ID: 928220079

View in Genome Browser
Species Human (GRCh38)
Location 2:29396176-29396198
Sequence CCATGGAGTATAAGCAGCAC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 136
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 127}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
928220079_928220083 -8 Left 928220079 2:29396176-29396198 CCCGTGCTGCTTATACTCCATGG 0: 1
1: 0
2: 0
3: 8
4: 127
Right 928220083 2:29396191-29396213 CTCCATGGTGGCAAGTATCCTGG 0: 1
1: 0
2: 1
3: 8
4: 107
928220079_928220087 30 Left 928220079 2:29396176-29396198 CCCGTGCTGCTTATACTCCATGG 0: 1
1: 0
2: 0
3: 8
4: 127
Right 928220087 2:29396229-29396251 CAGGCTTGATAGATGTTAAGAGG 0: 1
1: 0
2: 1
3: 9
4: 97
928220079_928220086 11 Left 928220079 2:29396176-29396198 CCCGTGCTGCTTATACTCCATGG 0: 1
1: 0
2: 0
3: 8
4: 127
Right 928220086 2:29396210-29396232 CTGGATAATAACGCTGTTGCAGG 0: 1
1: 0
2: 0
3: 5
4: 49

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
928220079 Original CRISPR CCATGGAGTATAAGCAGCAC GGG (reversed) Intronic
901459736 1:9384394-9384416 CCATCGAGTCTAAGCAGTTCTGG + Intergenic
901669522 1:10847601-10847623 CATTGGACAATAAGCAGCACAGG - Intergenic
904473345 1:30749145-30749167 CAATGGAGTATACACAGCAATGG + Intronic
904752279 1:32748495-32748517 CCAGGCAGGAGAAGCAGCACAGG - Intronic
905911918 1:41661426-41661448 CCCTGGAGTAGAAGCCGCTCTGG + Intronic
912569658 1:110612147-110612169 CCTTTGAGTATTAGCAGCAGGGG - Intronic
912690502 1:111801254-111801276 CCATGCAGTCTGTGCAGCACAGG + Intronic
912860217 1:113207518-113207540 CAAAGGAGTATAAGCAACATAGG - Intergenic
920292444 1:204933303-204933325 AGATGGAGAATAAGCAACACTGG + Intronic
921269609 1:213455716-213455738 CCATGGAATATAAGCTACAGAGG + Intergenic
923063980 1:230501303-230501325 CCATGGATGAAAACCAGCACAGG - Intergenic
923873972 1:238027821-238027843 TTATGGAGTATTAGCAGTACAGG - Intergenic
1064502530 10:15989959-15989981 GCATGGAGTATCAACATCACAGG - Intergenic
1066453252 10:35550255-35550277 TCACGGACTATGAGCAGCACAGG - Intronic
1067288906 10:44927406-44927428 CCCAGGAGTTTAATCAGCACTGG + Intronic
1069817491 10:71207610-71207632 CCATAAAGCATAAGCAGGACTGG + Intergenic
1072832947 10:98678521-98678543 CCATGGAGTTTAAGCACCCAGGG + Intronic
1073629496 10:105134383-105134405 CCATGGTTTATAAGCAGAAAGGG - Intronic
1074543468 10:114385031-114385053 ATATGAAGTATAAGCAGCAGGGG + Intronic
1074548261 10:114418971-114418993 CCTTGGGTTAGAAGCAGCACAGG + Intergenic
1077719919 11:4617825-4617847 CCATCGAGTTTAAACTGCACAGG - Intergenic
1078954910 11:16182198-16182220 CCAGTCAGTATAAACAGCACTGG + Intronic
1089787371 11:120917672-120917694 CCATGGAAAATAACCAGCACAGG - Intronic
