ID: 928218193

View in Genome Browser
Species Human (GRCh38)
Location 2:29380051-29380073
Sequence ACATCCTACACGGCTAAAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 430
Summary {0: 1, 1: 2, 2: 4, 3: 82, 4: 341}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
928218186_928218193 23 Left 928218186 2:29380005-29380027 CCTTAGGAAACTTGCAATCATGG 0: 4
1: 432
2: 6613
3: 8999
4: 6995
Right 928218193 2:29380051-29380073 ACATCCTACACGGCTAAAGCAGG 0: 1
1: 2
2: 4
3: 82
4: 341

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
928218193 Original CRISPR ACATCCTACACGGCTAAAGC AGG Intronic
901193988 1:7429854-7429876 ACATCTTACATGGCTGGAGCAGG + Intronic
901264401 1:7899052-7899074 ACATCTTACATGGCCAAAACAGG + Intergenic
902540846 1:17153408-17153430 ACATCTTACATGGCCAAAGCAGG - Intergenic
902707853 1:18218206-18218228 ACATCTTACATGGCTGGAGCAGG + Intronic
904224554 1:29005212-29005234 ACATCTTACATGGCCAGAGCAGG + Intronic
904292102 1:29493451-29493473 ACATTCTACATGGCTGGAGCAGG - Intergenic
906368165 1:45228619-45228641 ACATCTTACATGGCCAGAGCAGG - Intronic
906919971 1:50053685-50053707 ACATCCTAAACAGCTACAACTGG - Intronic
908592680 1:65650850-65650872 ACGTCTTACATGGCTAGAGCAGG - Intergenic
908879169 1:68711082-68711104 ACATCTTACGTGGCTAGAGCAGG - Intergenic
910203712 1:84726062-84726084 ACATCCTACATGGCTGGAGAAGG - Intergenic
910619889 1:89241975-89241997 ACATCTTACAAGGCCAGAGCAGG - Intergenic
912138016 1:106684848-106684870 ACATCCTACATGTCTAGAGTAGG - Intergenic
913366424 1:118044793-118044815 ACATCCTCCATGACTAGAGCGGG - Intronic
916152631 1:161810301-161810323 ACATCTTACATGGCTAGAGCAGG + Intronic
917051842 1:170933066-170933088 TCATCTTACATGGCCAAAGCAGG + Intergenic
917567870 1:176230976-176230998 ATATCTTACACGGCTGGAGCAGG - Intergenic
917577949 1:176344139-176344161 ACATCTTACATGGCTCAAGCAGG + Intergenic
917696681 1:177532924-177532946 ACATCTTACATGGCTGAAGCAGG + Intergenic
917700245 1:177573431-177573453 ACATCTTACATGGCCAAAGCAGG + Intergenic
918263732 1:182820653-182820675 ACATCTTACATGGCCAGAGCAGG + Intronic
918908226 1:190528408-190528430 ACGTCTTACATGGCTGAAGCAGG + Intergenic
919244874 1:194969756-194969778 ACTTCATACACGGCAGAAGCAGG + Intergenic
919605549 1:199678294-199678316 ACATCTTACATGGCTGAAGCAGG - Intergenic
921745954 1:218741011-218741033 ACATCCTACATGGCCAGAGCAGG - Intergenic
924779249 1:247131594-247131616 ACAGCCTCCCTGGCTAAAGCAGG - Intronic
924792289 1:247263010-247263032 ACATCTTACACGGCTGGAGCAGG - Intergenic
1062794182 10:330731-330753 ACATCTTACATGGCCACAGCAGG - Intronic
1063253356 10:4298869-4298891 ACATCCTACATGGCTGGAGCAGG - Intergenic
1063470119 10:6277637-6277659 ACATCTTACATGGCCAGAGCAGG - Intergenic
1064871174 10:19938473-19938495 ACATCTTACACGGCAGGAGCAGG + Intronic
1065160124 10:22911148-22911170 ACATCTTACATGGCTGGAGCAGG + Intergenic
1065347250 10:24760296-24760318 ACATCTTACATGGCCAGAGCAGG - Intergenic
1065430394 10:25648823-25648845 ACATCTTACATGGCCAGAGCAGG - Intergenic
1065431022 10:25655701-25655723 TCATCTTACACGGCCAGAGCAGG + Intergenic
1065624848 10:27619816-27619838 ACGTCCTACATGGCTGGAGCAGG + Intergenic
1065738533 10:28775711-28775733 ACATCTTACAAGGCTGGAGCAGG + Intergenic
1065835423 10:29653322-29653344 ACAGCCTGCATGGCTGAAGCAGG - Intronic
1066510986 10:36095648-36095670 ACATCTTACATGGCTGGAGCAGG - Intergenic
1068521893 10:58085945-58085967 ACATCCTACATGGCTGGAGCAGG - Intergenic
1068567022 10:58587649-58587671 ACAACATAGAGGGCTAAAGCTGG - Intronic
1069117714 10:64528502-64528524 ACATCTTACATGGCTGGAGCAGG - Intergenic
1070852149 10:79573757-79573779 ACATCCTCCTAGACTAAAGCAGG + Intergenic
1072883395 10:99250193-99250215 ACATCTTACATGGCTGGAGCAGG - Intergenic
1073567047 10:104543903-104543925 ACATCTTACATGGCCAGAGCAGG + Intergenic
1073952576 10:108828417-108828439 ACATCTTACATGGCCAAAGCAGG + Intergenic
