ID: 928220083

View in Genome Browser
Species Human (GRCh38)
Location 2:29396191-29396213
Sequence CTCCATGGTGGCAAGTATCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 117
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 107}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
928220078_928220083 -5 Left 928220078 2:29396173-29396195 CCTCCCGTGCTGCTTATACTCCA 0: 1
1: 0
2: 0
3: 6
4: 68
Right 928220083 2:29396191-29396213 CTCCATGGTGGCAAGTATCCTGG 0: 1
1: 0
2: 1
3: 8
4: 107
928220079_928220083 -8 Left 928220079 2:29396176-29396198 CCCGTGCTGCTTATACTCCATGG 0: 1
1: 0
2: 0
3: 8
4: 127
Right 928220083 2:29396191-29396213 CTCCATGGTGGCAAGTATCCTGG 0: 1
1: 0
2: 1
3: 8
4: 107
928220076_928220083 23 Left 928220076 2:29396145-29396167 CCTCTTGGTACAAAAAAGGCTCA 0: 1
1: 0
2: 0
3: 10
4: 125
Right 928220083 2:29396191-29396213 CTCCATGGTGGCAAGTATCCTGG 0: 1
1: 0
2: 1
3: 8
4: 107
928220077_928220083 -4 Left 928220077 2:29396172-29396194 CCCTCCCGTGCTGCTTATACTCC 0: 1
1: 0
2: 1
3: 7
4: 81
Right 928220083 2:29396191-29396213 CTCCATGGTGGCAAGTATCCTGG 0: 1
1: 0
2: 1
3: 8
4: 107
928220081_928220083 -9 Left 928220081 2:29396177-29396199 CCGTGCTGCTTATACTCCATGGT 0: 1
1: 0
2: 0
3: 17
4: 134
Right 928220083 2:29396191-29396213 CTCCATGGTGGCAAGTATCCTGG 0: 1
1: 0
2: 1
3: 8
4: 107
928220075_928220083 24 Left 928220075 2:29396144-29396166 CCCTCTTGGTACAAAAAAGGCTC 0: 1
1: 0
2: 1
3: 10
4: 106
Right 928220083 2:29396191-29396213 CTCCATGGTGGCAAGTATCCTGG 0: 1
1: 0
2: 1
3: 8
4: 107

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
928220083 Original CRISPR CTCCATGGTGGCAAGTATCC TGG Intronic
900704052 1:4067883-4067905 CCTCATGGTGGCAAGGACCCAGG + Intergenic
900885981 1:5415710-5415732 CTCCATGGTGACCAGTTCCCTGG + Intergenic
901285926 1:8078874-8078896 TTCCATTGTGGGAAGGATCCTGG + Intergenic
906515666 1:46437486-46437508 CTACCTGGTGTCAAGCATCCTGG - Intergenic
908318390 1:62957242-62957264 GTCCATGGTGGGCAGTGTCCGGG - Intergenic
909110960 1:71476793-71476815 CTCCATGTTTGCAACTTTCCTGG + Intronic
910129643 1:83888186-83888208 CTCCATGGTAGAGAGTATCTGGG + Intronic
912502852 1:110133721-110133743 CTCCATGGTTGGAAGCTTCCTGG + Intergenic
912831449 1:112956874-112956896 CTCTATGGTGGCAAGTTGCATGG - Intronic
913196107 1:116457530-116457552 CTCCAGAGTGGCCAGTATCTAGG + Intergenic
913555628 1:119963742-119963764 GACCATGGTGGCAAGGATCGGGG + Exonic
914965390 1:152253045-152253067 GTCCATGGTGGCAAGGATGGAGG - Intergenic
921803427 1:219428132-219428154 CTCCATGATGGCAACAATGCTGG + Intergenic
922592827 1:226791369-226791391 CTCCATGGTGTCAGGGAACCAGG + Intergenic
