ID: 928220081

View in Genome Browser
Species Human (GRCh38)
Location 2:29396177-29396199
Sequence ACCATGGAGTATAAGCAGCA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 152
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 134}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
928220081_928220083 -9 Left 928220081 2:29396177-29396199 CCGTGCTGCTTATACTCCATGGT 0: 1
1: 0
2: 0
3: 17
4: 134
Right 928220083 2:29396191-29396213 CTCCATGGTGGCAAGTATCCTGG 0: 1
1: 0
2: 1
3: 8
4: 107
928220081_928220087 29 Left 928220081 2:29396177-29396199 CCGTGCTGCTTATACTCCATGGT 0: 1
1: 0
2: 0
3: 17
4: 134
Right 928220087 2:29396229-29396251 CAGGCTTGATAGATGTTAAGAGG 0: 1
1: 0
2: 1
3: 9
4: 97
928220081_928220086 10 Left 928220081 2:29396177-29396199 CCGTGCTGCTTATACTCCATGGT 0: 1
1: 0
2: 0
3: 17
4: 134
Right 928220086 2:29396210-29396232 CTGGATAATAACGCTGTTGCAGG 0: 1
1: 0
2: 0
3: 5
4: 49
928220081_928220088 30 Left 928220081 2:29396177-29396199 CCGTGCTGCTTATACTCCATGGT 0: 1
1: 0
2: 0
3: 17
4: 134
Right 928220088 2:29396230-29396252 AGGCTTGATAGATGTTAAGAGGG 0: 1
1: 0
2: 1
3: 6
4: 140

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
928220081 Original CRISPR ACCATGGAGTATAAGCAGCA CGG (reversed) Intronic
900470308 1:2850711-2850733 ACCATGGAGCTTATGCAGCCTGG - Intergenic
900736544 1:4302874-4302896 GCCATGGAGGAGCAGCAGCAGGG - Intergenic
901039837 1:6357310-6357332 ACCATGGAGTAAAGGAAGCAAGG - Intronic
902252935 1:15167376-15167398 ACCATGGAATAAATGCAGTATGG - Intronic
906030818 1:42718564-42718586 ACCATGGAGGAAAATCAGGAAGG - Intergenic
908151640 1:61308845-61308867 AGCATGGAGTATCACCACCAGGG - Intronic
909518069 1:76534367-76534389 ACCATGGAGTATTAGAGACATGG - Intronic
910914944 1:92278646-92278668 AGAATGGTGTAGAAGCAGCAAGG - Intronic
911379014 1:97088964-97088986 ACTATGGAGCATAAACAGGAGGG - Intronic
912569660 1:110612148-110612170 GCCTTTGAGTATTAGCAGCAGGG - Intronic
912611238 1:111046911-111046933 ACCATGGAATATATACATCATGG - Intergenic
916345937 1:163791572-163791594 GCCATGGACTATTAGCACCAGGG + Intergenic
924658167 1:245992460-245992482 GCCATGTAGTAAAATCAGCATGG + Intronic
1065781195 10:29169454-29169476 ACAATGTATTATGAGCAGCAAGG + Intergenic
1065972373 10:30815838-30815860 AGCAAAGAGTATAAGAAGCATGG + Intergenic
1068259173 10:54555825-54555847 ACTATGGAGTACAAGGAGCCTGG + Intronic
1070089402 10:73270006-73270028 ACCATGGAGTTTCAGGTGCAAGG + Intronic
1070178573 10:73993803-73993825 ACTATGGAGGAAAAGCAGAACGG + Intergenic
1071046838 10:81389163-81389185 AACATGGACAATAAGTAGCATGG + Intergenic
1071150454 10:82628396-82628418 GCCGTGGAGTATAAACAGGATGG + Intronic
1072832945 10:98678520-98678542 TCCATGGAGTTTAAGCACCCAGG + Intronic
1073629498 10:105134384-105134406 TCCATGGTTTATAAGCAGAAAGG - Intronic
1074543467 10:114385030-114385052 CATATGAAGTATAAGCAGCAGGG + Intronic
1075595023 10:123722894-123722916 AGCATGGAGTATATCCATCACGG + Intronic
1075917296 10:126179706-126179728 ACCATGGAGTATGTGAACCATGG - Intronic
