intergenic
924520071 1:244798365-244798387 TTTTCTTTGTAAAAAGAGGAGGG - Intergenic
924584315 1:245348529-245348551 TTGTGTTTTCACACAGTGGAGGG + Intronic
1063799349 10:9555218-9555240 TTATATTTTGAAAAACAGGTAGG + Intergenic
1063799484 10:9556635-9556657 TTGTATTTTTAAGAAGAGACAGG + Intergenic
1063898063 10:10702878-10702900 TTATATTTTTAAAAAGGGGTTGG - Intergenic
1064618052 10:17183588-17183610 TTGTATTTTTAGAAAGAGACAGG + Intronic
1064711469 10:18130645-18130667 TCGTATTATCAAATTGAGGAAGG - Intergenic
1064769720 10:18711156-18711178 TTGTATTTTCAAGTAGAGATGGG + Intergenic
1064932823 10:20645873-20645895 TTGTGTTTTCAAAGAGACAATGG + Intergenic
1065098715 10:22311163-22311185 TTATATCTTTAAAAAGAGGGAGG - Intergenic
1065280487 10:24132776-24132798 TTCTATTTTCAAAAAGACACCGG + Intronic
1065335036 10:24648465-24648487 ATGTATTTTTAAAAAGAAGATGG - Intronic
1065812263 10:29452977-29452999 TTTTCTTTTCAAAAAGAGGAAGG + Intergenic
1066414087 10:35203380-35203402 TTGTTTTTTTAAAAAAAGGGTGG - Intronic
1066574148 10:36806928-36806950 TTGTTTTTTAAAAAAGAGTTCGG - Intergenic
1067211664 10:44264720-44264742 TTGCATTTTCAAAATGATGATGG + Intergenic
1067257022 10:44651363-44651385 TTGTAGTTTCCAAATCAGGAAGG - Intergenic
1067480108 10:46589380-46589402 TTGTATTTTCAAGTAGAGACGGG + Intronic
1067522516 10:47019045-47019067 TGTTTGTTTCAAAAAGAGGAAGG + Intergenic
1067614630 10:47752419-47752441 TTGTATTTTCAAGTAGAGACGGG - Intergenic
1067734496 10:48838553-48838575 TTTTTTTTTCAAAAAGATAATGG - Intronic
1068143285 10:53032158-53032180 TATTATTCTTAAAAAGAGGAAGG + Intergenic
1069342440 10:67427480-67427502 TTGAATTTTTACAAAGAGAAGGG - Intronic
1069420888 10:68245508-68245530 TTTTTTTTTTAAAAAAAGGAGGG + Intergenic
1069515281 10:69072318-69072340 TTGTATTTTTTAAAAGAGATGGG - Intergenic
1069852659 10:71420173-71420195 TGGTATTTTAGAAAAGAGAAAGG - Intronic
1070197486 10:74172515-74172537 TTGTATTTTTAATAAGAGATGGG - Intronic
1071130501 10:82387318-82387340 TTGTATTTTCAAGGAAAGAATGG + Intronic
1071131571 10:82399633-82399655 GTGTCTTTTTAAGAAGAGGAAGG - Intronic
1071183226 10:83011059-83011081 CTGTATATTTAAAAAGAGTAAGG + Intergenic
1071549865 10:86558393-86558415 TTGTATTTCCAATAAGAAAAGGG - Intergenic
1071630034 10:87212387-87212409 TTGTATTTTCAAGTAGAGACGGG - Intergenic
1071831833 10:89379859-89379881 TTGTATTTTTTAGAAGAGGCGGG - Intronic
1072096692 10:92188545-92188567 TTGTATTTTTAAATAGAGACGGG - Intronic
1072975566 10:100054541-100054563 TTTTATCTTCACAAAGATGATGG + Intronic
1073610102 10:104934738-104934760 TTATAATTCCAAAAGGAGGATGG - Intronic
1074349763 10:112724773-112724795 TTTTTTTTTCAAAAAAAGGGGGG - Intronic
1074647747 10:115481290-115481312 TTTTGTTTTAAAAAAGAGCAAGG + Intronic
1077985661 11:7348716-7348738 TTGTATTTTCAAAGTGCGGATGG + Intronic
1078660239 11:13279628-13279650 TTGTATTTTCAAAAATATTTGGG - Intronic
1078835773 11:15027845-15027867 TTTTATTTTCAAAATGAAAAAGG + Intronic
1079120361 11:17679390-17679412 TTGTATTTTTCAATAGAGGCAGG + Intergenic
1079378574 11:19916796-19916818 TTTTATTTACAAAAATAGGTGGG + Intronic
1080301596 11:30790983-30791005 TTGTATTTTTTAAAAGAGACGGG + Intergenic
1080739239 11:35048546-35048568 TTGTGTTTTAAAAAAGAGACTGG + Intergenic
1081161154 11:39750493-39750515 TTGTTTTTTTAAAAACATGAAGG + Intergenic
1081456636 11:43229700-43229722 TTTGATTCTCAAACAGAGGAGGG - Intergenic
1081717848 11:45263520-45263542 TTGAACTTTAAAAAAGGGGAGGG + Intronic
1081985909 11:47304037-47304059 TTGGATTTCCAAAGAGAGAAGGG - Intronic
1082085025 11:48043220-48043242 TTTTATTTTTAAAGAGAGGCAGG + Intronic
1082738169 11:56880330-56880352 TGGTATTTCTAAATAGAGGATGG + Intergenic
1083567944 11:63736355-63736377 TTGTATTTTCAATCCGAGGTTGG - Intronic
1084695983 11:70755861-70755883 TTGTATTTCCAACAATCGGAGGG - Intronic
1085072352 11:73558772-73558794 TTATTTTTTAAAAAAGAAGAAGG + Intronic
1085370668 11:76001651-76001673 TAGTATTTTAAAAAACATGATGG + Intronic
1086007893 11:82061752-82061774 TTATATTGTTAAAAAGTGGAAGG - Intergenic
1086028641 11:82326143-82326165 ATGTATTTTAAAAAAGAAAAAGG + Intergenic
1086428453 11:86711640-86711662 TGGTTTTTTAAAAAAGTGGAGGG + Intergenic
1087174878 11:95087665-95087687 TAGTTTTTTTAAAAAAAGGAGGG - Intergenic
1087456138 11:98388917-98388939 TTATATTTTCAAAAGGAAGGAGG + Intergenic
1087937264 11:104049571-104049593 TTGTATTGTTAAAAATAGAAGGG + Intronic
1087991078 11:104745630-104745652 CTGAATTTACAAAGAGAGGAAGG - Intergenic
1088236769 11:107733172-107733194 ATGAATTTGCAAAAAGATGAAGG + Intergenic
1088314687 11:108496157-108496179 TTATATTTTTAAAATGGGGATGG + Intronic
1089025451 11:115265124-115265146 GTGTATATTCAAGAAGGGGAGGG - Intronic
1089301132 11:117499200-117499222 ATGTATTTTTAAAAAAAGGAAGG - Intronic
1089636444 11:119816635-119816657 TTGAATTTTTAAAAGGGGGAAGG - Intergenic
1089892817 11:121898466-121898488 TTGTATTTTCCAAAGAAAGATGG + Intergenic
1089894014 11:121909166-121909188 TTATCTTTTCTGAAAGAGGAGGG + Intergenic
1090577401 11:128121189-128121211 TTCTAGTTTCATAAAGTGGAAGG - Intergenic
1090698109 11:129269097-129269119 TTGTATTTTTAAATAGAGATGGG - Intronic
1090743133 11:129684498-129684520 TTGTTTTTTCAAAGAGACTATGG + Intergenic
1090824591 11:130375478-130375500 TTCCATTTTTAAAAAGAAGATGG + Intergenic
1093258026 12:16896583-16896605 TTCTATTTTCATAATAAGGAAGG - Intergenic
1093622313 12:21306496-21306518 TTGTATTTTTTAATAGAGGTGGG + Intronic
1093858761 12:24137457-24137479 TTGTATTTTTAAATAGAGACGGG - Intergenic
1093888981 12:24496857-24496879 TTGTATATTCATAAAGAGCAAGG - Intergenic
1094786627 12:33855993-33856015 TTGTATTTTCAAAAAAAATTTGG + Intergenic
1095251823 12:39988464-39988486 TTATATTTAAAAAAAGAGGAAGG + Intronic
1095438349 12:42216406-42216428 GGATATTTTCAAAAAGAGGGGGG - Intronic
1095480990 12:42635523-42635545 TTTTATTTTCAAAAGAAGGGGGG - Intergenic
1095575356 12:43731604-43731626 TTGTTTAATAAAAAAGAGGAGGG + Intronic
1096739443 12:53681653-53681675 TGGTTTTTTAAAAAGGAGGAGGG - Intergenic
1097505669 12:60466215-60466237 TTGTCTTTATAAAAAGAGAAGGG + Intergenic
1097631418 12:62068138-62068160 TTGTATTTTCAAAGTGAGGAAGG - Intronic
1097657060 12:62378242-62378264 TGGTATTTTCAAGATGAGGGTGG + Intronic
1097884258 12:64712948-64712970 TTTTATTTTCAAAAACAAGTAGG - Intergenic
1098366934 12:69713365-69713387 TAGTATTTTCAAGAATTGGAGGG - Intergenic
1098394563 12:70004589-70004611 TTGTATTTTTTAGAAGAGGTGGG - Intergenic
1098609925 12:72444025-72444047 CTTTATATGCAAAAAGAGGAAGG - Intronic
1098971451 12:76861372-76861394 TTTTTTTTTTAAAAAAAGGAGGG + Intronic
