ID: 928220083

View in Genome Browser
Species Human (GRCh38)
Location 2:29396191-29396213
Sequence CTCCATGGTGGCAAGTATCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 117
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 107}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
928220078_928220083 -5 Left 928220078 2:29396173-29396195 CCTCCCGTGCTGCTTATACTCCA 0: 1
1: 0
2: 0
3: 6
4: 68
Right 928220083 2:29396191-29396213 CTCCATGGTGGCAAGTATCCTGG 0: 1
1: 0
2: 1
3: 8
4: 107
928220076_928220083 23 Left 928220076 2:29396145-29396167 CCTCTTGGTACAAAAAAGGCTCA 0: 1
1: 0
2: 0
3: 10
4: 125
Right 928220083 2:29396191-29396213 CTCCATGGTGGCAAGTATCCTGG 0: 1
1: 0
2: 1
3: 8
4: 107
928220077_928220083 -4 Left 928220077 2:29396172-29396194 CCCTCCCGTGCTGCTTATACTCC 0: 1
1: 0
2: 1
3: 7
4: 81
Right 928220083 2:29396191-29396213 CTCCATGGTGGCAAGTATCCTGG 0: 1
1: 0
2: 1
3: 8
4: 107
928220075_928220083 24 Left 928220075 2:29396144-29396166 CCCTCTTGGTACAAAAAAGGCTC 0: 1
1: 0
2: 1
3: 10
4: 106
Right 928220083 2:29396191-29396213 CTCCATGGTGGCAAGTATCCTGG 0: 1
1: 0
2: 1
3: 8
4: 107
928220081_928220083 -9 Left 928220081 2:29396177-29396199 CCGTGCTGCTTATACTCCATGGT 0: 1
1: 0
2: 0
3: 17
4: 134
Right 928220083 2:29396191-29396213 CTCCATGGTGGCAAGTATCCTGG 0: 1
1: 0
2: 1
3: 8
4: 107
928220079_928220083 -8 Left 928220079 2:29396176-29396198 CCCGTGCTGCTTATACTCCATGG 0: 1
1: 0
2: 0
3: 8
4: 127
Right 928220083 2:29396191-29396213 CTCCATGGTGGCAAGTATCCTGG 0: 1
1: 0
2: 1
3: 8
4: 107

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
928220083 Original CRISPR CTCCATGGTGGCAAGTATCC TGG Intronic