1074728567 10:116342834-116342856 ACATCTTACATGGCCAGAGCAGG - Intronic
1075006920 10:118837724-118837746 ACAACCTACATGGCTGGAGCAGG + Intergenic
1075685327 10:124360962-124360984 ACATCTTACATGGCCAGAGCAGG - Intergenic
1078697459 11:13648749-13648771 ACATCTTACATGGCCAGAGCAGG - Intergenic
1078892874 11:15573163-15573185 ACATCTTACATGGCCAGAGCAGG - Intergenic
1079783384 11:24638546-24638568 ATTTACTACATGGCTAAAGCAGG + Intronic
1080236842 11:30079757-30079779 ACATCCTATATGGCCAGAGCAGG - Intergenic
1080929086 11:36788548-36788570 ACATCTTACGTGGCTGAAGCAGG - Intergenic
1080946547 11:36980731-36980753 ACATCTTACATGGCTAGAGCAGG + Intergenic
1081441338 11:43084933-43084955 ACATCCTACATGGCTGGACCAGG + Intergenic
1081441615 11:43086941-43086963 ACATCCTATATGGCTGGAGCAGG + Intergenic
1084776266 11:71378707-71378729 ACATCTTACATGGCTGGAGCAGG - Intergenic
1085418531 11:76336063-76336085 ACATCTTACATGGCTGTAGCAGG - Intergenic
1085665174 11:78408811-78408833 ACATCTTACATGGCTGGAGCAGG - Intronic
1086365787 11:86109274-86109296 ACATCTTACATGGCCAGAGCAGG + Intergenic
1087433222 11:98080035-98080057 ACATCTTACATGGCCAGAGCAGG - Intergenic
1087595007 11:100242553-100242575 ACATCTTACATGGCCAGAGCAGG + Intronic
1087889309 11:103518592-103518614 ACATCTTACATGGCCAGAGCAGG + Intergenic
1088180601 11:107104644-107104666 ACATCTTACATGGCTGGAGCAGG + Intergenic
1088644442 11:111905725-111905747 ACATCTTACATGGCTGGAGCAGG - Intergenic
1091842711 12:3632169-3632191 ACATCTTACATGGCCAGAGCAGG - Intronic
1093425031 12:19019144-19019166 ACATCTTACATGGCTGAAGCAGG + Intergenic
1093718874 12:22414768-22414790 ACATCCTACATGGGTAGAACAGG + Intronic
1094322887 12:29204745-29204767 ACATCTTACATGGCCAGAGCAGG + Intronic
1094393023 12:29973635-29973657 ATGTCCTACATGGCTAGAGCAGG - Intergenic
1097520430 12:60662252-60662274 ACATCCTTTACGGATAAAGGAGG + Intergenic
1098560289 12:71865205-71865227 ACATCCAACACAGCCAGAGCAGG - Intronic
1099283980 12:80692126-80692148 ATATCCCACAGGGCTGAAGCAGG + Intergenic
1099816773 12:87658909-87658931 ATATCTTACATGGCTGAAGCTGG - Intergenic
1099972451 12:89514244-89514266 ACATCTTACATGGCCAGAGCTGG - Intronic
1100334654 12:93618125-93618147 ACATCTTACATGGCCAGAGCAGG - Intergenic
1100675424 12:96861369-96861391 ACATCCTACAAGGCACAAGACGG + Intronic
1100692715 12:97056094-97056116 ACATCTTACATGGCTAGAGCAGG + Intergenic
1100910098 12:99350186-99350208 ACATCTTACAGGGCCAGAGCAGG - Intronic
1101076920 12:101139896-101139918 ACATCTTACATGGCTGGAGCAGG + Intergenic
1101429313 12:104613590-104613612 ACATCTTACATGGCCAGAGCAGG - Intronic
1101629824 12:106482477-106482499 ACATCTTACACGGCCAGAGCAGG + Intronic
1101779015 12:107818846-107818868 ACATTCTATACTGCTAAAGAAGG + Intergenic
1101817986 12:108160493-108160515 TCATCTTACATGGCCAAAGCAGG + Intronic
1103342159 12:120226421-120226443 ACATCCCACACTGCCAAGGCTGG + Intronic
1103470565 12:121176950-121176972 ACACCCTGCACGGCTGAAGCAGG + Intronic
1104127061 12:125857931-125857953 ACATCTTACATGGCTGGAGCAGG - Intergenic
1104263130 12:127203706-127203728 ACATCTTACATGGCTGGAGCAGG + Intergenic
1105647536 13:22337685-22337707 ACATCCTACATGGCCAGAGCAGG - Intergenic
1105647854 13:22340008-22340030 ACATCCTACATGGCTGGATCAGG - Intergenic
1107499396 13:40957573-40957595 ACATCCTACATGGCTGGAGCAGG - Intronic
1107511885 13:41093493-41093515 ACATCTTACATGGTTAGAGCAGG - Intergenic
1107533632 13:41307661-41307683 ACATCCTACATGGCTGGAGCAGG - Intergenic
1107907386 13:45073920-45073942 ACATCTTACATGGCTGGAGCAGG + Intergenic
1108271024 13:48759791-48759813 ACTTCTTACAAGGCTAGAGCAGG + Intergenic
1109139707 13:58699312-58699334 ACATCTTACATGGCCAGAGCAGG + Intergenic
1109245925 13:59954761-59954783 ACATCCTATATGACTGAAGCAGG + Intronic
1110379913 13:74838906-74838928 ACATCCTACATGGCTGGAGCAGG + Intergenic
1110868277 13:80422025-80422047 ACATTCTACATGGCCAGAGCAGG + Intergenic