1090554788 11:127862628-127862650 CCATGGAATGTAAGCCACACGGG + Intergenic
1096229038 12:49887406-49887428 CCATGCAGTTTATGCAGCACTGG - Exonic
1102299528 12:111761010-111761032 CCATGGAGTAGAAAGAGCTCTGG - Intronic
1102884760 12:116513029-116513051 CCATGGAGTGTCATCAGCCCAGG - Intergenic
1103920110 12:124394977-124394999 CCCTGGAGGATGAGCAGCAGAGG - Intronic
1105472730 13:20706686-20706708 ACATGGAGAGTTAGCAGCACTGG + Intronic
1111359223 13:87152908-87152930 GCATGATGTATAAGCAGCACTGG + Intergenic
1114251313 14:20964055-20964077 CCACGTAGTATCAGCTGCACTGG + Intergenic
1119165702 14:72490695-72490717 CCCTGGGGTAGAAGCAGCAGTGG - Intronic
1119759130 14:77139315-77139337 CCATGGAGTAGAGGCAGGCCAGG + Exonic
1129071197 15:72952936-72952958 CCCTGGGTTTTAAGCAGCACTGG + Intergenic
1129314226 15:74731490-74731512 CCCTGGAGTCTAAGGAGCATAGG + Intergenic
1129698745 15:77755400-77755422 GCATGGAGGGGAAGCAGCACAGG + Intronic
1130157452 15:81363918-81363940 CCCTGAAGTCTAAGAAGCACAGG + Intronic
1130680883 15:85995716-85995738 TCATGGTGTATATGCACCACAGG - Intergenic
1131969049 15:97874248-97874270 CAAGGGAGAATAAACAGCACCGG - Intergenic
1132624618 16:886204-886226 GCATGGAGGATGGGCAGCACAGG + Intronic
1135313451 16:21423155-21423177 CCATGGAGGATGTGCAGCATGGG + Intronic
1135366375 16:21855433-21855455 CCATGGAGGATGTGCAGCATGGG + Intronic
1135445440 16:22515731-22515753 CCATGGAGGATGTGCAGCATGGG - Intronic
1135967048 16:27044460-27044482 CCATGGAGTAGAAGCCAAACTGG + Intergenic
1136152596 16:28360875-28360897 CCATGGAGGATGTGCAGCATGGG + Intronic
1136194153 16:28640307-28640329 CCATGGAGGATGTGCAGCATGGG - Intronic
1136210486 16:28754406-28754428 CCATGGAGGATGTGCAGCATGGG - Intronic
1136310115 16:29401855-29401877 CCATGGAGGATGTGCAGCATGGG + Intronic
1136323562 16:29503660-29503682 CCATGGAGGATGTGCAGCATGGG + Intronic
1136438247 16:30243629-30243651 CCATGGAGGATGTGCAGCATGGG + Intronic
1138856750 16:60702765-60702787 CCATGGTTTATATGGAGCACCGG - Intergenic
1139857802 16:69994259-69994281 CCATGGAGGATGTGCAGCATGGG + Intergenic
1141680963 16:85543594-85543616 CCATTGGTTCTAAGCAGCACTGG + Intergenic
1143514830 17:7414367-7414389 CCATGGAGAAACAGCATCACAGG - Exonic
1147019690 17:37521429-37521451 CTATGCAGAACAAGCAGCACAGG + Intronic
1149819223 17:59758754-59758776 CCTAGGAGTTTAAGCAACACAGG + Intronic
1150150141 17:62802518-62802540 CCCTGGATTATAAGCAACACAGG - Intronic
1154119248 18:11637512-11637534 CCATGGAGGATGTGCAGCATGGG + Intergenic
1156374881 18:36504375-36504397 CCATGGTGTATATGAAGCACAGG - Intronic
1157095743 18:44684038-44684060 CCCTGGAGGGTTAGCAGCACTGG + Intronic
