ID: 928220077

View in Genome Browser
Species Human (GRCh38)
Location 2:29396172-29396194
Sequence GGAGTATAAGCAGCACGGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 90
Summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 81}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
928220077_928220083 -4 Left 928220077 2:29396172-29396194 CCCTCCCGTGCTGCTTATACTCC 0: 1
1: 0
2: 1
3: 7
4: 81
Right 928220083 2:29396191-29396213 CTCCATGGTGGCAAGTATCCTGG 0: 1
1: 0
2: 1
3: 8
4: 107
928220077_928220086 15 Left 928220077 2:29396172-29396194 CCCTCCCGTGCTGCTTATACTCC 0: 1
1: 0
2: 1
3: 7
4: 81
Right 928220086 2:29396210-29396232 CTGGATAATAACGCTGTTGCAGG 0: 1
1: 0
2: 0
3: 5
4: 49

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
928220077 Original CRISPR GGAGTATAAGCAGCACGGGA GGG (reversed) Intronic
900607193 1:3529150-3529172 TGTGTGTAGGCAGCACGGGATGG - Intronic
901321680 1:8343913-8343935 GGAGTACAGGCAGCCCAGGAAGG - Exonic
901669521 1:10847597-10847619 GGACAATAAGCAGCACAGGATGG - Intergenic
905032691 1:34898291-34898313 TGAGGATAAGCAGCCAGGGAGGG + Intronic
909346274 1:74591256-74591278 GGAGTAGCAGAAGCAAGGGAAGG + Intronic
909677281 1:78252544-78252566 GGAGTGTAAGCAGCACAGATGGG - Intergenic
914764937 1:150629488-150629510 GGAGTGTAAGGGGCCCGGGAAGG + Exonic
915630990 1:157154236-157154258 GGAGCATTAGCAGCACAGGAAGG + Intergenic
918105111 1:181410109-181410131 GGAGTGGGAGCAGCAGGGGAGGG + Intergenic
920800773 1:209185442-209185464 GGAGAAAAAGCAGCAGGGGTGGG + Intergenic
923136634 1:231125554-231125576 GGACTATAAGCTCCACGGGGGGG + Intergenic
1074616086 10:115069560-115069582 GGAATATAAGCAGCATGCAAAGG - Intergenic
1076648338 10:131969886-131969908 TGAGTATAAGCAGCCAGGAAAGG + Intronic
1077661523 11:4072807-4072829 GGAGGATATTCAGCAAGGGAAGG + Intronic
1079357477 11:19742146-19742168 GGAGTATAAGGGGCTCAGGAGGG - Intronic
1089632372 11:119791780-119791802 GGAGTATCAGTAGGAGGGGAGGG - Intergenic
1089793752 11:120963717-120963739 GGAGTGTAACGAGCACGGGCTGG + Intronic
1095490819 12:42732147-42732169 GGATTATAAGCAACATGGGTAGG - Intergenic
1095622706 12:44277715-44277737 GCAGTAGATGCAGCATGGGAGGG - Intronic
1096493119 12:52023691-52023713 GGAGGAGGAGCAGCAGGGGAGGG - Intronic
1096868012 12:54576664-54576686 GGAGAATAAGCAGAAATGGAAGG + Exonic
1097638460 12:62150053-62150075 AGTGTTTAAGCAGCAGGGGATGG + Intronic
1100288692 12:93192607-93192629 AGAGTATAAGAAGCACTGTATGG - Intergenic
1114260370 14:21032220-21032242 GGAGAAGAGGCAGCACAGGAGGG + Intronic
1117947558 14:61045084-61045106 GTAGTAAAAGCAGCATGGTATGG + Intronic
1119189416 14:72670259-72670281 GGAATATAAGCAGAACGTCATGG - Exonic
1119711779 14:76827858-76827880 GGAGTATAAGGGGCAGGGCAGGG - Intronic
1120299941 14:82693073-82693095 GGAGTGTAAGGGGCCCGGGAAGG + Intergenic
1121061568 14:90914765-90914787 GGAGTATAAGTGCCAAGGGAAGG + Intronic
1127354947 15:58189194-58189216 GGAGTTTAAGCAGAAAGGTAGGG - Intronic
1128659267 15:69486028-69486050 AGAGTATAAGAAGCACTGGTAGG - Intergenic
1129314228 15:74731494-74731516 GGAGTCTAAGGAGCATAGGAAGG + Intergenic
1133848939 16:9483655-9483677 GGGGGAGAAGCAGCATGGGAAGG + Intergenic
1134346526 16:13396982-13397004 GGAGTATAAGCAGGAGGAGGAGG - Intergenic
1136021791 16:27445196-27445218 GGAGGAGAAGCAGCAGGTGAGGG - Exonic
1138874127 16:60928601-60928623 GGAATATAGGGAGCATGGGAAGG - Intergenic
1143055439 17:4158680-4158702 GAACTAGAAGCAGCATGGGAGGG - Intronic
1143906866 17:10216188-10216210 GGAGTAGGACCAGCACAGGAGGG + Intergenic
1151035517 17:70794097-70794119 GGCGTATAGGCAGGAGGGGATGG + Intergenic
