ID: 928220078

View in Genome Browser
Species Human (GRCh38)
Location 2:29396173-29396195
Sequence TGGAGTATAAGCAGCACGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 75
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 68}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
928220078_928220083 -5 Left 928220078 2:29396173-29396195 CCTCCCGTGCTGCTTATACTCCA 0: 1
1: 0
2: 0
3: 6
4: 68
Right 928220083 2:29396191-29396213 CTCCATGGTGGCAAGTATCCTGG 0: 1
1: 0
2: 1
3: 8
4: 107
928220078_928220086 14 Left 928220078 2:29396173-29396195 CCTCCCGTGCTGCTTATACTCCA 0: 1
1: 0
2: 0
3: 6
4: 68
Right 928220086 2:29396210-29396232 CTGGATAATAACGCTGTTGCAGG 0: 1
1: 0
2: 0
3: 5
4: 49

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
928220078 Original CRISPR TGGAGTATAAGCAGCACGGG AGG (reversed) Intronic
905592092 1:39173040-39173062 TGGAGTAGAAAAAGCACTGGAGG + Intronic
907646615 1:56250947-56250969 GGGAGTAGAAGCAGAAAGGGAGG - Intergenic
909677282 1:78252545-78252567 CGGAGTGTAAGCAGCACAGATGG - Intergenic
920438796 1:205965001-205965023 TGGAGAAGAAGCAGCAGGTGAGG + Intergenic
920800772 1:209185441-209185463 GGGAGAAAAAGCAGCAGGGGTGG + Intergenic
920898932 1:210087241-210087263 TAGAGCCTAAGCAGCATGGGCGG - Intronic
923136633 1:231125553-231125575 TGGACTATAAGCTCCACGGGGGG + Intergenic
1065009303 10:21407163-21407185 TGGAGTTTAAGCCTCACAGGAGG - Intergenic
1071431239 10:85608720-85608742 TGGAGCATACCCAGCAAGGGGGG + Intronic
1075595024 10:123722898-123722920 TGGAGTATATCCATCACGGCAGG + Intronic
1079357478 11:19742147-19742169 TGGAGTATAAGGGGCTCAGGAGG - Intronic
1080808392 11:35678063-35678085 TGGAGTATAATCAGTAGTGGTGG + Intronic
1089632373 11:119791781-119791803 TGGAGTATCAGTAGGAGGGGAGG - Intergenic
1091100572 11:132869073-132869095 TGGAGCAAAAGCACCACTGGGGG + Intronic
1095806650 12:46327189-46327211 TGGAGACTAATCAGCACAGGTGG - Intergenic
1096258526 12:50077079-50077101 TGGAGAATGGGCTGCACGGGAGG + Intronic
1099749038 12:86747134-86747156 TGCAGGATAAGGAGCACTGGAGG - Intronic
1106226904 13:27792907-27792929 TTGAGTAGAGGCAGCGCGGGCGG - Exonic
1110543851 13:76735091-76735113 TGGAATATGAGCAGGACAGGAGG - Intergenic
1140970984 16:80012194-80012216 GCGTGTATTAGCAGCACGGGAGG + Intergenic
1141485746 16:84339273-84339295 TAGACTATAGGCAGCAGGGGCGG - Intergenic
1143774415 17:9188580-9188602 TGGAGCATAGGCAGCAATGGGGG + Intronic
1148555667 17:48577388-48577410 TGGAATCTGAGCAGCAAGGGTGG - Intronic
1156999719 18:43510107-43510129 GGGAGTAGAAGCTGCAGGGGTGG - Intergenic
1158879612 18:61764713-61764735 TGGAGCATAAGCAGAATGTGGGG + Intergenic
1160603139 18:80029715-80029737 TGGAGTTTAAGCAGCACTAGGGG - Intronic
925917150 2:8614910-8614932 TGGAGAATGAGCAGGACTGGGGG + Intergenic
928220078 2:29396173-29396195 TGGAGTATAAGCAGCACGGGAGG - Intronic
936116240 2:109705435-109705457 TGGAATATATGCAGCGAGGGTGG + Intergenic
940416819 2:153432622-153432644 TGGATGACAAGCAGCACTGGGGG - Intergenic
940714543 2:157205275-157205297 TGTAGTCCAAGCAGCTCGGGAGG - Intergenic
942657169 2:178226064-178226086 TGGGCCATAAGCAGCAAGGGAGG + Intronic