1110868706 13:80425145-80425167 ACATCTTACATGGCCAGAGCAGG + Intergenic
1110909227 13:80934328-80934350 ACATCTTACATGGCTGGAGCAGG + Intergenic
1111175912 13:84596098-84596120 ACATCCTACTTGGCTGGAGCAGG - Intergenic
1111753186 13:92359698-92359720 ACATCTTACATGGCTGAAGCAGG + Intronic
1112827934 13:103413641-103413663 ACATCTTACATGGCTGGAGCAGG - Intergenic
1114576684 14:23720987-23721009 ACATCTTACATGGCCAGAGCAGG + Intergenic
1116072505 14:40066770-40066792 ACATCTTACATGGCTGAAGCAGG + Intergenic
1116389347 14:44374507-44374529 ACATCTTACACGGCCAGAACAGG - Intergenic
1119037939 14:71246374-71246396 ACATCTTACAGGGCTGGAGCAGG - Intergenic
1119929107 14:78527330-78527352 ACATCTTACATGGCTGGAGCAGG + Intronic
1120268322 14:82278384-82278406 ACATCTTACATGGCCAAAGCAGG - Intergenic
1120375084 14:83694818-83694840 ACATCTTACATGGCTGAAGCGGG + Intergenic
1120767079 14:88338068-88338090 ACATCCTACATGGCCAGAGAAGG - Intergenic
1120840870 14:89083808-89083830 ACGTCCTACATGGCCAGAGCAGG - Intergenic
1120915087 14:89703463-89703485 ACATCCTACATGGCCAGGGCAGG + Intergenic
1123826869 15:24091473-24091495 ACATCTTACATGGCTAGAGAAGG + Intergenic
1125281579 15:38047530-38047552 TCATCCTACATGGCTGAAGCAGG + Intergenic
1125407938 15:39372372-39372394 ACATCTTTCATGGCCAAAGCAGG + Intergenic
1125447691 15:39775722-39775744 ACATCCTACATGGTTGGAGCAGG - Intronic
1125856365 15:42953636-42953658 ACATCCTACAGAGGAAAAGCTGG + Intronic
1126562990 15:50064824-50064846 ACATCTTACACGGTTGAAGCAGG + Intronic
1127196481 15:56591449-56591471 ACATCTTACATGGCTGCAGCAGG + Intergenic
1128474217 15:67983284-67983306 ACATCTTACATGGCTGGAGCAGG - Intergenic
1131527573 15:93164809-93164831 GCATCTCACACGGCAAAAGCAGG - Intergenic
1131546022 15:93316139-93316161 ACATCTTACATGGCTGGAGCAGG - Intergenic
1131665206 15:94564247-94564269 ACATCTTACATGGCCAGAGCAGG + Intergenic
1132034915 15:98474421-98474443 ACATCTTACATGGCCAGAGCAGG + Intronic
1133436479 16:5784453-5784475 ACATCTTACATGGCCAGAGCAGG + Intergenic
1133496638 16:6324504-6324526 ACATCTTACATGGCCAGAGCAGG + Intronic
1133676579 16:8079037-8079059 ACATCTTACATGGCTGGAGCAGG - Intergenic
1139681206 16:68565242-68565264 ACAGCCTATAAGGGTAAAGCTGG + Exonic
1140194697 16:72846655-72846677 ACAACCTGCACGGCTTTAGCTGG + Intronic
1141533378 16:84661928-84661950 ACATCCTGGGCGGCTACAGCTGG + Exonic
1142280900 16:89147104-89147126 ACATCCTACATGGCCGGAGCAGG + Intronic
1143455781 17:7066779-7066801 GCATCTTACATGGCTGAAGCAGG + Intergenic
1143456116 17:7069110-7069132 ACATCTTACATGGCCGAAGCAGG + Intergenic
1145930978 17:28685286-28685308 ACACCCTGAAAGGCTAAAGCAGG - Intronic
1146734893 17:35230337-35230359 ACATCCTACATGGCTGGAGCAGG + Intergenic
1148897612 17:50848867-50848889 ACGTCTTACATGGCTAGAGCAGG + Intergenic
1149342526 17:55701340-55701362 ACGTCCTACATGGCTGGAGCAGG + Intergenic
1150862142 17:68811659-68811681 ACATCTTACATGGCTGGAGCAGG - Intergenic
1151018128 17:70580658-70580680 ACATCTTACATGGCTGGAGCAGG - Intergenic
1151126576 17:71851867-71851889 ACGTCTTACATGGCTGAAGCAGG - Intergenic
1151629888 17:75303278-75303300 ACATCTTACACTGCCAGAGCAGG + Intergenic
1153439332 18:5099627-5099649 ACATCTTACATGGCTGGAGCAGG - Intergenic
1153780243 18:8488658-8488680 ACATCTTACATGGCCAGAGCAGG - Intergenic
1154253539 18:12764319-12764341 ACGTCCTACATGGCTGGAGCTGG - Intergenic
1155812739 18:30258937-30258959 ACATCCTACATGGCTGGAGCAGG - Intergenic
1156151722 18:34251051-34251073 ATATCTTACATGGCCAAAGCAGG + Intergenic
1156250868 18:35351561-35351583 ACATCTTACATGGCTGGAGCAGG - Intergenic
1156643537 18:39131588-39131610 ACATCCTACATGGCTGGAGCAGG + Intergenic
1156807075 18:41197526-41197548 ACATCTTACATGGCTGGAGCAGG - Intergenic
1157822787 18:50786025-50786047 ACATCTTACAAGGCTAGGGCAGG - Intergenic
1158497404 18:57968903-57968925 ACATCCTACACAGCTGGAGCAGG - Intergenic
1158769261 18:60494966-60494988 ACATTCTACATGGCTGGAGCAGG + Intergenic