1099294361 12:80811673-80811695 TTGTATTTTCAGAGTGTGGAAGG - Exonic
1099579543 12:84426001-84426023 GTGTATTTTGAAAAGGAGGTAGG - Intergenic
1099660733 12:85557479-85557501 TTTTATTTTCAAAAACAAAAAGG - Intergenic
1099960342 12:89391169-89391191 CTGGATTTTCAAGTAGAGGAAGG + Intergenic
1100686167 12:96988228-96988250 TTGTATCTTCTAAAATGGGAAGG + Intergenic
1100935802 12:99664510-99664532 TGGCATTTTCAAAAAGCTGAGGG + Intronic
1101064426 12:101004605-101004627 TTGTATTATAGAAAAGAGTAAGG + Intronic
1102541602 12:113623547-113623569 TTATTTTTTGAAAAAGAGAATGG - Intergenic
1103302624 12:119939712-119939734 GTCTATTAACAAAAAGAGGAGGG - Intergenic
1103449400 12:121017657-121017679 TTCTATTTCAAAGAAGAGGAAGG + Intergenic
1103821970 12:123706055-123706077 ATCTATTTTGAGAAAGAGGAGGG - Intronic
1104422697 12:128650416-128650438 TTTTATTTTTAAAAAAAGGTGGG + Intronic
1105218135 13:18301926-18301948 TAGTATTGTAAAGAAGAGGAAGG - Intergenic
1106202346 13:27550220-27550242 CTTTATTTTCAAAAAGATAATGG + Intronic
1106274008 13:28186083-28186105 TTGTATTTTGAAAACGGGGAAGG + Intronic
1106739277 13:32621758-32621780 TTTTATTTAGAAAAAGAGGCAGG - Intronic
1107163747 13:37262333-37262355 TTATATTTTCAAAGTGAGAAAGG - Intergenic
1107870359 13:44740846-44740868 TTTTATTTTTACAAAAAGGAAGG - Intergenic
1107888019 13:44890802-44890824 TATTTTTTTCAAAAAGAAGAGGG + Intergenic
1108020123 13:46119860-46119882 TTGTATGTACAAATAGAGAATGG + Intergenic
1108705193 13:52979106-52979128 TTGTCTTTTCAAAATGCTGAGGG + Intergenic
1109286536 13:60415975-60415997 TTCTATTTTTAAATAGGGGAAGG - Intronic
1109329341 13:60908798-60908820 ATTTATTTTTAAATAGAGGAGGG - Intergenic
1109831592 13:67798184-67798206 TTGTCTTCTCCCAAAGAGGAAGG + Intergenic
1110430900 13:75421973-75421995 TTGTTTTTTCAACTAGAGGTGGG + Intronic
1110653379 13:77969337-77969359 TTGTTTTTTCCAATAGAGTAAGG + Intergenic
1110967434 13:81717463-81717485 TTATATTTTTGAAATGAGGAAGG - Intergenic
1111201064 13:84937657-84937679 TTGTATTTTTAAATAGAGACGGG - Intergenic
1111359028 13:87149588-87149610 TTGCATTTTCAAGAAAAGCATGG + Intergenic
1111720066 13:91932163-91932185 TTGTATTTTCAGAAAGAGACTGG + Intronic
1111816174 13:93156239-93156261 TTATATTTTAAAAGAGAGGAAGG + Intergenic
1111896994 13:94154564-94154586 TGGTATTTTCACAGAGAGCAAGG + Intronic
1112629569 13:101146012-101146034 TTGTATTTCCACATATAGGAGGG - Intronic
1112678075 13:101727870-101727892 TGGTATTTTCAAAAAGATCAAGG - Intronic
1112707001 13:102081575-102081597 TTTTTTTTTTAAAAAGAGCAGGG - Intronic
1113075197 13:106461216-106461238 TTTTTTTTTAAAAAAAAGGAAGG + Intergenic
1113374300 13:109750028-109750050 TAGCATGGTCAAAAAGAGGATGG - Intergenic
1113477295 13:110593248-110593270 TTGTATTTTTTAATAGAGGTGGG - Intergenic
1114073822 14:19139434-19139456 TAGTAATTTTAAAATGAGGATGG - Intergenic
1114088443 14:19260551-19260573 TAGTAATTTTAAAATGAGGATGG + Intergenic
1114355214 14:21900225-21900247 TTGTTTTTTAAAGAAGAAGAAGG - Intergenic
1115502479 14:34061526-34061548 TTTTATTTTCCAAAACAAGAAGG - Intronic
1115682613 14:35758493-35758515 TTCTATTCTTAAAAAGAGAAGGG + Intronic
1115805133 14:37042462-37042484 TTCTATTTTAAAAAAGAAAATGG - Intronic
1115939607 14:38593448-38593470 TCTCATTTTGAAAAAGAGGAAGG - Intergenic
1116585249 14:46695218-46695240 TTATATTTTAAAAATGAGAATGG - Intergenic
1116595951 14:46845054-46845076 TTGTATTTTTAAATAGAGACGGG + Intronic
1117478938 14:56124129-56124151 TTTTATTTTCCAGAAGATGAAGG - Intronic
1117839456 14:59844045-59844067 CTGTATTCTCACAAAGAGGCAGG - Intronic
1117921798 14:60732468-60732490 TAGTATTATCTAAAAGAGGCGGG - Intergenic
1118672959 14:68150114-68150136 TTGTATTTTTAACAAGAGACAGG + Intronic
1118894363 14:69933252-69933274 ATTTATTTTCAGAAACAGGATGG + Intronic
1119441695 14:74632657-74632679 TTGTACATTAAAAAAGAGTAAGG - Intergenic
1119560731 14:75587495-75587517 TTGTATTGTCAAGAAGGTGAGGG + Intronic
1119579209 14:75760684-75760706 TTATTTTTTAAAAATGAGGATGG + Intronic
1119669098 14:76505381-76505403 TTGATTTTTCAAAAACAGTATGG + Intergenic
1119946027 14:78695370-78695392 TTGAATCTACAAAAAGAGAAAGG - Intronic
1120183685 14:81370599-81370621 TTGCCTTTTCAATAAGAGGGAGG - Intronic
1120188293 14:81417044-81417066 TTGATTTTTACAAAAGAGGAAGG - Intronic
1120257060 14:82134033-82134055 TTGAATCTGCAAAAAGAGAAAGG - Intergenic
1122711347 14:103660615-103660637 TTGTATTTTTTAATAGAGAAGGG - Intronic
1122776748 14:104120309-104120331 TTGTCTTTTCCACAAGAGAAAGG + Intergenic
1123126370 14:105949000-105949022 TTAAATTTCCTAAAAGAGGAAGG + Intergenic
1123451125 15:20359390-20359412 TTGGCTTTTTAAAAAGAAGAAGG - Intergenic
1124399711 15:29337464-29337486 TTGTAATTTCCAGAAGGGGAAGG + Intronic
1124406595 15:29398412-29398434 TTCTTTTTTAAAAGAGAGGATGG - Intronic
1124903480 15:33846187-33846209 TTGGGTTTCCAAAAAGAGCATGG + Intronic
1125366115 15:38918346-38918368 TTATATGTTCAACAACAGGATGG + Intergenic
1125466978 15:39963011-39963033 TTGTATCTCCTTAAAGAGGAAGG - Intronic
1126156702 15:45572829-45572851 TCCTATTACCAAAAAGAGGAAGG - Intergenic
1126586980 15:50298654-50298676 TGTTATTTTCAAAAAGAGGCTGG + Intronic
1126927747 15:53609426-53609448 TTGTATTTTCAGATAGAGGGGGG + Intronic
1126930293 15:53640511-53640533 TTGTATTTTTAGAAAAAGAATGG - Intronic
1127119942 15:55762880-55762902 TTGTATTTTTTAGTAGAGGAAGG - Intergenic
1127234252 15:57031094-57031116 TTGTATTCTCAAAAGGAATAGGG + Intronic
1127550527 15:60033372-60033394 TTGTATTGGCAGAAAGAGTATGG + Intronic
1127644360 15:60945171-60945193 TTGGATTTTCAGAGAGAGGGTGG - Intronic
1128115055 15:65100070-65100092 TTGTATTTTTTAATAGAGGCAGG - Intronic
1128317815 15:66672081-66672103 TTGTATTTTTATAAAGACGGGGG - Intronic
1129768168 15:78183278-78183300 TTATGTTTACAAAAAGAGGCCGG + Intronic
1130007183 15:80110992-80111014 TTCTATTATCTAAAAGAGCAAGG + Intronic
1130177318 15:81587246-81587268 TAGTATTTTCAAATTGTGGAAGG - Intergenic
1130721924 15:86395931-86395953 TTGTATCTTCAAAAAGGCTACGG + Intronic
1130721997 15:86397126-86397148 TTGTATCTTCAAAAAGGCTACGG + Intronic
1131089602 15:89612943-89612965 TTGTATTTTAAATAACAGGGGGG + Intronic
1131661295 15:94520593-94520615 TAGAATTTGAAAAAAGAGGAGGG - Intergenic
1131708560 15:95026056-95026078 TTTTATTTACAAAAACAGGTGGG - Intergenic
1132288436 15:100682808-100682830 TCATATTTTCAGCAAGAGGAAGG - Intergenic
1133197224 16:4179671-4179693 TTGGAATTTAAAAAAGAGTATGG - Intergenic
1133576905 16:7100293-7100315 TTTTATTTTCAGAAAGAGTCAGG - Intronic
1135598205 16:23759622-23759644 TTTTTTTTTTAAAAAGAGGTGGG + Intergenic