1078540605 11:12210327-12210349 ACCATGGGTTATAAACAACATGG + Intronic
1080442728 11:32310327-32310349 ACCAAGGAGCATAAGATGCATGG + Intergenic
1086292016 11:85322260-85322282 ACCAAGGAATATAAGCTGAATGG - Intronic
1091333335 11:134748404-134748426 ACCATGGAGTCCAAGCAGATGGG + Intergenic
1092728484 12:11507212-11507234 ACCATGGTGTGTCAGCAGGAGGG - Intergenic
1095263291 12:40123474-40123496 ACCATGCAATATAAGCAGCTAGG + Intergenic
1100158819 12:91833729-91833751 ACAATGGAATATAGGCAGAAGGG + Intergenic
1100853719 12:98739873-98739895 GCCATGGAGCAGAAGCAGCAGGG - Intronic
1102732333 12:115123109-115123131 ACCATGGAGTATATGATGCTCGG + Intergenic
1103423544 12:120810817-120810839 ACCATAGACTATAAGAAGAATGG + Exonic
1105674967 13:22661298-22661320 ACAATTTATTATAAGCAGCAAGG - Intergenic
1105993802 13:25650186-25650208 AGCATGGAATAAAAGCCGCATGG - Intronic
1106795668 13:33202503-33202525 ACCAGGGAGTCAAAGCAGCATGG + Intronic
1111493251 13:89013009-89013031 AGCATGGAGAATAAGAAGCATGG + Intergenic
1117240019 14:53821677-53821699 AACATAAAGTATAAGCAGAAAGG + Intergenic
1119711782 14:76827863-76827885 GCCAGGGAGTATAAGGGGCAGGG - Intronic
1121713406 14:96055740-96055762 ACCATGGAGAGGAGGCAGCAGGG + Intronic
1123837812 15:24213824-24213846 ACCATGGAGTACCAGTAGCATGG + Intergenic
1123847345 15:24316123-24316145 ACCATGGAGTACCAGTAGCATGG + Intergenic
1123866338 15:24523192-24523214 ACCATGGAGTACCAGTAGCATGG + Intergenic
1127006890 15:54580911-54580933 ACCATGGAGTGTATGGAGAAGGG - Intronic
1127797120 15:62448100-62448122 AACTTGGAGCAGAAGCAGCATGG + Intronic
1132652613 16:1028467-1028489 ACCATGGAGCAAGAGCAGGAGGG + Intergenic
1135313449 16:21423154-21423176 GCCATGGAGGATGTGCAGCATGG + Intronic
1135366373 16:21855432-21855454 GCCATGGAGGATGTGCAGCATGG + Intronic
1135445442 16:22515732-22515754 GCCATGGAGGATGTGCAGCATGG - Intronic
1136152594 16:28360874-28360896 GCCATGGAGGATGTGCAGCATGG + Intronic
1136194155 16:28640308-28640330 GCCATGGAGGATGTGCAGCATGG - Intronic
1136210488 16:28754407-28754429 GCCATGGAGGATGTGCAGCATGG - Intronic
1136310113 16:29401854-29401876 GCCATGGAGGATGTGCAGCATGG + Intronic
1136323560 16:29503659-29503681 GCCATGGAGGATGTGCAGCATGG + Intronic
1136438245 16:30243628-30243650 GCCATGGAGGATGTGCAGCATGG + Intronic
1138383422 16:56619181-56619203 ACCATGGAGTTTGAGAAGCCCGG - Intergenic
1139857800 16:69994258-69994280 GCCATGGAGGATGTGCAGCATGG + Intergenic
1140449264 16:75057195-75057217 ACAATGGAGTCAAAGGAGCAGGG - Intronic
1142877563 17:2861223-2861245 ACCATGGAGGAAATACAGCAGGG - Intronic
1144369427 17:14575886-14575908 AACATGGAGCATGAACAGCAAGG - Intergenic
1148995136 17:51702867-51702889 ACCTTGGAGTAGTAGCAGCCAGG + Intronic
1154119246 18:11637511-11637533 GCCATGGAGGATGTGCAGCATGG + Intergenic
1156194038 18:34753242-34753264 AACAAGTAGTACAAGCAGCAAGG + Intronic
1158782492 18:60667979-60668001 GCCTTGGAGTATAAGGAGAATGG + Intergenic
927676926 2:25113037-25113059 ACCCTGTAGTATAGGCAGCTAGG - Intronic