1159071239 18:63625968-63625990 ATGTCCTACATGACTAAAGCAGG + Intergenic
1159149812 18:64506056-64506078 ACATCTTACATGGCTGGAGCAGG - Intergenic
1159873464 18:73784970-73784992 ACATCTTACACGGCCATAGCAGG + Intergenic
1159898601 18:74021034-74021056 ACATCTTACATGGCCAGAGCAGG + Intergenic
1165736805 19:38182222-38182244 ACAACCTACGCAGCTAAAGGTGG - Intronic
925644386 2:6021005-6021027 ACATCTTACATGGCCAAGGCAGG - Intergenic
925929861 2:8698306-8698328 ACATCCTATATGGCTGGAGCAGG - Intergenic
926096781 2:10086428-10086450 ACATCCTACATGGCTAAAGCAGG - Intergenic
926208267 2:10849391-10849413 ACATCCTACAAGGCTGGAGCAGG + Intronic
926221592 2:10939442-10939464 ACATCTTACATGGCCAGAGCAGG + Intergenic
926545849 2:14238816-14238838 ACATCCTACATGGTCAGAGCAGG - Intergenic
927131951 2:20067845-20067867 ACATCTTACATGGCTGGAGCAGG - Intergenic
928218193 2:29380051-29380073 ACATCCTACACGGCTAAAGCAGG + Intronic
930841649 2:55853979-55854001 ACGTCCTACATGGCTGGAGCAGG + Intergenic
930864091 2:56105861-56105883 ACGTCTTACACGGCCAGAGCAGG + Intergenic
931283574 2:60814419-60814441 AAATCCTTTATGGCTAAAGCAGG - Intergenic
931378368 2:61728925-61728947 ACATCTTACATGGCTGGAGCAGG + Intergenic
932224248 2:70026948-70026970 ACATACTACAAAGCTATAGCAGG + Intergenic
932879644 2:75489258-75489280 ACATCCTACATGGCGGGAGCAGG + Intronic
933046302 2:77540941-77540963 ACATCTTACATGGCCAGAGCAGG - Intronic
933283614 2:80359577-80359599 ACATCTTACATGGCCAGAGCAGG - Intronic
933428274 2:82141201-82141223 ACATCCTACATGGCCAGAGCAGG - Intergenic
933464174 2:82629856-82629878 ATATCTTACATGGCTAGAGCAGG - Intergenic
935265798 2:101392847-101392869 ACATCTTACATGGCTGGAGCAGG - Intergenic
935798602 2:106670155-106670177 ATATCCTACATGGCCAGAGCAGG - Intergenic
937151616 2:119690264-119690286 ACGTCCTACACGACTGGAGCAGG - Intergenic
937342415 2:121099702-121099724 ACATCCTTCCCTGCCAAAGCAGG + Intergenic
937447030 2:121967110-121967132 ACATCTTACATGGCTGGAGCAGG + Intergenic
938300512 2:130208005-130208027 ACATCTTACATGGCCAGAGCAGG + Intergenic
938456215 2:131466466-131466488 ACATCTTACATGGCCAGAGCAGG - Intronic
938624229 2:133091080-133091102 ACATCTTACATGGCCAGAGCAGG - Intronic
939588621 2:144035190-144035212 ACATCCTACATGACTGAAGCAGG - Intronic
940449965 2:153824847-153824869 ACATCTTACACGGCTGGAGCAGG - Intergenic
940826134 2:158415242-158415264 ACATTCTACATGGCTGGAGCAGG + Intronic
940826371 2:158416984-158417006 ACATTCTACATGGCTGGAGCAGG + Intronic
941675969 2:168343960-168343982 ACATTTTATACGGATAAAGCTGG - Intergenic
941701017 2:168604711-168604733 ACATCTTACGTGGCCAAAGCAGG - Intronic
941701331 2:168606897-168606919 ACATCTTACATGGCCAGAGCAGG - Intronic
942117309 2:172740745-172740767 ACATCCTCCAGGGCTCAGGCTGG + Intronic
942952712 2:181738999-181739021 ACATCTCACAAGGCTAGAGCAGG - Intergenic
943206273 2:184901102-184901124 ACATCCTACACTGCTTAAAATGG + Intronic
943290467 2:186064711-186064733 ACATCCTACATGGCTGGAGCAGG - Intergenic
943486955 2:188496908-188496930 ACATCTTACATGGCCAGAGCAGG - Intronic
943558020 2:189428662-189428684 ACATCTTACATGGCAAAAGCAGG - Intergenic
945605283 2:211922108-211922130 ACATTCTACAAGGTTAATGCTGG - Intronic
1169165229 20:3417056-3417078 ACATCTTACATGGCTAGAGCAGG + Intergenic
1169890148 20:10443871-10443893 ACATCCTACATGACTGGAGCAGG - Intronic
1170331023 20:15210781-15210803 ACATCTTACATGGCTGGAGCAGG - Intronic
1170941978 20:20855640-20855662 ACATCATACATGGCTGGAGCAGG + Intergenic
1174073932 20:47918749-47918771 ACATGCCACATGGCAAAAGCAGG - Intergenic
1174715640 20:52755065-52755087 ACATCTTACATGGCTGGAGCAGG + Intergenic
1174981585 20:55401498-55401520 ACATCTTACATGGCTGGAGCAGG - Intergenic
1177067666 21:16461180-16461202 ACATCCTACGTGACTGAAGCAGG - Intergenic
1177170059 21:17645022-17645044 ACATCCCACACGGCAGAATCAGG - Intergenic
1177258734 21:18700678-18700700 ACATCTTATACGGCTGGAGCAGG - Intergenic