1135735566 16:24929162-24929184 TTTTTTTTTTAAAAAGAGGCAGG + Intronic
1136010610 16:27361141-27361163 CTGTATATTAAAAAAAAGGAGGG - Intronic
1136191614 16:28618861-28618883 TTCTATTTGCAAAATAAGGATGG - Intronic
1136340635 16:29640799-29640821 TTGTATTTTTAAATAGAGACAGG - Intergenic
1136391324 16:29966503-29966525 TTCTAATTTTAAAATGAGGAAGG - Intronic
1136706598 16:32194084-32194106 ATGTATTTTCAGAAAGAGATTGG - Intergenic
1136761313 16:32735333-32735355 ATGTATTTTCAGAAAGAGATTGG + Intergenic
1136777161 16:32878084-32878106 GTATATTTCTAAAAAGAGGAAGG - Intergenic
1136806790 16:33135053-33135075 ATGTATTTTCAGAAAGAGATTGG - Intergenic
1136893460 16:33983429-33983451 GTATATTTCTAAAAAGAGGAAGG + Intergenic
1137995287 16:53204224-53204246 ATAAATTTTCAAAAAGAGAAGGG - Intronic
1138923814 16:61566466-61566488 TTTTATTTATAAAAAGAGGTAGG - Intergenic
1139279848 16:65761022-65761044 TTGTCTTTTCAAAAAGTGTCAGG + Intergenic
1139894942 16:70280999-70281021 TTGTATTTTTAATAAGAGACAGG + Intronic
1140996419 16:80264162-80264184 TTTTTTTTTCAAAAAGAGATGGG + Intergenic
1141378046 16:83549720-83549742 TTGAATTTCCAATAAGAGAAAGG + Intronic
1142014418 16:87736951-87736973 TTATATTTTTAATAAGAGGCAGG - Intronic
1142331554 16:89457423-89457445 TTGTATTTTCAAGTAGAGACAGG - Intronic
1203063465 16_KI270728v1_random:995650-995672 ATGTATTTTCAGAAAGAGATTGG + Intergenic
1203079576 16_KI270728v1_random:1140193-1140215 GTATATTTCTAAAAAGAGGAAGG - Intergenic
1143089059 17:4437958-4437980 TTGTATTTTTAAATAGAGATGGG + Intronic
1143638215 17:8178856-8178878 TTGTATTTTTAAATAGAGACGGG - Intergenic
1143716763 17:8777589-8777611 TTGAATTATCCCAAAGAGGATGG + Intergenic
1143989105 17:10941702-10941724 TTTTATGCTCAGAAAGAGGAGGG - Intergenic
1144213539 17:13034974-13034996 TTCTATTTCCAAAAAGAACAGGG - Intergenic
1144274709 17:13654959-13654981 TTTTATTTTGTAAAACAGGAAGG + Intergenic
1144467840 17:15510754-15510776 TTTTATTTTTAAAAAGATAATGG + Intronic
1146251812 17:31352841-31352863 TTGTCTTTTCAAAGAAAGCACGG - Intronic
1146556595 17:33830344-33830366 TTTTATTTTGACAAAAAGGAGGG - Intronic
1146776361 17:35620810-35620832 TTGTATTTTTTTAAAGAGGCAGG - Intronic
1147396181 17:40144672-40144694 TTTTTTTTTAAAAAAGAGGCAGG + Intronic
1147850386 17:43437965-43437987 CTTTATTTACAAAAACAGGATGG + Intergenic
1147954539 17:44124970-44124992 CTGTATTTTAAAAAAGAGGCCGG + Intergenic
1149920213 17:60650950-60650972 TTTTATTTTTAAAGAGATGAGGG - Intronic
1150141543 17:62734009-62734031 TTGTATTTTTAAGTAGAGGCAGG - Intronic
1150629717 17:66870805-66870827 TTGTATTTTTAAATAGAGATGGG - Intronic
1150765686 17:68000113-68000135 TTGTATTTTCAGTAAGAGATGGG - Intergenic
1153317253 18:3736599-3736621 TAGACTTTTCAAAAAGAGGTTGG - Intronic
1153780583 18:8492003-8492025 TTGTATTTTTAAACAGAGACAGG - Intergenic
1153812464 18:8764154-8764176 TTCTACTTTGAAAAAAAGGAGGG + Intronic
1155535454 18:26811828-26811850 TTGTATTTTTAAACCAAGGAAGG + Intergenic
1155566226 18:27137675-27137697 TTGTATTTTTAAAAAACGGGTGG + Intronic
1155952434 18:31927981-31928003 TTGTATTTTTAATAAGAGACGGG - Intronic
1156182174 18:34617978-34618000 TTATATTATCAAAAAGATGAAGG - Intronic
1156579982 18:38363653-38363675 TTGTGTTTTCAAATGGTGGAAGG - Intergenic
1156581535 18:38382239-38382261 TTGTGTTTTCAAATGGTGGAAGG + Intergenic
1156735236 18:40249385-40249407 TTGTATTCTGAAAGAGAGGGTGG + Intergenic
1157848104 18:51022654-51022676 TCTTATTTTAAAAAAAAGGACGG - Intronic
1157991944 18:52507785-52507807 TTGTATTTTCTAATAGCAGAGGG - Intronic
1158402302 18:57132110-57132132 TTTTTTTTTCAACAAAAGGAAGG + Intergenic
1158616392 18:58991677-58991699 TTGTTTTTTAAAAAAGAACAAGG + Intergenic
1158768115 18:60480394-60480416 TTGTATTTTTAAATAGAGACAGG + Intergenic
1159078558 18:63709182-63709204 TTCTATTTTCATAAACATGATGG + Intronic
1159200400 18:65176041-65176063 TTGAATTTACAAAATCAGGATGG - Intergenic
1159411108 18:68075546-68075568 TTGTGTTTTGAAAATGAAGATGG + Intergenic
1159538310 18:69743096-69743118 TTGTAGTTTGAAAATGAAGAAGG - Intronic
1159545451 18:69835287-69835309 TTGTATTTTTAAATAGAGACGGG - Intronic
1159666535 18:71168239-71168261 TTTAATTTTAAAAATGAGGATGG + Intergenic
1161603395 19:5199627-5199649 TTTTTTTTTAAAAAAAAGGAGGG - Intronic
1161640573 19:5420161-5420183 TTGTATTTTTAAGTAGAGGCGGG - Intergenic
1161742505 19:6031822-6031844 TTCTTTTTTAAAAAAGAGGTGGG + Intronic
1161917212 19:7237640-7237662 TTGTATTTTTAAATAGAGACGGG - Intronic
1162266502 19:9579941-9579963 TTGAATTTTCAAATAGAGGGTGG + Intronic
1162330141 19:10023031-10023053 TTGTATATTCTTAAAGAGGAAGG + Intergenic
1162587986 19:11572901-11572923 TTGTATTTTTAAATAGAGATGGG - Intronic
1163408563 19:17139002-17139024 TTGCATTTTCAAATAGAGACAGG - Intronic
1163724423 19:18914366-18914388 TTGTATTTTTAAGTAGAGGCGGG - Intronic
1163832898 19:19555605-19555627 TTGCTGTTTCAAAATGAGGAAGG + Intergenic
1164262323 19:23578935-23578957 TTGTGATATCAAAAACAGGAAGG + Intronic
1165456256 19:35912614-35912636 TTATATTTTTAAAAATAGGCTGG + Intergenic
1165864357 19:38927107-38927129 TTGTATTTTTTAATAGAGGCAGG + Intronic
1167193808 19:48012468-48012490 TTGAATTTTGAAAAAAAAGAAGG + Intronic
1167226830 19:48249900-48249922 TTTTGTTTTCAACAAGCGGAGGG - Intronic
1168036095 19:53720836-53720858 TTGTATTTTTAAATAGAGATGGG - Intergenic
1168522914 19:57066848-57066870 TTTTTTTTTAAAAAAAAGGAAGG + Intergenic
926014875 2:9442083-9442105 TTGATTTTTAAAAATGAGGACGG + Intronic
926070268 2:9882683-9882705 CTGTATTTTTAAAAAGAAAAAGG - Intronic
926621783 2:15053010-15053032 TTGTATTTTTTAAAGGATGATGG + Intergenic
926656420 2:15412027-15412049 TACTATTTTTAAAAAGAGGAAGG + Intronic
927567733 2:24127989-24128011 TTGTATTTCCCAAAAGATGGAGG - Intronic
928123460 2:28600257-28600279 TGGTTCTTTCAAAAAGAGGTAGG - Intronic
928216651 2:29367043-29367065 TTGTATTTTCAAAAAGAGGACGG - Intronic
928714745 2:34047386-34047408 CTGTATTTTGAAAAAGAAGCTGG + Intergenic
928822774 2:35382540-35382562 TAGTATCTTCAAATAGAGGTAGG - Intergenic
929595745 2:43174553-43174575 TTGTTTTCTTAAAGAGAGGAAGG - Intergenic
930431895 2:51288379-51288401 ATGTGTTTTCCAAAAGTGGAAGG - Intergenic
930676805 2:54210267-54210289 TTTATTTTTCTAAAAGAGGATGG - Intronic
931797106 2:65721875-65721897 TTGCCTTTTTAAAAAGAGGGTGG + Intergenic
932099043 2:68879888-68879910 TGATATTTTCAAAGGGAGGACGG - Intergenic
932102037 2:68909578-68909600 TTGTATTTTTAAATAGAGACAGG - Intergenic
932280969 2:70491553-70491575 TTGAATTTTCAAAAAGATAAAGG - Intronic
932744612 2:74323065-74323087 TTGTATTTTTAATAAGAGACGGG - Intronic