947383776 2:229570688-229570710 TGGAGTATGAGGGGCACGAGAGG + Intronic
1168879504 20:1194533-1194555 TGGAGTTTAATCACCATGGGAGG + Intergenic
1173802411 20:45902606-45902628 TGGGGGATGAGCAGCAGGGGCGG + Intronic
1178155889 21:29853909-29853931 TGCTGTGTAAGCAGCATGGGTGG + Intronic
1181437080 22:22917321-22917343 TGGAGTGTCACCGGCACGGGGGG - Intergenic
1183078617 22:35442185-35442207 TGGAGTATAATATACACGGGTGG - Intergenic
1183568231 22:38632089-38632111 TGGAGGAAAAGCAGAACGGATGG + Intronic
949437250 3:4042920-4042942 GAGAGAATAAGCAGCACTGGTGG - Intronic
957198646 3:77103087-77103109 TGGAGCAGAAGGAGCACAGGGGG + Intronic
962581279 3:136800131-136800153 TGGAGTAGGAGCAGGACGGGAGG - Intergenic
963458016 3:145572066-145572088 TGGAGTATAAGAAGCATGATAGG - Intergenic
963721896 3:148871018-148871040 TGTAGTATAAGCTACTCGGGAGG - Intronic
963932249 3:151015465-151015487 TGGAGAATAAGGTGCACGGTAGG - Intergenic
969939063 4:10712294-10712316 TGGAGTATATGGATCAGGGGTGG + Intergenic
979029148 4:115618375-115618397 CTGAGTAGAAGCAGCACGGATGG - Intergenic
987336396 5:16901348-16901370 GAGAGTAGAACCAGCACGGGTGG - Intronic
987979066 5:25056262-25056284 TGGACTATGAGCTGAACGGGGGG + Intergenic
988927033 5:36000154-36000176 TGGGGTGTAAGCAGCACTAGGGG - Intergenic
992524378 5:77593358-77593380 TAGACTATAAGCAGCAAGAGTGG + Intronic
998874335 5:146584090-146584112 TGGGGAATGAGCAGCAGGGGCGG + Intronic
999501557 5:152151785-152151807 TGGAGAATAACCAGCACATGTGG - Intergenic
1005000206 6:21232686-21232708 AGGACTAGAAGCAGCACAGGAGG - Intergenic
1017019489 6:150128837-150128859 AGGTGTATAAGCAGAACGTGTGG + Intergenic
1018486140 6:164242927-164242949 AGGAGTTTACGCAGCACGGGAGG - Intergenic
1021835548 7:24669750-24669772 GGGATTATAAGTAGCACAGGGGG - Intronic
1031844503 7:126788486-126788508 TGTAGTATAAGTAGGATGGGAGG - Intronic
1036596955 8:10221918-10221940 TGGCGTGTAATCAGCAAGGGAGG + Intronic
1037408429 8:18568431-18568453 AGGAGTCTAAGAAGCAAGGGGGG + Intronic
1044648191 8:94467048-94467070 TGGAGTATCAGCTACTCGGGAGG - Intronic
1055485993 9:76756854-76756876 TGCAGTTTAAGTATCACGGGGGG - Intronic
1057366767 9:94429764-94429786 TGGAGTAAATGCAGCACCGCTGG - Intronic
1057656568 9:96958300-96958322 TGGAGTAAATGCAGCACCGCTGG + Intronic
1057818701 9:98315048-98315070 TGGAATGTCAGCAGCACAGGGGG - Intronic
1058377774 9:104343898-104343920 TGTAGTACCAGCAGCTCGGGAGG + Intergenic
1059195649 9:112368681-112368703 TGGAGTGTATGCAGCACTAGTGG + Intergenic
1061893161 9:133633357-133633379 TGGAGCAGAGGCAGCAGGGGTGG + Intergenic
1203719613 Un_GL000216v2:3756-3778 TGGAATAGAAGCAACACGAGTGG - Intergenic
1186699003 X:12069390-12069412 TAGACTATAGGCAGCAAGGGTGG + Intergenic
1190515832 X:51222918-51222940 TGCAGCATAAGCAGCAGAGGTGG + Intergenic
1191190163 X:57658069-57658091 TGGAATATAAGCAGCACCGCAGG + Intergenic
1193640811 X:84007954-84007976 TGGAGTGTAAGCAGCACTAGGGG - Intergenic
1195017939 X:100796999-100797021 CGTAGTATAAGCAGCACTAGGGG - Intergenic
1196212802 X:113013978-113014000 TGGAGTACTAGCAACATGGGAGG - Intergenic