ID: 928220075

View in Genome Browser
Species Human (GRCh38)
Location 2:29396144-29396166
Sequence GAGCCTTTTTTGTACCAAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 118
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 106}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
928220075_928220083 24 Left 928220075 2:29396144-29396166 CCCTCTTGGTACAAAAAAGGCTC 0: 1
1: 0
2: 1
3: 10
4: 106
Right 928220083 2:29396191-29396213 CTCCATGGTGGCAAGTATCCTGG 0: 1
1: 0
2: 1
3: 8
4: 107
928220075_928220082 12 Left 928220075 2:29396144-29396166 CCCTCTTGGTACAAAAAAGGCTC 0: 1
1: 0
2: 1
3: 10
4: 106
Right 928220082 2:29396179-29396201 GTGCTGCTTATACTCCATGGTGG 0: 1
1: 0
2: 0
3: 9
4: 72
928220075_928220080 9 Left 928220075 2:29396144-29396166 CCCTCTTGGTACAAAAAAGGCTC 0: 1
1: 0
2: 1
3: 10
4: 106
Right 928220080 2:29396176-29396198 CCCGTGCTGCTTATACTCCATGG 0: 1
1: 0
2: 0
3: 3
4: 78

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
928220075 Original CRISPR GAGCCTTTTTTGTACCAAGA GGG (reversed) Intronic
903274915 1:22215301-22215323 TAGCTCTTTATGTACCAAGATGG + Intergenic
905686309 1:39911204-39911226 CAGCCTTCTGGGTACCAAGAGGG + Intergenic
907438852 1:54465995-54466017 GAGCCTTTTTTTTTTTAAGATGG + Intergenic
907589771 1:55655170-55655192 GAGCCTTTGATGTACCATAAAGG + Intergenic
910331558 1:86078252-86078274 GGGTATTTTTTTTACCAAGAAGG - Intronic
911462475 1:98208002-98208024 AAGCCTTTTATGTACCAAGTAGG - Intergenic
917512972 1:175683455-175683477 GAGCCTTTTTTGGAGAAGGATGG - Intronic
1068765131 10:60754995-60755017 GAACTTTTTCTGTACCAAAATGG - Intergenic
1069317953 10:67131193-67131215 AAGCCTTTTCTGAGCCAAGAGGG + Intronic
1071169465 10:82847276-82847298 CAGCCTTCTTTGTACCATGTAGG - Intronic
1075661972 10:124203887-124203909 GAGCTTTTTATGTACCAACTTGG - Intergenic
1077418528 11:2437140-2437162 GAGCCTTTTTGTCACCATGAAGG - Intergenic
1077985814 11:7349882-7349904 GACCTATTTTTTTACCAAGATGG - Intronic
1078680839 11:13474169-13474191 GAGGCTTTTTTGGACTAAGAGGG - Intergenic
1085974402 11:81635103-81635125 GAACCTGTTTTTAACCAAGAGGG - Intergenic
1089969036 11:122677745-122677767 GAGCCTTTTTTTTTTCGAGAGGG - Intronic
1093110886 12:15150621-15150643 GGGCCTTTATTTTACAAAGAAGG + Intronic
1093800876 12:23371477-23371499 TAGCCTTTTTTATACCAAAGGGG + Intergenic
1096623045 12:52876477-52876499 AGGCCTTGTTTGTGCCAAGATGG - Intergenic
1098407125 12:70138583-70138605 GAGGCTTTTTTGGACTAAGAGGG + Intergenic
1099364332 12:81749032-81749054 GAGTCTTCTTTGTACAAAGTAGG + Intronic
1100707069 12:97212480-97212502 CAGCCATTTTGGCACCAAGAGGG + Intergenic
1105427950 13:20311957-20311979 TAGCCCTTTTAGTAACAAGAGGG - Intergenic
1106622186 13:31381514-31381536 GAGCCTTTTCTGTACACAGCAGG + Intergenic
1107487478 13:40843193-40843215 GAGTGTTTTTTTTATCAAGAAGG - Intergenic
1109230013 13:59745024-59745046 GAACCTTTTTTGTTCCAAGAAGG + Intronic
1112787479 13:102967004-102967026 GTGCCTTATTTATACAAAGAAGG - Intergenic
1113253712 13:108484483-108484505 GATCCTTTTTTGTAACAAAGAGG + Intergenic
1113555362 13:111229757-111229779 GAGACTTTTTTGTCCCAGGCAGG + Intronic