932766125 2:74471409-74471431 TTGTATTTTCTAGTAGAGGTGGG + Intergenic
932887101 2:75558499-75558521 TTATTTTTTAAAAAAAAGGAGGG + Intronic
933219629 2:79673362-79673384 TTATATTTTTAAAAAGATAAAGG - Intronic
933279490 2:80317372-80317394 TTGTATATTCTGAAAGTGGAAGG - Intronic
933291085 2:80439018-80439040 TTTTATTATCAAAAAGAGAAAGG - Intronic
934939632 2:98491133-98491155 TTGTATTTCCAAAAAGGGGGCGG + Intronic
935283267 2:101538231-101538253 TTATTTTTTTAAAAAAAGGAAGG + Intergenic
935683125 2:105655608-105655630 TTGTATTTTCAAAAAAAGATTGG + Intergenic
936270224 2:111043411-111043433 TTGTGTTATGAAAAAGAGGTGGG + Intronic
936344427 2:111664497-111664519 TTGGAATTTCAAAATGAGTATGG - Intergenic
936891505 2:117375810-117375832 TTGCATTTTCAAAAACAGTTTGG - Intergenic
937054249 2:118918253-118918275 TTGTAAGTTCAAAGTGAGGATGG - Intergenic
937163400 2:119788210-119788232 ATGTATTTTTAAAAAGATGATGG + Intronic
937367433 2:121273919-121273941 TTGTATTTTTAAATAGAGACCGG - Intronic
937590692 2:123610008-123610030 TTTTATTTTTAAAAGGAAGAAGG - Intergenic
938487756 2:131730804-131730826 TAGTAATTTTAAAATGAGGATGG - Intronic
939696362 2:145329634-145329656 TTGTATTTTCACTAAGAGGAGGG + Intergenic
939935152 2:148282681-148282703 ATGTATTTTACAAAAGAGAATGG - Intronic
940100202 2:150028735-150028757 TTCTATTTTCCAAAAGATGAGGG - Intergenic
940997732 2:160168183-160168205 TTGCATTTTGAATGAGAGGAGGG - Intronic
941020311 2:160401153-160401175 ATGTATTTTTAAAAACTGGAAGG - Intronic
941399804 2:165016735-165016757 ATGTATATTTAGAAAGAGGAAGG - Intergenic
942442974 2:176055187-176055209 TTGTATCTTCACATAGTGGAGGG + Intergenic
942888508 2:180958693-180958715 TCCTATTTTTAAAAGGAGGAAGG + Intergenic
943196182 2:184753240-184753262 ATGTATTTACAAAATGAGGCTGG + Intronic
943363196 2:186945568-186945590 ATATATTTTTAAAAAGAAGAGGG - Intergenic
943561288 2:189466062-189466084 TTTTATTTTCAAAAGTAGGCAGG + Intronic
943593702 2:189830197-189830219 CTTTATTTACAAAAACAGGAAGG + Intronic
943910277 2:193556442-193556464 ATGTATTTTCAGAAGGAGGTAGG - Intergenic
944075697 2:195728420-195728442 TTATATTTTCAAAAATAGTTTGG - Intronic
944177107 2:196843196-196843218 TTGGATTTTTAAAAAGATAAGGG - Intronic
944248482 2:197557294-197557316 TTGTTTTTTTAAACAGAGAAGGG - Intergenic
944276736 2:197847420-197847442 TTTTATTTTCATAGAGAGAATGG + Intronic
944525516 2:200614971-200614993 TATTATTTTTAAAGAGAGGAGGG - Intronic
945685180 2:212960081-212960103 TTATCTTTTCAAAGAAAGGAAGG + Intergenic
945700641 2:213166020-213166042 TTGAATTTAGAAAAAGAGAAAGG - Intergenic
945951056 2:216039304-216039326 TTCTGTTGTCAAAAAGATGAAGG - Exonic
946283550 2:218684591-218684613 TTGTATTTTCATAGAGAGGGGGG + Intronic
946494149 2:220178513-220178535 TTGTATTTTTAAGTAGAGAAGGG + Intergenic
947154005 2:227142814-227142836 TTGTTTTTCAAAAAAGAAGATGG - Intronic
947266243 2:228285240-228285262 TTGTATTTTTAAATAGAGACGGG + Intergenic
947366524 2:229401918-229401940 CTGTATTTTCAATAAGATGCTGG + Intronic
947400347 2:229725445-229725467 TTGTATTTTTAAATAGAGATGGG - Intergenic
947696434 2:232193935-232193957 TTGTATTTTTAAATAGAGACAGG - Intronic
948125607 2:235562884-235562906 TTGTATTTTTTAAAAGAGATGGG - Intronic
1169102257 20:2960541-2960563 TTGTTTTTTAAAAAAAAGGTAGG - Intronic
1169249786 20:4051579-4051601 GTGGCTTTACAAAAAGAGGAAGG + Intergenic
1169452435 20:5723515-5723537 TTAAATTTTAAAAAAGAGGCCGG + Intergenic
1169634796 20:7677471-7677493 TTTTATTTACAAAAGGAGGAAGG - Intergenic
1170532277 20:17306414-17306436 TTGAATTCTCAAACAGAAGATGG + Intronic
1170590465 20:17767526-17767548 TTGTATTTTCAGTAAGAGACAGG + Intergenic
1170993982 20:21334155-21334177 TAGCATTTTTAAAAAGAGAAAGG + Exonic
1171058778 20:21934953-21934975 TTGTATTAGCAAAAAGATGTGGG - Intergenic
1173007893 20:39155175-39155197 TTCTATCTTAAAAACGAGGATGG - Intergenic
1173756193 20:45518547-45518569 TTGTAATTCCAGAAAGGGGAGGG + Intergenic
1173958958 20:47056733-47056755 TTCTATTTTGAGAAAGAGCAGGG - Intronic
1174175946 20:48644964-48644986 TTTAATTTTCAAAAAGGTGAAGG - Intronic
1174237612 20:49106976-49106998 TTTTTTTTTCAAAAAGTGGGTGG - Intergenic
1174333309 20:49838454-49838476 AACTATTTTGAAAAAGAGGAAGG - Intronic
1175620328 20:60439886-60439908 TAGTATTTTCAAAAAAATGGTGG - Intergenic
1177774866 21:25556873-25556895 TTGTATTTTTAAGTAGAGGCAGG - Intergenic
1177911304 21:27036063-27036085 TTATATTTAGAAACAGAGGAAGG + Intergenic
1177961145 21:27667992-27668014 TTGTATTGTCAAAGAAAGTAGGG - Intergenic
1178674474 21:34619214-34619236 TTTTTTTTTCAAATGGAGGAAGG + Intergenic
1178712992 21:34936265-34936287 TTTTTTTTTAAAAAAGAGGGGGG - Intronic
1178933554 21:36840973-36840995 TTGTTTTTTCAAAGAGGGGTGGG + Intronic
1179062475 21:37991809-37991831 TTTTATTTTCAACAACAGGGAGG - Intronic
1179336192 21:40457205-40457227 CTGTATTTGGAAAAAGAAGAAGG + Intronic
1180492270 22:15861786-15861808 TAGTAATTTTAAAATGAGGATGG - Intergenic
1181151783 22:20889068-20889090 TTGTTTTTTTAAAAAGACAAGGG - Exonic
1181261989 22:21604945-21604967 TTTTTCTTCCAAAAAGAGGAAGG - Intronic
1181839737 22:25646424-25646446 TTGGAGTTTCAGAAAGAGAAGGG + Intronic
1182431758 22:30302978-30303000 TTGTTTTTTAAAAAAGAGATAGG + Intronic
1183821874 22:40352600-40352622 TTCTATTTTCCCAGAGAGGAGGG - Intronic
1184463125 22:44651435-44651457 TTGTATTTTTAAATAGAGACAGG - Intergenic
1185040261 22:48500408-48500430 GTGTGTTTTCAAATAGGGGACGG + Intronic
949320603 3:2806073-2806095 TTGTATTTTCAGAGAGACGGGGG + Intronic
949342029 3:3040628-3040650 TTGTATTTTCATAAAGCATATGG + Intronic
949447315 3:4148907-4148929 CTGTAAGTTCAAAAAGAGAAAGG + Intronic
949576968 3:5347819-5347841 TTGTTTTTAAAAAAAAAGGATGG - Intergenic
949837790 3:8287802-8287824 TTTTATTTACAAAAACAGGTTGG + Intergenic
950736963 3:15017121-15017143 TTGTTTTTTAAAAAGGAGGTTGG + Intronic
951060962 3:18206840-18206862 TTTTATTTTCAAAATGGGAAAGG + Intronic
951120438 3:18920698-18920720 CTGTGTTTTCAGAAGGAGGAAGG - Intergenic
951533421 3:23719752-23719774 TTGTCTTTTAAAAAAGATCAAGG - Intergenic
951614639 3:24528316-24528338 TAGTTTTTTAAAATAGAGGAGGG + Intergenic
951749591 3:26019622-26019644 TTGTTTGTTCAATTAGAGGAAGG + Intergenic
951954011 3:28233956-28233978 TTAGATTTTCAACAAGAGAAAGG - Intergenic
952470647 3:33647657-33647679 TTTTATATACAAAAACAGGAGGG + Intronic
952474706 3:33695766-33695788 TTGTATTTTAAAATAGAGATGGG - Intronic
953121525 3:40047432-40047454 TTTTATTTTAAGAAAGTGGAGGG + Intronic
953218207 3:40941684-40941706 TAGAATTTTGAAAAAGAGTAAGG - Intergenic