1154361515 18:13666590-13666612 GGAGTATCTGCAGGACAGGATGG - Exonic
1160603138 18:80029714-80029736 GGAGTTTAAGCAGCACTAGGGGG - Intronic
1160872896 19:1285300-1285322 GGAGTGTGAGCAGCTGGGGATGG - Intergenic
1161042833 19:2119117-2119139 GGAGGATAAGCAGGATGGGCAGG + Intronic
1164292396 19:23880092-23880114 GGAGAATAAGGAGGACAGGAGGG + Intergenic
1167884991 19:52493135-52493157 GGACTTTAAGAAGCACGGGGCGG - Intronic
925850862 2:8080842-8080864 GGAGTTTAAGCACCACAGAAGGG + Intergenic
926492317 2:13539624-13539646 GGACAATAAGGAGCAAGGGAAGG + Intergenic
928220077 2:29396172-29396194 GGAGTATAAGCAGCACGGGAGGG - Intronic
939140069 2:138344285-138344307 GGAGTATAAGCAGCAAAGCAAGG - Intergenic
948382740 2:237562111-237562133 GTAGGGTAAGCAGCACGGGAAGG - Intergenic
1169655240 20:7915340-7915362 GGAGAATAAGAAGAAGGGGAAGG + Intronic
1180628906 22:17213653-17213675 GGAGGAGAAGCAGCACGGCCTGG + Intronic
1182918496 22:34058007-34058029 GGAGTCTACGCAGGACAGGATGG - Intergenic
1183215469 22:36476789-36476811 GGTGGCCAAGCAGCACGGGAAGG - Exonic
1184623393 22:45701140-45701162 ACAGTATAAGCAGCACAGCAGGG + Intronic
950884111 3:16347947-16347969 AGAGTAGAAGCAGCCCAGGAAGG + Intronic
952122096 3:30257681-30257703 GAAGTATAAGAAGCATGGCAAGG + Intergenic
962581278 3:136800130-136800152 GGAGTAGGAGCAGGACGGGAGGG - Intergenic
963550447 3:146715289-146715311 GGAGTAGAAGCAGAACTTGAGGG + Intergenic
964231671 3:154477317-154477339 GAAGTATAGGCAGCACCTGATGG + Intergenic
964551252 3:157887462-157887484 GCAGTAAAAGCAGCACCGCATGG + Intergenic
973133172 4:46673325-46673347 GGAGGAGAAGCAGCACGTGAAGG - Intergenic
975112883 4:70646685-70646707 GGAATGTAAGCAGTAGGGGATGG - Exonic
977961397 4:103089133-103089155 GGAGTCTAGGCAGCTCTGGAAGG - Intronic
980906628 4:138954467-138954489 GGAGAAAAAGCAGTGCGGGATGG - Intergenic
992436419 5:76759752-76759774 GGAGTGACAGCAGCAGGGGAGGG + Intergenic
1002312436 5:178323024-178323046 GGAGGCTAAGCAGGACGGGGTGG + Intronic
1008690343 6:53971815-53971837 ACAGTATTAGCATCACGGGAAGG - Intronic
1012855828 6:104500294-104500316 GGAATGTAAGCAGCACAGGTTGG - Intergenic
1013535604 6:111060611-111060633 GAAGTAGAAGCATCAGGGGATGG + Intergenic
1013613213 6:111815224-111815246 GGAGTAGAAGCAGCAGGAAATGG + Intronic
1018486139 6:164242926-164242948 GGAGTTTACGCAGCACGGGAGGG - Intergenic
1021835547 7:24669749-24669771 GGATTATAAGTAGCACAGGGGGG - Intronic
1022477979 7:30724022-30724044 TCAGTAGAAGCAGCAGGGGAGGG - Intronic
1027495792 7:78886611-78886633 GGAGTAGAATCAGCACTGGGTGG + Intronic
1027558000 7:79690479-79690501 GGAGTATAACCAGCACTCTAAGG - Intergenic
1030375738 7:108751357-108751379 GGAGTATGAGGAGGACAGGAAGG - Intergenic
1032983127 7:137307867-137307889 GGAGTAGAAGCAGCTGTGGAGGG - Intronic
1038777706 8:30545971-30545993 GAAGAAAAAGCAGCAGGGGAAGG - Intronic
1045201118 8:99982629-99982651 GGCGTAGAAGCAGGACTGGACGG - Intronic
1049325489 8:142019438-142019460 GGAGGATCAGGAGCACGGCAGGG - Intergenic
1049938892 9:525765-525787 GGAGAATAAGCAGCAAAGGTTGG + Intronic
1053441684 9:38121383-38121405 GGAGAATCAGCAGCTCCGGAAGG + Intergenic
1057800227 9:98186349-98186371 GGACTACAGGCAGCAGGGGAAGG + Intronic
1187004684 X:15220458-15220480 AGAGTATATGCAGCATGAGAAGG - Intergenic
1191190164 X:57658070-57658092 GGAATATAAGCAGCACCGCAGGG + Intergenic
1193640810 X:84007953-84007975 GGAGTGTAAGCAGCACTAGGGGG - Intergenic
1193847876 X:86497308-86497330 CAAGTATTAGCATCACGGGAAGG - Intronic
1195364558 X:104113764-104113786 GGAGTACAGGCAGGAGGGGATGG + Exonic
1197817612 X:130514307-130514329 GGAATATAAGAACCAGGGGATGG + Intergenic