1115938892 14:38586810-38586832 GAGAGTTTTTTTTACCATGAAGG + Intergenic
1120416772 14:84229171-84229193 TACCTTATTTTGTACCAAGATGG - Intergenic
1121450372 14:94003181-94003203 GAGGGTTTGTTGTACCAAGATGG + Intergenic
1128848098 15:70919526-70919548 GAGAAATTATTGTACCAAGAGGG + Intronic
1129806293 15:78461894-78461916 GATACCTTTTTGTACCAAAAAGG + Intronic
1138183810 16:54961507-54961529 GTTCCTTTTTTTTTCCAAGATGG + Intergenic
1140146258 16:72312980-72313002 CAGCCTTTATTGAAACAAGATGG - Intergenic
1140406884 16:74717131-74717153 AGGCCTTTTTTGTTCCAAGGGGG + Intronic
1143940550 17:10536693-10536715 GAGCCTTTTTTCTACCCAGCTGG + Intronic
1147450042 17:40498719-40498741 GAGAATTTTTTGTAGAAAGAGGG + Intronic
1149304585 17:55335538-55335560 GAGCTATTTGTGTACCAAGCTGG + Intergenic
1150657320 17:67048084-67048106 GTGACTTTTTTGAACTAAGATGG - Intronic
1151691813 17:75691194-75691216 GCCCTTTTTTTGTACTAAGAGGG + Intronic
1151856007 17:76722490-76722512 GAGGCTTGTTTGAACCAAGGAGG + Intronic
1153161433 18:2208591-2208613 GAGACTTTTTTATACCATGTGGG - Intergenic
1156321201 18:36024794-36024816 TAGACTTTTTTGTACCAAGTAGG - Intronic
1160343827 18:78112873-78112895 CAGCCTTTCTTGTACACAGAGGG + Intergenic
927610986 2:24540396-24540418 CAGTCTTTTTGGTGCCAAGATGG + Intronic
928220075 2:29396144-29396166 GAGCCTTTTTTGTACCAAGAGGG - Intronic
933176810 2:79183507-79183529 GACCCTTTTTTGAAACAATAAGG - Intergenic
934219342 2:90067527-90067549 GAGCATTTTTTGTATTAATATGG - Intergenic
936917738 2:117657027-117657049 GAGCCTTTTCTGTATCCAGTGGG - Intergenic
941451428 2:165665269-165665291 CAGCCTCTTTTGTACCAACAAGG - Intronic
941482240 2:166030491-166030513 GTGCCTTTTTTGTTCCCAAAAGG + Intronic
942368045 2:175250279-175250301 GAGACTTTTTTGATCCAAAAGGG - Intergenic
942465788 2:176206234-176206256 GAGCATCTTTTGTACTCAGAAGG + Intergenic
943249160 2:185495088-185495110 AAACCTTTTTTTTTCCAAGATGG - Intergenic
944410128 2:199432379-199432401 GAGCCTCATTTGTACCAATAAGG - Intronic
946015463 2:216600596-216600618 GAGAATTTCTTGAACCAAGAAGG + Intergenic
1169948374 20:11014134-11014156 GAGCCTTATTTGTCCAAAGAAGG - Intergenic
1172215615 20:33233609-33233631 GGGCTTTGTTTGTACCAAGGAGG - Intergenic
1174203677 20:48824658-48824680 GAGCCTTATTTGTAAAAAGAGGG - Intronic
1179124836 21:38581457-38581479 GAGCATCTTTTGTTCTAAGAAGG + Intronic
1182093308 22:27610273-27610295 GAACCTTTTTTGAACAAGGAAGG - Intergenic
1182727926 22:32463030-32463052 GAAACTTTTTTTAACCAAGAAGG - Intronic
1184156048 22:42667892-42667914 GAGGCTTTGTAGTATCAAGAGGG - Intergenic
951482946 3:23180945-23180967 AAGACATTTTTGTACCTAGAGGG + Intergenic
952791198 3:37201926-37201948 GAACCCTTGTTGTACCAAGCAGG - Intergenic
954865440 3:53725265-53725287 CAGCCTTTTATGGACCAAGCAGG - Intronic
956075902 3:65505044-65505066 AAGGCATTTTTGTTCCAAGAGGG + Intronic
957757134 3:84504894-84504916 GAACATTTTTTTTTCCAAGAGGG - Intergenic
960810651 3:121624295-121624317 GAGCTTTTTATGTGCCAAGCAGG + Intronic
964880619 3:161419143-161419165 GAGCCTTGTTTAGCCCAAGATGG + Intergenic
969526059 4:7704669-7704691 GTGCCTTTTTTGGCCCAAGCTGG - Intronic
970355727 4:15250269-15250291 TTTCCTTTTTTGTCCCAAGACGG - Intergenic