953708775 3:45251982-45252004 TTCTCTCTTCTAAAAGAGGAAGG + Intergenic
953760965 3:45686838-45686860 TTGTATTTTTAAATAGAGAGAGG + Intergenic
954858569 3:53667887-53667909 ACGTCTTTTCATAAAGAGGAAGG + Intronic
955005517 3:54965191-54965213 CTTTATTTACAAAAAGAGGCTGG + Intronic
955199057 3:56833267-56833289 GGCTATTTTTAAAAAGAGGAGGG - Intronic
955210621 3:56937041-56937063 TGGTCTTTTCAAAAACTGGAGGG + Intronic
955988730 3:64602219-64602241 TTGAATGTTCAGAAAGAGAAAGG + Intronic
956016551 3:64889866-64889888 TTTTTTTTTTAAAAAAAGGAAGG - Intergenic
956150206 3:66233167-66233189 TTTTTTTCTCAAAAGGAGGAGGG - Intronic
956303094 3:67793775-67793797 TAAAATTTTTAAAAAGAGGATGG - Intergenic
956482256 3:69685031-69685053 TTTTATTTTCAGAGAAAGGAAGG + Intergenic
957699447 3:83689567-83689589 TTGTATTTTTTAGTAGAGGAGGG + Intergenic
957824669 3:85425520-85425542 GTGTACTTTCAAAAAGATAAAGG - Intronic
957911825 3:86628384-86628406 TAATATTTTCAAAAAAATGAAGG - Intergenic
957923799 3:86781260-86781282 TTGTATCTCTAAAAAGAGTATGG - Intergenic
958012261 3:87894622-87894644 TTTTATTTTGAAAATGAGGCTGG - Intergenic
958032607 3:88130922-88130944 TTGGAATTTCAAATAGAGAAAGG + Intronic
958437754 3:94118681-94118703 TTTTTTTTTAAATAAGAGGAAGG - Intronic
958612175 3:96440287-96440309 TTATATTTTTAAAAAGAACACGG - Intergenic
958706325 3:97661089-97661111 CTGGATTTACAAAAAGAGCAGGG - Intronic
958804723 3:98795836-98795858 TTATTTTTTTAAAAAAAGGATGG + Exonic
958899860 3:99872921-99872943 TTTTTTTTTTAAAAAAAGGAGGG + Intronic
958953612 3:100442763-100442785 TTTTATTTTTAAAAAAAGGAGGG - Intronic
959309685 3:104717921-104717943 TTATTTTTACAGAAAGAGGAAGG - Intergenic
959568991 3:107861785-107861807 TTGGATTTTCAGAAACGGGAGGG - Intergenic
959650071 3:108742957-108742979 ATGTATTGGCAAAAAGAGAAAGG - Intergenic
959816518 3:110680223-110680245 TTGTATTTTTAAAAACAGGGGGG + Intergenic
959988927 3:112608945-112608967 TTGTTTTTTAAAAGGGAGGAGGG - Intronic
960346999 3:116545405-116545427 TTTTCTTTTAAAAAAGAAGAAGG + Intronic
960622659 3:119651805-119651827 TTGTATTTTCTAATAGAGATGGG + Intronic
961207908 3:125101477-125101499 TATTATTTTTAAAAACAGGAAGG - Intronic
962502688 3:136011026-136011048 TGGTATATTTAGAAAGAGGAGGG - Intronic
963100450 3:141597633-141597655 TTTTATTTTTAAAAAAAGAAAGG + Intronic
963443772 3:145374958-145374980 TTCTATTTGTGAAAAGAGGAAGG + Intergenic
963971248 3:151431621-151431643 TTGTATTTTCTATAAGAATAAGG - Intronic
964056945 3:152472587-152472609 CTGTATTTAGGAAAAGAGGAAGG + Intergenic
964093957 3:152910105-152910127 TCTTATTTTACAAAAGAGGAAGG + Intergenic
964576854 3:158180636-158180658 TTGCATTTTTCAAAAGAGGTGGG + Intronic
964664544 3:159157741-159157763 TTGTATGTGCATAAAGTGGAAGG - Intronic
964788290 3:160424315-160424337 TTGTATTTTCAAAATACGGGAGG - Intronic
965737350 3:171835481-171835503 GTGGATTTTCATAAAGAAGAGGG + Intergenic
965883190 3:173411936-173411958 TTGTATTTTCTGAAAGAGAATGG + Intronic
966000028 3:174937880-174937902 TTCTATTTTTGCAAAGAGGAGGG - Intronic
967282781 3:187838073-187838095 TTTTTTTTTAAAAAAAAGGAAGG + Intergenic
967427922 3:189348856-189348878 TTTTATTTTCAAGAGGAGGTGGG + Intergenic
967563271 3:190943073-190943095 TGGTCTTTTCAAAAGGAGTAGGG - Intergenic
968772330 4:2515287-2515309 TTTTCTTTTCACATAGAGGAGGG - Exonic
968871529 4:3245140-3245162 TGGTAATTTCAGAAAGAAGAGGG + Intronic
968884950 4:3323476-3323498 ATGTATTTTCAATAAAGGGAAGG - Intronic
969489314 4:7490234-7490256 TGGTCTTTTCCACAAGAGGAGGG - Intronic
969976723 4:11110261-11110283 TTTTATTTTAAAAATGGGGATGG + Intergenic
970179021 4:13368823-13368845 TTTTTTTTTCAAGAAGAGAATGG + Intronic
970785921 4:19795971-19795993 TTTTATTTTCAAAAAGAAAATGG - Intergenic
970865470 4:20753629-20753651 TTGTATATTCAAATACATGAAGG - Intronic
971009007 4:22409678-22409700 ATGTATCTTAAAGAAGAGGATGG - Intronic
971132248 4:23825251-23825273 TTGTATTTTGAACAGAAGGAGGG + Intronic
971286228 4:25292565-25292587 TTGTATTTACAAAAAGGATACGG - Intergenic
972111709 4:35569838-35569860 CAGTTTTTTCAAAAAGAGGAAGG - Intergenic
972321939 4:37979948-37979970 TTGTATTTTTAAATAGAGACAGG + Intronic
973136828 4:46718907-46718929 TTGATTTTTCAAAAATAGGCAGG - Intergenic
973238679 4:47933298-47933320 TTGTATTTGTAAAATGAGTAGGG + Intronic
973867801 4:55131590-55131612 TTGTATGTTCAAGAAAAAGAAGG + Intergenic
973980792 4:56306701-56306723 TAGTATTTGCAAGTAGAGGAAGG - Intronic
973988753 4:56381973-56381995 TTGCATTTTGAAAAAGAGACTGG - Intronic
974058404 4:57007645-57007667 CTGTATTTTCCAACAAAGGAGGG - Intronic
974206898 4:58715816-58715838 TTGTTTATTCAAAAAATGGAGGG - Intergenic
974229873 4:59096910-59096932 TTGTATTTTCAAAAACTTTAAGG + Intergenic
974463166 4:62216639-62216661 TTGTATATTCAAAAACATTACGG - Intergenic
974554667 4:63429379-63429401 GTGTATTTTCAGAGAGATGAGGG + Intergenic
974674643 4:65074125-65074147 CTTGAATTTCAAAAAGAGGAGGG + Intergenic
975471607 4:74775384-74775406 TTGTATTTTAAAGAAGATGAAGG + Intronic
976180835 4:82397177-82397199 TTGTATTTTCTGATAGAGGCGGG - Intergenic
976211013 4:82669720-82669742 TTGTATTTCCACCAGGAGGAGGG + Intronic
977061861 4:92269692-92269714 ATGTAGTTTCAAAAAGGGCAAGG - Intergenic
977123557 4:93134939-93134961 TTTTATTTTCAGAGAGAGCACGG - Intronic
977265909 4:94854001-94854023 TTTAATTTGCAATAAGAGGAAGG - Intronic
977697891 4:99987239-99987261 TTGTATTTTTAAAAATATGTGGG + Intergenic
978115410 4:105014556-105014578 TTGGGTTTACAAAGAGAGGAAGG - Intergenic
978124064 4:105114622-105114644 TTATAGTTTAAAAAAGAGAAAGG + Intergenic
979469734 4:121080739-121080761 TTTTTTTTTAAAAAAAAGGAGGG + Intergenic
979734629 4:124067386-124067408 TTTTGTTTTTAAAAAAAGGAGGG - Intergenic
980394658 4:132195190-132195212 TTGTATCTTCAAAATGAGTGTGG - Intergenic
981146041 4:141325339-141325361 TTGTCCTTTAAAAAATAGGATGG - Intergenic
981620248 4:146688536-146688558 TTGTATTTTCAAAATCTGTAGGG + Intergenic
982334838 4:154222951-154222973 TTGGAATCTCAAAAAGAGAATGG - Intergenic
982505937 4:156218269-156218291 TTATATTTTAACAAAGAGGCTGG + Intergenic
982508971 4:156256666-156256688 CTGTATTTTCTAAAAGATCAAGG - Intergenic
982592767 4:157336183-157336205 CTGTGTATTCATAAAGAGGAGGG + Intronic
982709287 4:158744100-158744122 TTGTAGTTGCAGGAAGAGGAAGG + Intergenic
982738673 4:159034716-159034738 TTGTATTTTTGTAAAGATGAGGG - Intronic
983185740 4:164698546-164698568 ATGTTTCTTCAAAAAGATGATGG + Intergenic
983754414 4:171316986-171317008 TTGTGTTTTCAATAAGAAAATGG - Intergenic
983757105 4:171352912-171352934 TTGTATCTTAACAAAAAGGAAGG + Intergenic