1157901987 18:51526734-51526756 CCCTGGGGTAGAAGCAGCCCTGG + Intergenic
1164623316 19:29710618-29710640 CCATGGAGTATGAGAGGCAGTGG + Intronic
1166124306 19:40704592-40704614 GCATGGCGAATAAGCAGAACAGG + Intronic
927869070 2:26612461-26612483 CCAGAAAGTAGAAGCAGCACTGG - Intronic
928220079 2:29396176-29396198 CCATGGAGTATAAGCAGCACGGG - Intronic
930032710 2:47068307-47068329 ACATGGGGCATAAGCAGCAGAGG - Intronic
930200221 2:48545620-48545642 CCATGGAGAGTGAGGAGCACAGG - Intronic
935484588 2:103638036-103638058 TGATGAAGAATAAGCAGCACTGG - Intergenic
938652857 2:133401668-133401690 TTATGGAGTAAAAGTAGCACAGG + Intronic
938689152 2:133770940-133770962 CCATGGAGTAAAACCAGAAGAGG + Intergenic
938988589 2:136604775-136604797 CCATGGAGTGTAAGAAGATCTGG + Intergenic
939297853 2:140293030-140293052 CCAGGGAGAATAAGCTGTACAGG + Intronic
942951761 2:181729457-181729479 CCAAGGAGTAGAAGCAGGATTGG - Intergenic
944296287 2:198066771-198066793 CCATGCAGAAGAAACAGCACGGG - Intronic
945185740 2:207137634-207137656 ATATGGAATATAAGCAGTACAGG + Intronic
947182529 2:227424190-227424212 CCATATAGTTTAAGAAGCACTGG + Intergenic
1170565940 20:17605300-17605322 CCATGGAGGTTAAGCAGTTCTGG - Intronic
1172861868 20:38060622-38060644 CCAGGCAGTGGAAGCAGCACAGG + Intronic
1173323130 20:42007597-42007619 ACATGTAGTATAAAGAGCACAGG + Intergenic
1177677683 21:24323118-24323140 CCATGGAAGATAAGCAGTAAGGG + Intergenic
1178730107 21:35094061-35094083 CCACGGGGTAGAAGCAGCCCTGG - Intronic
1179358739 21:40685646-40685668 CTATGGAGCAAAAGCAGCAAAGG - Intronic
1184160437 22:42694267-42694289 CCATGGTGTGTAACCATCACAGG + Intronic
949437251 3:4042923-4042945 GCAGAGAGAATAAGCAGCACTGG - Intronic
949903887 3:8842575-8842597 GCAGGGAGTATAAGGATCACTGG - Intronic
950271888 3:11623234-11623256 CCATGGAACAGAAGCAGCAAAGG + Intronic
950460845 3:13121501-13121523 GCATGGAGTTTGAGCATCACAGG + Intergenic
953750988 3:45608231-45608253 CACAGGATTATAAGCAGCACAGG - Intronic
954177982 3:48859328-48859350 CCAAGGAGTGCCAGCAGCACTGG - Intronic
954655704 3:52192860-52192882 CCAAGGAGCAGCAGCAGCACAGG + Intergenic
958586153 3:96091015-96091037 CCATGGAGGACAAGCAGAAGTGG + Intergenic
959907815 3:111730019-111730041 CCATGAAGTATAAGGAGATCTGG + Intronic
960814859 3:121661956-121661978 CCAAGGAGTTTAAGCAGGACTGG + Intergenic
962933509 3:140058955-140058977 CCATGGAGGATAAGAAGCTATGG + Intronic
965873101 3:173284307-173284329 TCATGGAGTAGAAGGAGCTCGGG + Intergenic
967912653 3:194555228-194555250 ACATGGAGAATAACCAGCTCGGG - Intergenic
969418408 4:7075748-7075770 CAGTGGAGGATCAGCAGCACGGG + Intergenic
969571163 4:8009287-8009309 CCAGGGAGCATCAGCAGCAGGGG + Intronic