928220081 2:29396177-29396199 ACCATGGAGTATAAGCAGCACGG - Intronic
930139890 2:47940890-47940912 GTCAGGGAGTTTAAGCAGCATGG + Intergenic
933503272 2:83143835-83143857 ACCCTTGAGTATAAGGTGCATGG + Intergenic
937805050 2:126129777-126129799 ACAATGGAGTGTAAGTGGCAGGG - Intergenic
940960025 2:159774887-159774909 AACATGGAGTTGAAGCAGCAAGG - Intronic
945206779 2:207341137-207341159 AATATGGAGGAAAAGCAGCAGGG + Intergenic
946509953 2:220345162-220345184 ACCCTGGAGAAGAAGGAGCAAGG + Intergenic
947871914 2:233443942-233443964 ACCATGGAGCAGTAGCAGCCAGG - Intronic
948767734 2:240232205-240232227 ACCCTTGAGTGTGAGCAGCAAGG + Intergenic
1169809248 20:9592756-9592778 ACCATGCAGTTTAAGCTGAAAGG + Intronic
1170489787 20:16861482-16861504 AACATGTAGGCTAAGCAGCAGGG - Intergenic
1172266050 20:33615221-33615243 TCCATGGTGTATAAGAAGTAAGG + Intronic
1175157198 20:56979152-56979174 GCCTTGGGATATAAGCAGCATGG + Intergenic
1177677681 21:24323117-24323139 ACCATGGAAGATAAGCAGTAAGG + Intergenic
1178576902 21:33801426-33801448 ACCATGGGCTAGAAGAAGCAAGG + Intronic
1181992393 22:26847338-26847360 AGACTGGAGTATAAGCAGAAAGG - Intergenic
1182211711 22:28682494-28682516 ACCCTGTAGTATAAGTAGCTGGG + Intergenic
1182865768 22:33602946-33602968 ACCATGGGGGAAAAGCAACATGG - Intronic
1183509236 22:38225338-38225360 ACCAGGGACCATAAGCAGAAGGG + Intronic
952188572 3:30997639-30997661 AGCATGCAGCAAAAGCAGCAGGG - Intergenic
960619053 3:119621757-119621779 AGCATGGCTTGTAAGCAGCAGGG + Intronic
965187505 3:165483777-165483799 AACATGGAGAAGAAGCAGAAGGG - Intergenic
965873100 3:173284306-173284328 ATCATGGAGTAGAAGGAGCTCGG + Intergenic
969333244 4:6492141-6492163 CCCATGGAGTTTAAGCCCCAGGG - Intronic
969571161 4:8009286-8009308 CCCAGGGAGCATCAGCAGCAGGG + Intronic
970122763 4:12775301-12775323 ACAATGGAATCTAAGCTGCAAGG - Intergenic
973925222 4:55730029-55730051 ACCATGGAGGATGCGCAGTAAGG + Intergenic
979446135 4:120814151-120814173 ACCATGGAATCTAAGCAAAAGGG + Intronic
979472039 4:121110222-121110244 AGCATGGCATATAAGCAGAAGGG - Intergenic
981221249 4:142238648-142238670 ACCATGTATTATCAGAAGCAAGG + Intronic
981241259 4:142478891-142478913 ACCCTGGAGGATAACCAGCAAGG + Intronic
986197887 5:5554692-5554714 ACCATTGAGAAGTAGCAGCAGGG - Intergenic
986767068 5:10937911-10937933 TCCAAGGATTGTAAGCAGCATGG + Intergenic
987245401 5:16043203-16043225 ACCATGGTGCAAAAGCAGGAGGG - Intergenic
989425597 5:41291966-41291988 ACCATGCAATAAAAGGAGCAAGG - Intergenic
991349110 5:65702325-65702347 ATCATGGTGTATATTCAGCAGGG - Intronic
991567156 5:68017174-68017196 ACCATGGTGGAAAAGCAGAAGGG + Intergenic
992986285 5:82233939-82233961 AAAATGGTGTATAAGCTGCAGGG - Intronic
993223526 5:85135407-85135429 AGCATGGAGTAGAAGCAAGAAGG - Intergenic
995348885 5:111152372-111152394 ACCATGTAGAAAGAGCAGCAAGG - Intergenic
995366820 5:111371154-111371176 ATCATGGGGTATAGACAGCATGG - Intronic
997864767 5:137451212-137451234 AGCATGGAGTATAATAAGAATGG - Intronic
1001718316 5:173835624-173835646 CCCATGGAGAAGAAGCAGCAGGG + Intergenic