1177517556 21:22175418-22175440 ACATCCTACATGGCTGAAGTAGG - Intergenic
1177725612 21:24963189-24963211 ACATCTTACACTGCCAGAGCAGG - Intergenic
1177855936 21:26400074-26400096 ACATCTTACACGGCTGGAGCAGG - Intergenic
1177970587 21:27784711-27784733 ACATCCTACAGAGCTGGAGCAGG + Intergenic
1178081933 21:29074968-29074990 ACATCCTACAAGGCTGGAGGAGG - Intergenic
1178234273 21:30823248-30823270 ACATCCTACATGGCTTGAGCAGG - Intergenic
1178683656 21:34694577-34694599 ACATCCTACATGGCTGGAGAAGG - Intronic
1179096528 21:38321007-38321029 ACGTCCTACATGGCTGGAGCAGG + Intergenic
1181868619 22:25879845-25879867 ACATCCTACATGGCTGGAGCAGG + Intronic
1181905907 22:26196214-26196236 ACATCTTACATGGCCACAGCAGG - Intronic
1182402247 22:30087685-30087707 ACATCTTACATGGCCAAAGCAGG + Intronic
1182642413 22:31778955-31778977 ACATGCTACACGTCCAGAGCAGG + Intronic
1182996291 22:34815946-34815968 ACGTCCTACATGGCTGGAGCAGG + Intergenic
1185392868 22:50572020-50572042 ACCTCCTACACGGCTGCAGTGGG - Exonic
949242108 3:1885810-1885832 ACATCCTACATGGCTGGAGTAGG + Intergenic
949404900 3:3703799-3703821 ACATCTTACATGGCTGGAGCAGG + Intronic
951271194 3:20626548-20626570 ACATCCTACATGGCTGGAGCAGG + Intergenic
952186833 3:30978647-30978669 ACATCCTACATGGCTGGAGTAGG - Intergenic
952221247 3:31326410-31326432 ACATCTTACACGGCCGGAGCAGG + Intergenic
952255342 3:31690278-31690300 ACATCTTACATGGCCAGAGCAGG - Intronic
952346056 3:32486889-32486911 ACATCTTACATGGCCAGAGCAGG - Intronic
952637732 3:35552229-35552251 ACATCTTACATGGCCAGAGCAGG + Intergenic
954452688 3:50580242-50580264 GCATGCTACAGGGCTAAAGGGGG - Intronic
955692855 3:61607143-61607165 ACATCCTACACGGATCAACTTGG + Intronic
957019450 3:75108555-75108577 ACATCTTACATGGCCACAGCAGG + Intergenic
958114723 3:89201154-89201176 ATATCCTACATGGCTGGAGCAGG + Intronic
958560634 3:95743990-95744012 ACAGCCTACATGGCTGGAGCAGG + Intergenic
959237226 3:103740338-103740360 ACTTCCTACATGGCTGGAGCAGG + Intergenic
961242795 3:125426768-125426790 ACATCTTACATGGCCAGAGCAGG + Intergenic
961954606 3:130788556-130788578 ACATCTTACATGGCCAGAGCAGG + Intergenic
962325509 3:134428784-134428806 ACAGCCCACACGGTGAAAGCTGG + Intergenic
962973105 3:140423569-140423591 ATATCCCACACAGCTAAGGCAGG - Intronic
964718891 3:159752076-159752098 ACATTTTACATGGCCAAAGCAGG - Intronic
964919907 3:161884131-161884153 ACACCATATATGGCTAAAGCAGG - Intergenic
965394908 3:168151732-168151754 ACATCTTACATAGCTGAAGCAGG - Intergenic
965756698 3:172034871-172034893 GCGTCCTACACGGCTGAAGCAGG + Intergenic
965891546 3:173520088-173520110 ACATTTTACATGGCCAAAGCAGG - Intronic
965979552 3:174671003-174671025 ACATTTTACACGGCTAAAGCAGG - Intronic
966241192 3:177757018-177757040 ACATCTTACATGGCCAGAGCAGG + Intergenic
966241466 3:177759052-177759074 AGATCTTACATGGCCAAAGCAGG + Intergenic
966782150 3:183593112-183593134 ACATCTTACATGGCCAGAGCAGG - Intergenic
967592795 3:191298456-191298478 ACATCTTACATGGCCAGAGCAGG - Intronic
967866196 3:194192040-194192062 ACATCCTACATGGCTGGAGCAGG - Intergenic
969140591 4:5067843-5067865 ACATCTTACATGGCTGGAGCAGG + Intronic
970027321 4:11637190-11637212 ACATCTTACATGGCTAGAACAGG + Intergenic
970151957 4:13099274-13099296 ACATCCTACACGGCTGAAGCAGG + Intergenic
970225018 4:13848916-13848938 ATATCCTACATGGCTGGAGCAGG - Intergenic
970344288 4:15138083-15138105 ACATCCTACATGGCTGGAGCAGG - Intergenic
970495307 4:16618964-16618986 ATGTCCTACACGGCTGGAGCAGG - Intronic
970566209 4:17334743-17334765 ACATCCTACATGGCTGGAGCGGG - Intergenic
970747119 4:19312466-19312488 ACATCCTACTTGGCTACAGCAGG - Intergenic
970894787 4:21089305-21089327 ACATCTTACACGGCCAGAGAAGG - Intronic
971454781 4:26834107-26834129 ACATCCTACATGGCTGGAGCAGG - Intergenic
971896790 4:32606472-32606494 ACATCTTACATGGCTGGAGCAGG + Intergenic
972858546 4:43138042-43138064 ACATCCTACACAGCTGGAGCAGG + Intergenic