974490609 4:62558819-62558841 GTGCCCTTCCTGTACCAAGAGGG - Intergenic
975465562 4:74705279-74705301 CAGGCTTTGTAGTACCAAGAGGG + Intergenic
982351561 4:154421002-154421024 GAGCCTTTTTTTTCCAATGATGG - Intronic
985320840 4:188709144-188709166 GAGACTTTTTTGTAACATCAAGG + Intergenic
986458945 5:7949799-7949821 GTGCCCTTTTTGTATCAATAGGG + Intergenic
987812453 5:22855636-22855658 GAGTCTTATTTGTCCCTAGATGG + Intergenic
989588300 5:43090162-43090184 AAGCATTTTTTGTATCTAGAAGG + Intronic
993491698 5:88559610-88559632 GATGCTTTTTTCTTCCAAGATGG - Intergenic
995346711 5:111129218-111129240 GAGCCCTTTTTGTACATATAAGG + Exonic
995346712 5:111129221-111129243 GAGCCTTATATGTACAAAAAGGG - Exonic
995796665 5:115948409-115948431 GAGACTTTTTTTTTCCACGAGGG - Intergenic
997444744 5:133932987-133933009 CAGGCTTTGTAGTACCAAGAGGG - Intergenic
1005393613 6:25359061-25359083 GTGTCTTTTTTCTGCCAAGATGG + Intronic
1008230257 6:48978554-48978576 GACCCATTTTTTTTCCAAGATGG + Intergenic
1011424769 6:87214403-87214425 GAATCTATTTTGTACCATGAAGG + Intronic
1012302861 6:97611872-97611894 GAGAGTTTTTTTTACCATGAAGG + Intergenic
1014330187 6:120055018-120055040 GAGTCTTTTTTTTTTCAAGACGG + Intergenic
1014964966 6:127736778-127736800 TTGCCCTTTTTGTAACAAGAAGG + Intronic
1021649089 7:22815521-22815543 TAGTTTTTTTTGTAGCAAGAAGG - Intronic
1023128298 7:36976680-36976702 GGGCCTTTCTTTTATCAAGAGGG + Intronic
1025605121 7:63034341-63034363 GAGGCTTGTTTGTCCCATGAAGG + Intergenic
1033152227 7:138925365-138925387 GAGCTTTATTTGCACCATGAGGG - Intronic
1033381994 7:140830544-140830566 GAGCATCTTTTGTTCCAACAAGG + Intronic
1033573396 7:142656243-142656265 GAGACTTTTTTGTTGTAAGAAGG - Intergenic
1036779848 8:11638821-11638843 GAGGCTTCTTTGTCCCATGAAGG - Intergenic
1040706104 8:50129594-50129616 GAGCCATTTCTCCACCAAGACGG - Intronic
1045178478 8:99753810-99753832 GAGTCTTGTTTGTACTTAGAGGG + Intronic
1045748273 8:105450788-105450810 GAGCCCTTTATGAAACAAGAGGG + Intronic
1045837679 8:106542110-106542132 GACCCTTTCTTTTACAAAGAGGG + Intronic
1046017710 8:108625484-108625506 GATAATTTTTAGTACCAAGAAGG - Intronic
1056202972 9:84294489-84294511 GAGCTTTTTTTGCTCAAAGAAGG + Intronic
1056367357 9:85918932-85918954 GTGCCTTTTAAGTCCCAAGAAGG - Intergenic
1056959057 9:91105762-91105784 GAGCCTTTTTTCTTCCCAAAGGG + Intergenic
1058015784 9:100030718-100030740 GAGCCTTTTTTCTCCCCAAAAGG + Intronic
1061287642 9:129633258-129633280 CAGCCTTTTCTGTACCAGGCTGG + Intronic
1061300349 9:129700953-129700975 GAACCTTTTTGCTACCAAGTTGG - Intronic
1186196319 X:7113224-7113246 GAGCCTTTTTGGTAGCATGGGGG - Intronic
1187286153 X:17905759-17905781 GAGCCAATTCTATACCAAGATGG + Intergenic
1188033218 X:25287940-25287962 GAGCCTATGGTGAACCAAGAAGG + Intergenic
1193065398 X:77254150-77254172 GAGCTTTTTTTGTACCACAGTGG + Intergenic
1193657033 X:84210992-84211014 GAGCCTTTTTTTTTTTAAGATGG - Intergenic
1196502829 X:116405490-116405512 GAGACTTTTTTGGATAAAGAAGG - Intergenic
1199437233 X:147826466-147826488 GTGCCTTTTTAGTCTCAAGATGG + Intergenic
1201611196 Y:15844904-15844926 GATCTCTTTTTGTACCATGAGGG - Intergenic