1065011781 10:21427504-21427526 ATTTATGGTGGCGAGTATCCAGG + Intergenic
1067556786 10:47278341-47278363 CCCCAAGGTGGCGAGGATCCAGG + Intergenic
1068770693 10:60817597-60817619 CTCCTGGGTGGCCAGTAGCCTGG + Intergenic
1070589519 10:77791889-77791911 CTCCTTGGTGGCACCTCTCCTGG - Exonic
1071675373 10:87650922-87650944 CTCCATGGTGGGTAGTAACAAGG + Intergenic
1073415025 10:103373881-103373903 CTCTCTGGTGGGAAGGATCCTGG + Intronic
1082232987 11:49791911-49791933 CTCCCTGGTCTCAAGTACCCAGG - Intergenic
1087367534 11:97239849-97239871 CTCCAGTGAGGCAAGTATCTGGG - Intergenic
1089096353 11:115923090-115923112 CTCCCCGGTGGCAATTAGCCGGG + Intergenic
1089613472 11:119682271-119682293 CTGGATGGGGGCAAGAATCCTGG + Intronic
1090944503 11:131417905-131417927 GTCCATGGTGGAAAGTGTCCTGG + Intronic
1091834679 12:3577179-3577201 CTCCATGGTGGCACGGATGTGGG + Intronic
1091875711 12:3931415-3931437 CTTCATGGTGGGAAGTGCCCTGG - Intergenic
1092099205 12:5869373-5869395 CTCCATGGGGACAAGGATCCAGG + Intronic
1096096165 12:48937217-48937239 CTCCATGGGGCCAGGTTTCCTGG - Exonic
1097054879 12:56243316-56243338 CTTCATGGTGGAAAGGATCAAGG + Exonic
1100122557 12:91385555-91385577 CTCCATGGTACCAAATATACAGG - Intergenic
1101001501 12:100362242-100362264 CACCATGGTGGCAAGGGTCATGG + Intronic
1105627510 13:22127084-22127106 CTCGAAAGTGGCAGGTATCCAGG + Intergenic
1107870849 13:44745291-44745313 CTCCCTGGAGCCAAGTATGCAGG + Intergenic
1112414182 13:99190689-99190711 CTCCATGCTGGCAAAGATGCTGG + Intergenic
1114242893 14:20885271-20885293 CTCCATGAAGGAAAATATCCGGG + Intergenic
1114483959 14:23052270-23052292 CTGCCTGGTAGCAAGGATCCAGG + Intronic
1119147333 14:72329354-72329376 CTCCCTGGTGCCAAGTCTCTTGG + Intronic
1120056737 14:79933043-79933065 CTCCATGGTAGCAAGGACCCAGG - Intergenic
1122856470 14:104562618-104562640 CTCCATGTGGGCTAGGATCCGGG + Intronic
1124585717 15:31004610-31004632 CTCCCTGGTGGCAAACGTCCAGG - Intronic
1127714416 15:61635210-61635232 CTCCCTGAAGTCAAGTATCCAGG - Intergenic
1128725998 15:69989088-69989110 CTCCCCGGTGGCATGTCTCCCGG + Intergenic
1129262470 15:74376315-74376337 CACCATGGTGGCAGGCACCCAGG - Intergenic
1131132003 15:89906198-89906220 CTCCAGGGAGGCAAATAGCCTGG - Intronic
1133459729 16:5977084-5977106 CTGCATGGTGGCAAGTCTTCTGG + Intergenic
1135803458 16:25520551-25520573 CTCCATAGGGGCAAGGATCATGG + Intergenic
1136029840 16:27494941-27494963 CACCATGGTGACTGGTATCCTGG - Intronic
1140968967 16:79994577-79994599 CTCCATGGTGGGAAGGAAGCAGG - Intergenic
1142038771 16:87879139-87879161 CTCCATCTTGGAAAATATCCAGG + Intergenic
1143989251 17:10942768-10942790 CTCCATGGGTGCACGTGTCCTGG + Intergenic