973749079 4:53994513-53994535 ACTTCCTACATGGCGAGAGCAGG - Intronic
974339026 4:60589654-60589676 ACATCTTACATGGCCAGAGCAGG - Intergenic
975053189 4:69892472-69892494 GCATCCTACATGGCTAGAGCAGG - Intergenic
975093159 4:70426498-70426520 ATATCCTACATGGCTGGAGCAGG - Intergenic
975835633 4:78419813-78419835 ACATCTTACATGGCCAGAGCAGG + Intronic
976086375 4:81410925-81410947 ATATCTTACATGGCTAGAGCAGG - Intergenic
976820206 4:89197836-89197858 ACATCTTACACAGCTGGAGCAGG - Intergenic
977349764 4:95867607-95867629 ACATCATACATGGCTGGAGCAGG - Intergenic
977983834 4:103359234-103359256 ACATGTTACATGGCTAGAGCAGG - Intergenic
978294366 4:107186447-107186469 ACATCTTACATGGCTGGAGCAGG - Intronic
979087354 4:116429288-116429310 ACATCTTGCATGGCTCAAGCAGG - Intergenic
980888902 4:138793237-138793259 ACATCCTACATGGCTGCAGCAGG - Intergenic
981215165 4:142156808-142156830 AAATCCTACCCGGCTGATGCAGG - Intronic
981277581 4:142919939-142919961 ACATCTTCCATGGCTAGAGCAGG + Intergenic
981912327 4:149995765-149995787 ACATCTCACAAGGCTAGAGCAGG - Intergenic
982187884 4:152820585-152820607 ACATCCTATATGGCTGGAGCAGG + Intronic
982271910 4:153599176-153599198 ACATCTTACATAGCTAAAGCAGG + Intronic
982428988 4:155299705-155299727 ACATCTTACATGGCCAGAGCAGG + Intergenic
983161165 4:164416723-164416745 ACATGTCACATGGCTAAAGCAGG + Intergenic
983670491 4:170231617-170231639 ACATCCTACATGACTGGAGCAGG - Intergenic
986305413 5:6510660-6510682 ACATCTTACACGGCTGGAGCAGG + Intergenic
986474023 5:8106877-8106899 ACATCTTACATGGCTGGAGCAGG + Intergenic
987289422 5:16494560-16494582 ACATCTTACATGGCCAGAGCAGG - Intronic
987514416 5:18887801-18887823 ACATCTTACATGGCGAAAGGTGG + Intergenic
987646865 5:20684657-20684679 ACATCTTACATGGCCAGAGCAGG - Intergenic
987777397 5:22385830-22385852 ACATCTTACATGGCCAGAGCAGG + Intronic
988360444 5:30230354-30230376 ACATCTTACATGGCTGGAGCAGG + Intergenic
988366648 5:30309371-30309393 ACATCTTACATGGCCAAAGCAGG - Intergenic
988671462 5:33386200-33386222 ATATCTTACACGGCTAGAGAAGG + Intergenic
989662499 5:43814848-43814870 ACATCTTACATGGCTGAAGCAGG - Intergenic
990494497 5:56334228-56334250 ACATCTTACATGGCTGGAGCGGG + Intergenic
991704439 5:69344726-69344748 ACGTCTTACATGGCTAGAGCAGG - Intergenic
992448359 5:76853980-76854002 ACATCTTACATGGCCAGAGCAGG - Intronic
992905146 5:81338446-81338468 ACGTCCTACATGGCTAGAGCAGG - Intronic
993119464 5:83756900-83756922 ACATCCTCCAAGACTAAACCAGG + Intergenic
993351833 5:86858996-86859018 ACATCTTACATGGCATAAGCAGG - Intergenic
993455029 5:88118053-88118075 ACATCTTACATGGCCAGAGCAGG + Intergenic
993583921 5:89699531-89699553 ACATCTTACATGGCCAGAGCAGG - Intergenic
993848213 5:92972336-92972358 ACATCTTACATGGCAAGAGCAGG + Intergenic
994137364 5:96303138-96303160 ACATCCTACATGGCTGGAGCAGG + Intergenic
994992891 5:107019916-107019938 ACAACTTACACAGCCAAAGCAGG + Intergenic
995460941 5:112402217-112402239 ACATTCTACATGGCTAGACCAGG - Intronic
995477908 5:112566356-112566378 ACATCCTACATGGCTAGAGCAGG + Intergenic
995477978 5:112566851-112566873 AAATCCTACATGGCTGGAGCAGG + Intergenic
995955146 5:117768822-117768844 ACGTCCTACATGGCTGGAGCAGG - Intergenic
996232963 5:121088488-121088510 ACATCCTAAATGGCTGGAGCAGG + Intergenic
996674584 5:126159219-126159241 ACATCTTACATGGCTGGAGCAGG + Intergenic
996911008 5:128656558-128656580 ACATCTTACATGGCTGGAGCAGG + Intronic
997273630 5:132563921-132563943 ACATCTTACACGGCCAGAACAGG - Intronic
997664137 5:135614941-135614963 ACGTCTTACATGGCTGAAGCAGG - Intergenic
997706230 5:135955729-135955751 ATGTCTTACACGGCTGAAGCAGG - Intergenic
1001244127 5:170093018-170093040 ACATCCTGCCTGGCTGAAGCAGG - Intergenic
1001944282 5:175766010-175766032 ACATCTTACACAGCTGGAGCAGG + Intergenic
1004242325 6:13936022-13936044 ACATCTTACATGGCCAGAGCAGG + Intronic
1004317544 6:14603264-14603286 ACGTCCTACATGGCTGGAGCAGG - Intergenic