984241280 4:177222525-177222547 CTGGAATTTCAAAAAGAGCATGG + Intergenic
984398193 4:179227096-179227118 GTGCATTTTAAAACAGAGGAAGG - Intergenic
984939388 4:184918116-184918138 TTGGATTCTCAAAAAGACCATGG + Intergenic
985228710 4:187790716-187790738 TTGTTTTTTCAAAAATTAGATGG + Intergenic
986045291 5:4030944-4030966 CTTTATTTTCAAAAACAGGCTGG + Intergenic
986681359 5:10235717-10235739 TAGTATTTTAGAGAAGAGGAGGG - Intronic
986780143 5:11057895-11057917 TTATATTTTAAAAAAGAGACTGG + Intronic
986888738 5:12273871-12273893 TTATTTTTTCAAAAAAAGAAAGG + Intergenic
986889151 5:12279029-12279051 ATGTTTTTTCAACTAGAGGAAGG + Intergenic
987642559 5:20631501-20631523 TTGTATCTGAAAAAAAAGGAAGG + Intergenic
988972231 5:36480867-36480889 TTTTTTTTTAAAAAAGAGGAGGG + Intergenic
989040368 5:37221279-37221301 TTGTATTTTTAAAAAGAGACAGG - Intronic
989069405 5:37494937-37494959 TTTTATTTACAAAAACAGGGTGG - Intronic
989146101 5:38251604-38251626 CTGTATTTTCAGGAAGACGATGG + Intergenic
989775463 5:45201365-45201387 TTTTATTTACAAAAATAGAATGG - Intergenic
990370335 5:55111519-55111541 TTTTAACTGCAAAAAGAGGATGG + Intergenic
990659921 5:58001938-58001960 GTGAATTTCAAAAAAGAGGAGGG - Intergenic
991120757 5:63010529-63010551 TTGTATTTTTAAATAGAGACAGG + Intergenic
991137716 5:63202323-63202345 TTGTATTTTCAAGAGGCAGAGGG - Intergenic
991419053 5:66422228-66422250 TTTTATTTTGGAAGAGAGGATGG + Intergenic
992159557 5:73987589-73987611 TTGGGTTTTGAAAAATAGGAAGG + Intergenic
992680721 5:79150293-79150315 TTGTATTTTTAAGTAGAGGCGGG - Intronic
992791756 5:80220282-80220304 TTGTAATTTTAAAAAGTAGAGGG - Intronic
993375042 5:87141022-87141044 TTGCACTAACAAAAAGAGGAAGG + Intergenic
993597847 5:89881831-89881853 TTGTGTTTTCACATAGTGGAAGG + Intergenic
993601564 5:89932311-89932333 TTTTATTTTCAAAAATGGGGTGG - Intergenic
994006015 5:94838018-94838040 GTGTATTTCCAAAAAATGGAAGG - Intronic
994227359 5:97268365-97268387 TTAAATTTAAAAAAAGAGGAGGG - Intergenic
994790283 5:104216536-104216558 TTTTATTGTCACAAAGAGGTAGG - Intergenic
994852016 5:105067759-105067781 TTGTGCTTTGAAAATGAGGAGGG - Intergenic
994860845 5:105191379-105191401 GTGTATTTTGAAAAAGAGCAGGG - Intergenic
994963465 5:106635876-106635898 TTTTTTTTTCAAACAGAGGTAGG - Intergenic
995364669 5:111344665-111344687 TTGTACTTGGAAAAAAAGGAAGG + Intronic
995424722 5:112007695-112007717 TTGTTTTTTAATAAAGAGGAAGG + Intergenic
995458306 5:112375358-112375380 TTTTTTTTTTAAATAGAGGAAGG - Intronic
995634205 5:114166892-114166914 TTGTATCCTCAAATAGTGGAGGG - Intergenic
995648884 5:114344991-114345013 ATGTATTTTCAAATTGATGAAGG - Intergenic
995868470 5:116718778-116718800 TTGTTTTTTCAAAATGCTGATGG + Intergenic
996425624 5:123311054-123311076 TTTTTTTTTTAAAAAAAGGAAGG - Intergenic
996547441 5:124695293-124695315 TTGTATTTTCAGTAACAGCATGG - Intronic
996882787 5:128319840-128319862 TTCTACTCTCAAAAAGAGGATGG + Intronic
996989946 5:129617003-129617025 TTCTATTTTACAAATGAGGAAGG - Intronic
997129955 5:131266627-131266649 TTGTATTTTCAAAAAGAGACGGG + Intronic
997191805 5:131944966-131944988 ATTTATTTTTAAAAAGGGGAAGG - Intronic
997724225 5:136106730-136106752 TTTTATTCTAAAAAAAAGGAAGG + Intergenic
997935566 5:138107754-138107776 TTGTATAAACAGAAAGAGGAGGG + Intergenic
998453905 5:142255656-142255678 TTGTATTTTTTAATAGAGGTGGG - Intergenic
999341228 5:150775099-150775121 TTGTATTTTTAAATAGAGACAGG + Intergenic
999360032 5:150976346-150976368 TTGTATTTTCAAAAGGAGTAAGG - Intergenic
999375257 5:151081926-151081948 TTTTAATTCCAAAAAGTGGAAGG + Intronic
999518226 5:152322259-152322281 TTTTATTTACAAAAACAGGAGGG - Intergenic
1000078440 5:157819055-157819077 TTCTATTTTTAAAATAAGGAAGG + Intronic
1000120966 5:158197515-158197537 TTTTTTTTTCACAAAGAGGTGGG + Intergenic
1000259946 5:159578182-159578204 TTTTATTTACAAAAACAGGTGGG - Intergenic
1000890995 5:166802169-166802191 TTGTATTGTAAAAATGAGCATGG - Intergenic
1002069905 5:176673002-176673024 TAGTGTTTTCAAAAGGAGAATGG - Intergenic
1002494222 5:179600867-179600889 TTGTATTTTTAACTAAAGGAGGG + Intronic
1002976598 6:2084678-2084700 TTGTATTTTTAAATAGAGATGGG + Intronic
1003041428 6:2691001-2691023 TTGTATTTTTAAATAGAGACGGG + Intronic
1003534410 6:6963767-6963789 TCTTATTTTTAAAAAGGGGAGGG - Intergenic
1003679647 6:8239465-8239487 TTGTATTTTCAAATAGGGCATGG + Intergenic
1003719490 6:8684900-8684922 ATATATTTTCAAAATTAGGAAGG - Intergenic
1005036199 6:21557040-21557062 TTTTACTTTCAAAAAGAAGTCGG + Intergenic
1005201591 6:23351066-23351088 TTTTTTTTTCAGAAAGAGGGAGG + Intergenic
1005209065 6:23440073-23440095 ATGTATTTACAAAAAGAAGCAGG - Intergenic
1005793934 6:29337100-29337122 TTATATTTTGAAAAAGAGTATGG + Intergenic
1005897483 6:30190522-30190544 TTCTATTATTAAAAGGAGGAAGG - Intronic
1006235217 6:32624950-32624972 TTATATTTATAAAAACAGGAAGG + Intergenic
1006326714 6:33359855-33359877 TTGGAGTTTCAACAAGACGAAGG + Intergenic
1006697391 6:35942613-35942635 TTGTAAATACAAAAAGAGGTAGG - Intergenic
1007428472 6:41762329-41762351 ATGTTTTTTTAAAAAGAGGCTGG - Intergenic
1007437054 6:41821599-41821621 TTGTATTTTTTAAAAGAGATAGG - Intronic
1008381202 6:50841453-50841475 TTGTGCTTTATAAAAGAGGAAGG + Intronic
1008511817 6:52283125-52283147 TTTTTTTTTCAAAAAGTGGGTGG - Intronic
1008705694 6:54156281-54156303 CTGTATTTTTAAAAATTGGATGG - Intronic
1008952677 6:57177480-57177502 TTGTGCTTTCATAAAAAGGAGGG - Intronic
1009553954 6:65137739-65137761 TTGTGTATTGAAAGAGAGGAAGG + Intronic
1009582101 6:65549431-65549453 TTTTATTTACCAAAACAGGAAGG - Intronic
1009824493 6:68847870-68847892 TTGTTTTTTGAAAAGAAGGAAGG + Intronic
1010207646 6:73337357-73337379 TTTTATTTTCAAAAAAAGATAGG + Intergenic
1010370986 6:75107074-75107096 TTGTATTTTGTAATAGAGGCGGG + Intronic
1010558635 6:77318402-77318424 TTTTATCTTCAAAAACAGGCAGG + Intergenic
1010702031 6:79061978-79062000 GTGTATTTTGATAAAGAGTAAGG - Intronic
1010776761 6:79895667-79895689 TTTTATTACCAAAAACAGGAGGG + Intergenic
1011468222 6:87680778-87680800 TTTTTTTTTAAAAAAAAGGAAGG + Intronic
1011860672 6:91751987-91752009 TTGAATTTTCAAAAATAAAATGG + Intergenic
1011898222 6:92259137-92259159 TTGTCTTTTTAAAAAGATTAGGG - Intergenic
1012092485 6:94917458-94917480 TTGTATTTTTAAATAGAGACGGG + Intergenic
1012442682 6:99276216-99276238 GTGTATTTTCAATAAAAGGTTGG - Exonic
1012509757 6:99989772-99989794 TTATATTTTCAAAAAGTGGAAGG - Intronic
1012557191 6:100528352-100528374 TTGTTTTTGCAAATATAGGAAGG + Intronic
1012697944 6:102413196-102413218 TTGTAATTTCCAAAAGCAGATGG + Intergenic