969895020 4:10295609-10295631 CCTTGGAGTATAAGCAGATGTGG + Intergenic
971427831 4:26533433-26533455 CTATGGAGTAAAAGAAACACAGG + Intergenic
972276825 4:37565439-37565461 CCATGGAGGAGGAGCAGCACCGG + Intronic
979926279 4:126568970-126568992 CCATGAAGTATTAGGATCACAGG + Intergenic
986171245 5:5316646-5316668 ACTTGGAGTATCAACAGCACAGG - Intronic
986398690 5:7357441-7357463 CCACTGAGTATAAGTAGCACAGG + Intergenic
988845048 5:35119272-35119294 GCATGGAGGATATTCAGCACTGG - Intronic
991298749 5:65107179-65107201 CCTTGGAGGATAAGGACCACAGG - Intergenic
996188446 5:120509215-120509237 ACATGGTTTATAAGCACCACAGG + Intronic
999963464 5:156782966-156782988 CCATGGAGAATGAGCAGGGCAGG + Intergenic
1000997129 5:167970780-167970802 CACTGGAGTATAAACAGCAATGG - Intronic
1002437001 5:179237833-179237855 CCTTGCAGTACAAGAAGCACTGG - Intronic
1002762379 6:211883-211905 CCATGCAGGAGAGGCAGCACAGG - Intergenic
1012855829 6:104500298-104500320 CTAGGGAATGTAAGCAGCACAGG - Intergenic
1015152136 6:130052067-130052089 CCATGTATTTTAATCAGCACAGG + Intronic
1018555878 6:165050214-165050236 CCATGGAGGGAAAGCAGCAGCGG + Intergenic
1019716077 7:2539964-2539986 CCCTGGAGTACGGGCAGCACAGG - Intronic
1022269586 7:28793248-28793270 CCAAGGAGAAAAAGCAGGACTGG + Intronic
1023623760 7:42096724-42096746 GCATGGAGAGTAAGCAGCAAGGG + Intronic
1024082962 7:45870845-45870867 ACTTGGAGAATAATCAGCACTGG + Intergenic
1031057553 7:117010175-117010197 CCATGGAGAATGTGGAGCACTGG + Intronic
1033172231 7:139094271-139094293 ACTTGGAGTATAGGCAGCTCAGG + Intronic
1035446675 7:158947883-158947905 TCATGGAGCAGAAGCTGCACAGG - Intronic
1038184705 8:25262982-25263004 CTATGTAGTGTAAGCAGCAGAGG + Intronic
1038651374 8:29406885-29406907 CCATGGAATGTGAGCAGGACTGG - Intergenic
1042275728 8:67003517-67003539 CCTTGGACAATAGGCAGCACAGG - Intronic
1043373506 8:79621085-79621107 CCATGCAGCACCAGCAGCACTGG - Intronic
1043874081 8:85464624-85464646 CCATGGATTCAAACCAGCACTGG - Intronic
1045201119 8:99982633-99982655 CCTTGGCGTAGAAGCAGGACTGG - Intronic
1046609663 8:116409697-116409719 CCAGGGAGTTTAAGTAGAACCGG + Intergenic
1046692841 8:117305037-117305059 CCATAGAGTATGTGCAGCAGAGG - Intergenic
1057764243 9:97902161-97902183 CCATAAAGAATAAGCTGCACAGG + Intergenic
1058878361 9:109264460-109264482 TCATTGAGTATAAGAAGCATTGG - Intronic
1059526900 9:115000408-115000430 CCATGGAGTCCAAGGAGGACGGG - Intergenic
1060546918 9:124467410-124467432 CCATGGAGTATCATCAGAATGGG - Intronic
1061117156 9:128621137-128621159 CCCTGGAGTAGAAGCAGCCAAGG - Exonic
1062009794 9:134260889-134260911 CCATGAAGTATGAGCTGCTCTGG - Intergenic
1195434821 X:104830030-104830052 TCATGTAGTAAAAACAGCACAGG - Intronic