1004476488 6:15978063-15978085 ACATCCTACATGTCTGAAGCAGG - Intergenic
1004984118 6:21060390-21060412 CCATCCTTCATGCCTAAAGCTGG + Intronic
1005046850 6:21651497-21651519 ACATCTTACATGGCCAGAGCAGG + Intergenic
1005879781 6:30047303-30047325 ACATCTTACATGGCTGAAGCAGG + Intergenic
1006731333 6:36238574-36238596 ACATCTTACATGGCCAAAGCAGG + Intergenic
1007438327 6:41834667-41834689 ACATCTTACATGGCTGGAGCAGG - Intronic
1008877420 6:56344814-56344836 ACGTCCTACATAGCTGAAGCAGG - Intronic
1010421480 6:75681305-75681327 ACATCTTACATGGCCAGAGCAGG - Intronic
1010466917 6:76178657-76178679 ACATCCTACATGGCCAGAGCAGG + Intergenic
1010552889 6:77244676-77244698 ACATCTCACATGGCTGAAGCAGG + Intergenic
1010642962 6:78353637-78353659 ACATCTTACATGGCTGGAGCAGG + Intergenic
1011349163 6:86403194-86403216 ACATCTTACATGGCTGTAGCAGG + Intergenic
1011567415 6:88691244-88691266 ACATCTTACATGGCCAGAGCAGG - Intronic
1011645675 6:89455698-89455720 ACATCTTACATGGCCAGAGCAGG - Intronic
1012128887 6:95466618-95466640 ACGTCCTACATGGCTGGAGCAGG + Intergenic
1012210374 6:96510872-96510894 CCATCTCACATGGCTAAAGCAGG - Intergenic
1013848019 6:114478262-114478284 ACATCTTACATGGCCAGAGCAGG + Intergenic
1013863838 6:114669795-114669817 ACATCCTACATGGCTGAAGCAGG + Intergenic
1014415720 6:121181410-121181432 ACATCTTACATGGCTGGAGCAGG - Intronic
1014638861 6:123883514-123883536 ACATCTTACATGGCTGGAGCAGG - Intronic
1014928676 6:127306565-127306587 ACGTCCTACATGGCTGGAGCAGG - Intronic
1014937429 6:127400610-127400632 ACATCTTACATGGCTGGAGCAGG + Intergenic
1015264619 6:131278630-131278652 ATATCTTACACGGCCAGAGCAGG + Intronic
1015329573 6:131961791-131961813 ACGTCCTACATGGCTGGAGCAGG - Intergenic
1015383143 6:132592684-132592706 ACATCTTACATGGCTGAAGCAGG - Intergenic
1016157241 6:140825881-140825903 ACATCCTACATGGCTGGAGCAGG + Intergenic
1016568045 6:145480283-145480305 ACATCTTACATGGCCAGAGCAGG + Intergenic
1016589372 6:145728028-145728050 ACGTCCTACATGGCTGGAGCAGG - Intronic
1018029116 6:159828127-159828149 ACATCTTACATGGCTGGAGCAGG + Intergenic
1020474649 7:8581411-8581433 ACATCTTACATGGCTGGAGCAGG + Intronic
1021055387 7:16041106-16041128 AGATCCTACATGGCTGGAGCAGG - Intergenic
1021368996 7:19818078-19818100 ACATCCTACATGGCTGGAGCAGG + Intergenic
1021763060 7:23920122-23920144 ACATATTACATGGCTAGAGCAGG - Intergenic
1022135416 7:27443007-27443029 ACAACCAACACGCCTATAGCAGG - Intergenic
1023275809 7:38517413-38517435 ACAGCTTACATGGCTGAAGCAGG - Intronic
1024895039 7:54249194-54249216 GCACGCTACACGGCAAAAGCAGG + Intergenic
1025708443 7:63887602-63887624 ACATCTTACATGGCTGGAGCAGG - Intergenic
1026334602 7:69382998-69383020 ACATCTTACATGGCTGGAGCAGG - Intergenic
1027566956 7:79807062-79807084 ACATCCTACATGACTGCAGCAGG - Intergenic
1027581749 7:80005444-80005466 ACATCTTACATGGCTGGAGCAGG - Intergenic
1027831338 7:83181966-83181988 ACATCCAACATGGCTGAAGAAGG + Intergenic
1028232743 7:88324777-88324799 ACATCTTACAGGGCCAGAGCAGG - Intergenic
1028257181 7:88613576-88613598 ACATCTTATATGGCCAAAGCAGG + Intergenic
1031182066 7:118431914-118431936 ACATCCTACATGGCTAGAACAGG - Intergenic
1031360534 7:120844065-120844087 ACATCTTACATGGCCAGAGCAGG + Intronic
1032994707 7:137432084-137432106 ACATCCTACATGGCTGGAGCAGG - Intronic
1033605760 7:142927565-142927587 ACATCCTACATGGCCGGAGCAGG + Intronic
1033671242 7:143495292-143495314 ACATCTTACACGGCCAGAGCAGG - Intergenic
1034362174 7:150509643-150509665 ACATCTTACAAGGCTGGAGCAGG - Intergenic
1035405564 7:158594914-158594936 ACATCTTACATGGCCAGAGCAGG - Intergenic
1038047872 8:23781524-23781546 CCATCCGACAGGGCCAAAGCTGG + Intergenic
1039116688 8:34099242-34099264 ACATCCTACATGGCTGGAGCAGG + Intergenic
1042750842 8:72156001-72156023 ACATCTTACATGGCTGGAGCAGG + Intergenic
1042893977 8:73645782-73645804 ACATCTTACATGGCCAAAGCAGG + Intronic
1043145538 8:76648880-76648902 ACATCTTACACAGCCAGAGCAGG - Intergenic