1013160452 6:107538789-107538811 TTGTATTTTGAAATACAGAATGG + Intronic
1013507916 6:110817434-110817456 TTGCATTTTTAATAAGAGGCAGG - Intronic
1013726239 6:113099664-113099686 TTTTATTTTCTAAAAGAGATTGG - Intergenic
1014218871 6:118780203-118780225 TTGTATTTACTAAATGAAGAAGG - Intergenic
1014863597 6:126501234-126501256 TTTAATTTTTAAAAAAAGGAGGG - Intergenic
1014918079 6:127177899-127177921 TTTTTTTTACAAAAAGAGAATGG + Intronic
1015182259 6:130372771-130372793 ATGTATGTACAACAAGAGGAAGG + Intronic
1015208152 6:130665503-130665525 TTGAATTACCGAAAAGAGGAAGG + Intergenic
1015509256 6:134021838-134021860 ATTTAACTTCAAAAAGAGGAAGG + Intronic
1015830940 6:137368389-137368411 TTGTTTTTTCCAAAAGGGTAGGG + Intergenic
1016087355 6:139930158-139930180 TTGTATTTTGAATAAGAGCAAGG - Intergenic
1016438367 6:144060218-144060240 TTGTATTTTTTAATAGAGGTGGG + Intronic
1017093304 6:150781044-150781066 TTGTATTTTTTAATAGAGAAGGG + Intronic
1017230875 6:152072365-152072387 TGATATTTTAAGAAAGAGGAGGG + Intronic
1017395416 6:153993264-153993286 TTGAATGTACAAAAGGAGGAAGG - Intergenic
1017446879 6:154515025-154515047 TTGTATTTTTAATAAGAGATGGG - Intergenic
1017553535 6:155538240-155538262 TTGTATTTTATAAAGGAGGTAGG - Intergenic
1019401186 7:855021-855043 TTTTATTTTAAAAAAGCGTAAGG - Intronic
1019759743 7:2801580-2801602 TTGTGTTTTGAAAAAGGGAAAGG - Intronic
1020707048 7:11558305-11558327 TTTTACTTTCAAAAAGATAAAGG - Intronic
1021535286 7:21697113-21697135 TTATATTTACAAAAACAGGTAGG + Intronic
1022082673 7:27038231-27038253 TTTTTTTTACAAAAAGAAGAGGG + Intergenic
1022166370 7:27766957-27766979 TTCTATTTACAAAAACAGTAAGG - Intronic
1022252790 7:28625483-28625505 TTATATAGTCAAAAAGAAGAGGG + Intronic
1022850240 7:34254058-34254080 TTTTATATTCAAAAATATGAGGG - Intergenic
1023174612 7:37423827-37423849 TTATTTTTTAAAAAAGAGAAAGG - Intronic
1023469789 7:40504230-40504252 TTGTTTTTTAAAAAAGAAGAAGG - Intronic
1023610081 7:41964072-41964094 TTTTTTTTTTAAAAAGAGGGTGG + Exonic
1023799237 7:43819079-43819101 TGATATTTGCAGAAAGAGGAGGG + Intergenic
1024225539 7:47323672-47323694 TTGTACTTTAAAAATGGGGAGGG + Intronic
1024371418 7:48588305-48588327 TTTTATTTTCAACATGAGGCAGG + Intronic
1024386585 7:48758825-48758847 TTATATTTTCAGACAGAGGCTGG + Intergenic
1025753743 7:64314538-64314560 TTTTATTTTTAAAAGGAGAAAGG - Intronic
1025794302 7:64723618-64723640 CTGCATTTGCAAAATGAGGAAGG + Intergenic
1026181967 7:68049501-68049523 TTGTATTTTTTAATAGAGGTGGG + Intergenic
1026577786 7:71588144-71588166 TTGTTTTTTTAGAAAGAGTAAGG + Intronic
1026660195 7:72293923-72293945 TTGTATTTTTAAGGAGAGGCGGG - Intronic
1026812407 7:73479555-73479577 GGGTATGTTCAAAGAGAGGATGG - Intronic
1027143477 7:75677431-75677453 TTGTATTTTCAAGCAGAGACGGG - Intronic
1027335839 7:77149344-77149366 TTCTATTTTTAAAAAGCTGACGG - Intronic
1027488359 7:78790287-78790309 TGGTATTTTTTAAAAGAGCAAGG - Intronic
1027928835 7:84504408-84504430 TTGTAATTTCAAAAAGCCAAAGG - Intergenic
1028315487 7:89396884-89396906 ACATTTTTTCAAAAAGAGGATGG + Intergenic
1028515247 7:91671099-91671121 TTGTATTTTTTAATAGAGGCAGG - Intergenic
1028686495 7:93594890-93594912 TTCTCTTTTCAAAAAGTTGATGG + Intronic
1029488907 7:100859704-100859726 TTGTCTCTTAAAAAAAAGGAAGG + Intronic
1029841768 7:103371866-103371888 TTGTATTTTTAAATAGAGACAGG + Intronic
1029845975 7:103412720-103412742 TTGTATTTTTACAAAGAGATGGG + Intronic
1029858422 7:103542933-103542955 TTATATTTTTAAAAGGAGTATGG + Intronic
1030262954 7:107585322-107585344 TGGTATTGTCAAAAACAGAAAGG + Intronic
1030636981 7:111961284-111961306 ATCTACTTTGAAAAAGAGGAAGG - Intronic
1030673190 7:112359585-112359607 TTTTATTATTAAAAAGAGAATGG + Intergenic
1030848264 7:114449915-114449937 CTGTATTTTTAATAATAGGAAGG - Intronic
1030876669 7:114821501-114821523 TTGTCTTTTCAAATTGAGGAAGG + Intergenic
1031143610 7:117973210-117973232 TTCTATTTTCAACAGTAGGATGG - Intergenic
1032254973 7:130289895-130289917 ATGGATTTTCTAAAAGATGAAGG - Intergenic
1032271461 7:130411250-130411272 TTGTCTTTTACAAAAGACGAGGG + Intronic
1032552029 7:132793026-132793048 CTGTTTTTTAAAAAAGGGGAAGG - Intronic
1033227358 7:139572621-139572643 TTTTATTTTAAAAAAGAAAAAGG - Exonic
1033803927 7:144933508-144933530 TTGTATTTTTAATAAGAGACGGG + Intergenic
1033823974 7:145166685-145166707 TTCTGTTCTCAAAAAGAGGTAGG + Intergenic
1034067387 7:148150237-148150259 TTGTATTTTTAAATAGAGACAGG - Intronic
1034161291 7:148995842-148995864 TTTGGTTTTCACAAAGAGGAGGG + Intergenic
1034410220 7:150937162-150937184 TTGTATTTTTATAGAGAGGTGGG - Intergenic
1034565442 7:151910619-151910641 TTGTATTTTTAAGTAGAGGAAGG - Intergenic
1034670627 7:152854939-152854961 TTTTATTTACAAAAATAGGCTGG - Exonic
1034834287 7:154337330-154337352 TTATGTTTTCAAAAAGAATAGGG - Intronic
1035138596 7:156733393-156733415 CTATATTTTCACAAAGAGGGAGG + Intronic
1035374452 7:158398233-158398255 TTGTGTTTTCAAAACCAGGGTGG + Intronic
1036221768 8:6927051-6927073 TTGTATATGCCAAAAGAGAAGGG + Intergenic
1036521035 8:9491864-9491886 TTTGATTTTGAAAAAGAGGATGG - Intergenic
1037164417 8:15809876-15809898 TAGGATTTTAAAAAATAGGAGGG - Intergenic
1037359708 8:18060295-18060317 ATGTGTTTTCTAAAAAAGGATGG + Intronic
1037372681 8:18196766-18196788 TATTATTTTAAGAAAGAGGAAGG + Intronic
1037612554 8:20488581-20488603 TTCTCTTTTCACAAAGTGGAGGG + Intergenic
1038529004 8:28301799-28301821 TTTTTTTTTAAAAAAAAGGAAGG - Intergenic
1038574216 8:28690371-28690393 TTGTATTTTCAAAATTAGCTGGG - Intronic
1038889174 8:31699699-31699721 TTTTTTTTTTAAAAAAAGGAAGG - Intronic
1039073920 8:33671617-33671639 CTTTATTTTCAAACAAAGGAAGG + Intergenic
1039226060 8:35389556-35389578 TTGTTTTTTATAAAAGAGGCAGG - Intronic
1039478459 8:37854351-37854373 TTGTATTTTCATTTAGAGAAAGG - Intergenic
1039758269 8:40546196-40546218 TTTCTTTTTAAAAAAGAGGAAGG + Intronic
1041003416 8:53474563-53474585 TTGTATGGTCAAAATGATGAGGG + Intergenic
1041078531 8:54191213-54191235 TTGTATTTTCCAAATGACTAAGG + Intergenic
1041819946 8:62019781-62019803 TTGTTTTGTCACAAAAAGGAGGG - Intergenic
1042147278 8:65743284-65743306 CTGTATTTTCAAAAAGGAGAAGG + Intronic
1042445226 8:68876406-68876428 ATATATTTTCAAAAAGAGACCGG - Intergenic
1043041398 8:75266682-75266704 TTCTCTTTTAAAAAAGAGGTTGG - Intergenic
1043079770 8:75751791-75751813 TTGTATTTTTAGAAAGAGATGGG + Intergenic
1043091469 8:75909756-75909778 TTAAAATCTCAAAAAGAGGAAGG + Intergenic
1043140440 8:76581998-76582020 TTGTATTTGCTTAAAGGGGAAGG + Intergenic
1043147829 8:76678622-76678644 TTGTATTTTCCAAGAAAAGACGG + Intergenic