1001942254 5:175749077-175749099 ACCCCGGAGAAGAAGCAGCATGG + Intergenic
1004708139 6:18143447-18143469 ACTATATAGTATAAGAAGCAAGG - Intronic
1004899321 6:20179943-20179965 ACCATATAATAGAAGCAGCAAGG + Intronic
1005203891 6:23378936-23378958 GCCATAGAGTATAAGGAGGAAGG + Intergenic
1007597675 6:43061483-43061505 ACCATTGAGTGTCTGCAGCAGGG + Exonic
1008192028 6:48471292-48471314 CCCATGGACTGTAAGAAGCATGG - Intergenic
1009657690 6:66567820-66567842 ACCATGGAGGGGAAACAGCAGGG - Intergenic
1017072736 6:150590245-150590267 ACCATGGTGAATAAGCCGAAGGG + Intergenic
1017532580 6:155311109-155311131 ACCTTGGGGTTTAAGCATCATGG + Intronic
1021565599 7:22013659-22013681 AACATGGAGGAAATGCAGCAAGG - Intergenic
1021774564 7:24039903-24039925 ATAATGTAGTATAAACAGCATGG - Intergenic
1022427169 7:30279866-30279888 ATAATGGAGTAAAAGCATCATGG + Intergenic
1023623759 7:42096723-42096745 AGCATGGAGAGTAAGCAGCAAGG + Intronic
1027958343 7:84911375-84911397 TTCATGGAGTATAATAAGCAAGG + Intergenic
1032210395 7:129909191-129909213 ACTATGTAATATAAGGAGCAGGG + Intronic
1032921888 7:136558367-136558389 ACGATGGTTTATAACCAGCAAGG + Intergenic
1034429565 7:151034400-151034422 ACCATAGAGGATAAGCAGGTGGG - Exonic
1034917077 7:155049178-155049200 TCCATGGAGTAAAGGCAGCTCGG + Intergenic
1039870999 8:41545267-41545289 AGCATGGAGTAAATGCAGCAAGG - Intergenic
1040526137 8:48226711-48226733 ACCATGGAGGGAAAACAGCATGG + Intergenic
1040724828 8:50369958-50369980 ACCATGGAATATAGACACCATGG - Intronic
1045116022 8:98980971-98980993 ACCATGGAGAATTAGCACTACGG - Intergenic
1045620602 8:103973363-103973385 ATCATGGACTAAAAACAGCAGGG + Intronic
1047327348 8:123852439-123852461 AACATGGAGTTCAAGCAACAAGG - Intronic
1047366587 8:124217002-124217024 ACCATGGAACATAAACAGCCTGG + Intergenic
1047555713 8:125927945-125927967 ATCATAGGGTTTAAGCAGCAAGG - Intergenic
1048127191 8:131648946-131648968 ACCATGGAGTCTAAGCTGAAAGG - Intergenic
1049619741 8:143592668-143592690 AGCATGAAGGAAAAGCAGCAAGG + Intronic
1050493339 9:6213269-6213291 ACCATTGAGTACAACCAGAAAGG + Intergenic
1056273919 9:84974614-84974636 AACATGGAGACTGAGCAGCATGG + Intronic
1056708145 9:88969031-88969053 AGAATGGAGGAGAAGCAGCAGGG + Intergenic
1058462880 9:105198981-105199003 TCCATGGAGTTAAAGGAGCATGG + Intergenic
1059456277 9:114402247-114402269 ACCATGGGGGATAAGGAGCCAGG + Exonic
1060546920 9:124467411-124467433 ACCATGGAGTATCATCAGAATGG - Intronic
1185794247 X:2951205-2951227 ACCATGTGATATCAGCAGCATGG + Intronic
1189809769 X:44770860-44770882 ACCATGTAGTACCAGCTGCATGG - Intergenic
1192749802 X:73977966-73977988 ACCCTGGAGTGGAAGCAACAGGG - Intergenic
1193435320 X:81468276-81468298 ACCAAGGAGTAGAAGCAGGATGG - Intergenic
1194411269 X:93561675-93561697 AAGATTGAGTAAAAGCAGCATGG - Intergenic
1195740810 X:108062953-108062975 AGCATGGAGTATAAACAAGAAGG - Intronic
1199162198 X:144627222-144627244 TCCATGGAGAAAAATCAGCATGG + Intergenic
1200557192 Y:4649827-4649849 AACATGGTGTATAAGCACAATGG + Intergenic