1043493324 8:80772483-80772505 ACATCTTACATGGCCGAAGCAGG + Intronic
1045679782 8:104646301-104646323 ACATCTTACATGGCTGGAGCAGG - Intronic
1047574611 8:126138968-126138990 ACATCCTACATGGCAGAAGTAGG - Intergenic
1048676156 8:136783537-136783559 ACATCTTACATGGCTGAAGCTGG - Intergenic
1049871640 8:144983396-144983418 ACATCTTACATGGCTGGAGCAGG - Intergenic
1050288793 9:4131577-4131599 ACATCTTACATGGCTGGAGCAGG - Intronic
1050444287 9:5702444-5702466 ACCTCTTACACGGCCAGAGCAGG + Intronic
1050604598 9:7287765-7287787 TCATCCTACACAGATTAAGCAGG - Intergenic
1050874956 9:10622847-10622869 ACATCTTACATGGCTGGAGCAGG + Intergenic
1051608348 9:18938416-18938438 GCATCCTACACGGCAGGAGCAGG + Intronic
1051818875 9:21141508-21141530 AGATCCAACAGGGCTATAGCTGG + Exonic
1052502001 9:29304012-29304034 ACTTCCTACAGGGCTAGAGCAGG + Intergenic
1054837440 9:69692711-69692733 ACATCTTACATGGCCAGAGCAGG + Intergenic
1054959582 9:70953030-70953052 AAATGCTATACTGCTAAAGCTGG + Intronic
1055453491 9:76452575-76452597 ACATCTTACACGGCTGGAGCAGG + Intronic
1056734535 9:89196764-89196786 ACATCTTACATGGCTAGAGCAGG + Intergenic
1059472218 9:114514307-114514329 ACATCTTACATGGCTGGAGCAGG + Intergenic
1060174610 9:121488259-121488281 ACATCCTAACAGGCTAAGGCGGG - Intergenic
1185754054 X:2638582-2638604 ACATCTTACATGGCCACAGCAGG - Intergenic
1186005456 X:5065982-5066004 ACATCCTACGTGCCTAGAGCAGG + Intergenic
1186373503 X:8970969-8970991 ACATCTTACACGGCTAGAGCAGG - Intergenic
1186656196 X:11614422-11614444 ACGTTCTACATGGCTAGAGCAGG + Intronic
1187209001 X:17210436-17210458 ACATCTTACATGGCCAGAGCAGG + Intergenic
1188105768 X:26145235-26145257 ACATCTTACATGGCTGAAGCAGG + Intergenic
1188822234 X:34789612-34789634 ACATCCTACATGGCTGGAGAAGG - Intergenic
1188989562 X:36801092-36801114 ACATCTTACATGGCCAGAGCAGG - Intergenic
1189053294 X:37669559-37669581 ACATCTTACATGGCCAGAGCAGG - Intronic
1189431232 X:40949582-40949604 ACATCTCACACGGCCAGAGCAGG + Intergenic
1189656347 X:43248796-43248818 ATATTCTACACGGCTGGAGCAGG - Intergenic
1189680438 X:43510483-43510505 ACTTACTAAAAGGCTAAAGCAGG + Intergenic
1190087513 X:47408723-47408745 ACATCTTACATGGCCAGAGCAGG + Intronic
1190506960 X:51135900-51135922 ACGTCCTACATGGCTGGAGCAGG - Intergenic
1190578407 X:51865922-51865944 ACATCTTACATGGCCAGAGCAGG - Intronic
1191873473 X:65770065-65770087 ACATCTTACAAGGCCAGAGCAGG - Intergenic
1192101932 X:68273960-68273982 ACATCTTACATGGCCAGAGCAGG + Intronic
1192114932 X:68400940-68400962 ACATCCTACATGGCCAGAGCAGG + Intronic
1192755236 X:74040210-74040232 ACATCTTACATGGCTGGAGCAGG + Intergenic
1193143398 X:78053504-78053526 ACATCTTACATGGCATAAGCAGG + Intergenic
1193332818 X:80255032-80255054 ACATCTTACATGGCTAGAGCAGG - Intergenic
1193406305 X:81106333-81106355 ACATCTTACATGGCCAGAGCAGG - Intergenic
1193634472 X:83931236-83931258 ACATCCTATATGGCCAGAGCAGG - Intergenic
1194206423 X:91016516-91016538 ACATCTTACATGGCCAGAGCAGG + Intergenic
1197006446 X:121507697-121507719 ACATCTTACATGGCTGGAGCAGG + Intergenic
1197640134 X:128958812-128958834 ACATCTTACATGGCTAGAGCAGG + Intergenic
1198506759 X:137308891-137308913 ACATCCTACATGGCTGGAGCAGG - Intergenic
1198818716 X:140622138-140622160 ACATCTTAGATGGCCAAAGCAGG + Intergenic
1199077756 X:143544208-143544230 ACATCTTACATGGCCAAAGCAGG + Intergenic
1199220666 X:145312219-145312241 ACATCTTACATGGCTGCAGCAGG + Intergenic
1199403627 X:147429766-147429788 ACGTCCTACATGGCTGGAGCAGG + Intergenic
1199945631 X:152664265-152664287 ACGTCTTACATGGCTGAAGCAGG - Intergenic
1200552175 Y:4591337-4591359 ACATCTTACATGGCCAGAGCAGG + Intergenic
1200563543 Y:4736097-4736119 ACATCCTACATGGTTGGAGCAGG + Intergenic
1201343339 Y:12956933-12956955 ACATCTTACATGACTAAAGCAGG + Intergenic
1201688005 Y:16728744-16728766 ACATCTTACATGGCAGAAGCAGG - Intergenic
1201728399 Y:17180298-17180320 ACATCTTACAGGGCCAGAGCAGG - Intergenic