1043419753 8:80086423-80086445 TTCTAGTTTTTAAAAGAGGAGGG + Intronic
1043612102 8:82077704-82077726 TTGTATTTTGAAATAGAGGCGGG + Intergenic
1044303874 8:90616251-90616273 TTGAATTTTTTAAAAGAGAATGG - Intergenic
1044535197 8:93349837-93349859 CTGTATTTTCAAACAGCGGAAGG + Intergenic
1044805803 8:96006810-96006832 TTGGAATGTGAAAAAGAGGAAGG - Intergenic
1044825865 8:96196321-96196343 ATTTATTTTCAAAAAAAGGAAGG + Intergenic
1044910949 8:97057979-97058001 TTTTCTTTTGAAAAAGAAGAAGG + Intronic
1045185379 8:99831920-99831942 ATGTATTTTTAGAAAGAGGCTGG - Intronic
1045820161 8:106327960-106327982 TTGTATTTTAAAAAGGATGAGGG + Intronic
1045884104 8:107075964-107075986 TTGTACTTTAAAAATGAGAATGG + Intergenic
1045940939 8:107737383-107737405 TGGTAATTTCCAAAAGTGGACGG - Intergenic
1045998372 8:108390195-108390217 TTGTCTATTCAGAAAGAGTATGG - Intronic
1046269131 8:111870398-111870420 TTTTTTTTTCAAAAATAAGATGG + Intergenic
1047202395 8:122778341-122778363 ATGTATTTTTCAAAAAAGGAAGG + Intergenic
1047588490 8:126300969-126300991 TTGTATTTAATAAATGAGGAAGG - Intergenic
1047658694 8:127008519-127008541 TTTAATTTTCAATACGAGGATGG + Intergenic
1048433441 8:134392239-134392261 TTTTATTTTCATAGAGATGAAGG + Intergenic
1048556870 8:135486919-135486941 TTTTATTTTCTTAAAGAGGATGG + Intronic
1048672981 8:136744013-136744035 ATTTACTTTCAAAAAAAGGAAGG - Intergenic
1050008513 9:1160274-1160296 TTCCATTTTCAAAAGAAGGAAGG - Intergenic
1050437665 9:5627885-5627907 TTGTATTTTCAGTAAGACGGGGG + Intergenic
1050500619 9:6294298-6294320 TTGGAGATTCAGAAAGAGGAAGG - Intergenic
1050958821 9:11700844-11700866 TTGTATTTTTAAAAAAATCAAGG - Intergenic
1051641318 9:19227528-19227550 TTGTATTTTTAAATAGAGACGGG + Intergenic
1051646764 9:19276144-19276166 CTGTATTTTCTAGAAGAGGGAGG - Exonic
1051897401 9:22002525-22002547 TAATATTTTCAAAAAAGGGAGGG + Intronic
1052488596 9:29133586-29133608 TTGCATTTTAAAAAAAATGATGG - Intergenic
1053233292 9:36430105-36430127 TTGTGTTTTTATCAAGAGGATGG + Intronic
1053505787 9:38642265-38642287 TTGGATTTTCAGAAAGATTAGGG - Intergenic
1054942942 9:70763510-70763532 TTATATTTAGAAAAAGAGGATGG + Intronic
1055184602 9:73435461-73435483 TTTTATTTTTAGAAAAAGGAAGG - Intergenic
1055360259 9:75482175-75482197 ATATATTTTCATAAAGTGGATGG - Intergenic
1055891079 9:81123825-81123847 TTGCATTTTCAAAAAGTTCATGG - Intergenic
1056033113 9:82574105-82574127 TGGTATTTTCAAAAATAGTTTGG + Intergenic
1057249987 9:93493384-93493406 TTGTATTTTCATTTAGAGAAAGG - Intronic
1057329706 9:94102261-94102283 TCGTATTTTTAAAAAGGGGTAGG + Intronic
1057515568 9:95717533-95717555 TTGTGTTATCAGAAAGAAGATGG + Intergenic
1057647420 9:96889918-96889940 TTGGATTTTTAAAAAGAGACAGG - Intergenic
1057823940 9:98358066-98358088 TGGTATTTTCAAAGAAAGGAAGG - Intronic
1058216601 9:102241645-102241667 TTGTATGGTCAAAATGATGAGGG + Intergenic
1058478930 9:105371175-105371197 TTGTATTTCCAGTAAGAGGGTGG + Intronic
1058566350 9:106289301-106289323 TTGTTTTTTCTTAAAGAGCAAGG + Intergenic
1059072036 9:111147907-111147929 TTGCATAAACAAAAAGAGGATGG + Intergenic
1059503064 9:114772426-114772448 TTGTATTTTTTAATAGAGAAGGG + Intergenic
1059798777 9:117728672-117728694 TTTTTATTTTAAAAAGAGGAGGG - Intergenic
1060292976 9:122321172-122321194 GTGTATTTTTAAAAACTGGAAGG - Intronic
1060803659 9:126561555-126561577 TTGTATTTTTATAGAGAGAAGGG + Intergenic
1061638858 9:131935654-131935676 TTGCATTTTAAAAATGAGAAGGG + Intronic
1061834807 9:133321790-133321812 TTGTTTTCTCAAACAAAGGAAGG - Intergenic
1061851764 9:133420210-133420232 TTGTATTTTTGAAAAGAGACGGG + Intronic
1186912466 X:14183268-14183290 TTCTGTTGTCAAAAAAAGGATGG + Intergenic
1187003919 X:15212877-15212899 ACATATTTTCAAAAACAGGAGGG - Intergenic
1187019872 X:15369831-15369853 TAAAATTTTTAAAAAGAGGAAGG + Intronic
1187101851 X:16201107-16201129 TTCTATTTTCAACAAAAGTAGGG + Intergenic
1187481785 X:19663317-19663339 TTGTTTTTTCAGGAAGAGTAGGG + Intronic
1187504582 X:19868573-19868595 CTGTATTTTTTAAAAGAGGAAGG - Intronic
1187953193 X:24491139-24491161 TTGTATTTTTACAAAGAGATAGG - Intronic
1188043480 X:25398305-25398327 TTGTATTTTTAGAAAGAGACAGG + Intergenic
1188545086 X:31296384-31296406 TTCTATTTTCAAAAAGCTAATGG + Intronic
1188676343 X:32944775-32944797 TTGTATTTTTAAGTAGAGGCTGG + Intronic
1188766316 X:34096275-34096297 TTATATTTTCCAAAACAGCAGGG + Intergenic
1188994629 X:36868222-36868244 ATATAATTTCAAACAGAGGAGGG - Intergenic
1189213474 X:39303858-39303880 TTGTATTTTGCAATAGAAGAAGG + Intergenic
1189716803 X:43875433-43875455 TTGAATATTCAAAATCAGGAAGG + Intronic
1189831439 X:44978095-44978117 TTGTATTTTGAATCATAGGATGG + Intronic
1189884203 X:45523670-45523692 TAGTATTTTTTAATAGAGGAAGG + Intergenic
1191143585 X:57140816-57140838 TAGGATTTCCAAAAAGAGGGAGG + Intergenic
1192793820 X:74410461-74410483 TTGTATTTTTTAGTAGAGGAGGG + Intergenic
1194674756 X:96781338-96781360 TTGTATTGTCAATAAGATCATGG + Intronic
1195085948 X:101414680-101414702 TTGTATGTTTAAAAAGAAGTAGG + Intergenic
1195922279 X:109995620-109995642 TTGTATTTTCTAGTAGAGAAGGG - Intergenic
1196674617 X:118406262-118406284 CTGTATTTTCAAAATTAGGTAGG + Intronic
1198463065 X:136881524-136881546 TTGTATTTTTAAAAAGAGACGGG - Intergenic
1199507515 X:148582014-148582036 CTGTATTTTCAAAAATATCAAGG - Intronic
1199704886 X:150415509-150415531 TTGCATAAGCAAAAAGAGGAAGG + Intronic
1200102702 X:153695964-153695986 GTATATTTCTAAAAAGAGGAAGG + Exonic
1200450501 Y:3321720-3321742 ATTTATATTCTAAAAGAGGAGGG - Intergenic
1200759500 Y:7025019-7025041 TTCTTTTTTCAAACAGAGGGTGG + Exonic
1200798102 Y:7360368-7360390 TTGTTTTTTTAAATAGAGGTGGG + Intergenic
1200853234 Y:7908185-7908207 TTGTATTTCCAAAAAAAAGTGGG + Intergenic
1200971649 Y:9158965-9158987 AGGGTTTTTCAAAAAGAGGAAGG - Intergenic
1201329383 Y:12801482-12801504 TTGTATCTTCATAAAGACAAAGG + Intronic
1201376405 Y:13325998-13326020 TTTTATTTTCAAAAGCAGGTTGG + Intronic
1201649950 Y:16274303-16274325 TTGTATTCTCAAGAAGACCATGG - Intergenic
1201850399 Y:18473607-18473629 TTGGATTTTAAAAAATAGGTAGG + Intergenic
1201882919 Y:18846770-18846792 TTGGATTTTAAAAAATAGGTAGG - Intergenic
1202243875 Y:22796424-22796446 CTGAATTTTCTAGAAGAGGAAGG - Intergenic
1202346130 Y:23929889-23929911 TAGTAGTTTTAAAAAGAGGGAGG + Intergenic
1202396862 Y:24430174-24430196 CTGAATTTTCTAGAAGAGGAAGG - Intergenic
1202473921 Y:25239918-25239940 CTGAATTTTCTAGAAGAGGAAGG + Intergenic
1202524641 Y:25740201-25740223 TAGTAGTTTTAAAAAGAGGGAGG - Intergenic
1202598312 Y:26566741-26566763 GTGTATTTTAAAAAAGAAAAGGG + Intergenic