1146301701 17:31694654-31694676 CCCCAAGGTGGCAAGGACCCAGG + Intergenic
1148015651 17:44520169-44520191 CTGAATGGTGCCAAGTGTCCGGG - Intergenic
1148321418 17:46757271-46757293 ATTCCTGGTGGCCAGTATCCTGG + Exonic
1148930040 17:51120651-51120673 CTCCATGGTGGCAAGCGGACGGG + Exonic
1151640498 17:75389025-75389047 CTGGATGGTGGCAAGTAATCGGG - Intronic
1152304269 17:79512020-79512042 CTCGATGGTAACATGTATCCAGG - Intronic
1152304319 17:79512220-79512242 CTCGATGGTAACATGTATCCGGG - Intronic
1152304371 17:79512420-79512442 CTCGATGGTAACATGTATCCAGG - Intronic
1153343020 18:3994568-3994590 CTATATAGTGGCAAGCATCCAGG - Intronic
1153818810 18:8814651-8814673 CTCCCTGGTGACAAGTTGCCTGG - Intronic
1158028560 18:52933775-52933797 CACCATGATGGGAAATATCCAGG - Intronic
1160482988 18:79260195-79260217 CGCCATGATTGCAAGTTTCCTGG - Intronic
1166569681 19:43785533-43785555 CTCTATGTTGGCAAGAAACCAGG - Intergenic
925873059 2:8287371-8287393 CTCCATGATGGCAGGTGTCCTGG + Intergenic
927136169 2:20097956-20097978 CTCCATAGTGGCAACCGTCCAGG - Intergenic
928220083 2:29396191-29396213 CTCCATGGTGGCAAGTATCCTGG + Intronic
929014690 2:37482401-37482423 CCCCATTGTGGCAGGTATGCTGG + Intergenic
930178789 2:48329639-48329661 CTACATGATGTCATGTATCCAGG - Intronic
932546187 2:72712772-72712794 ATACAAGGTGGCAAGAATCCTGG + Intronic
934603215 2:95674388-95674410 CTACATGGTGGGAGGTAGCCTGG + Intergenic
936536599 2:113316594-113316616 CTACATGGTGGGAGGTAGCCTGG + Intergenic
940009949 2:149041915-149041937 CTCTATGGTGGCAATTCTCAAGG + Intronic
946449347 2:219766405-219766427 CTCAATGGAGACAAGTATACGGG - Intergenic
1170665556 20:18383022-18383044 CTGCATGGTGGCCAGTGTCCAGG - Intergenic
1178955258 21:37016204-37016226 CTTCACGGTGGGAACTATCCTGG + Intronic
1180831497 22:18909251-18909273 TTCTCTGGTGGCAAGTCTCCAGG - Intronic
1183808272 22:40231946-40231968 CTCCTTGGTGGCAGCTAACCTGG + Intronic
1203281581 22_KI270734v1_random:134522-134544 TTCTCTGGTGGCAAGTCTCCAGG - Intergenic
950710468 3:14810178-14810200 CTCCATGAGGGCAAGAATCTGGG + Intergenic
953492283 3:43362339-43362361 CCCCATGGTGGCAAGTTGGCAGG + Intronic
965293822 3:166917574-166917596 CTCCCTGGTGACAAGTATTAGGG - Intergenic
966163665 3:176993101-176993123 ATTCACTGTGGCAAGTATCCAGG + Intergenic
966651229 3:182303338-182303360 CTCCAAGGTGGCAAGTAGCCAGG + Intergenic
971598825 4:28567513-28567535 CACCATGATAGTAAGTATCCTGG - Intergenic
982111481 4:152059869-152059891 CTCCATGGTGCCAAATATGTAGG - Intergenic
982760992 4:159283409-159283431 CTGCATGGTGTGAAGCATCCAGG + Intronic
985910314 5:2874386-2874408 CTCCATGCTGGAAAATGTCCAGG - Intergenic
986087294 5:4464141-4464163 GTCCATGGTGGCAAGGATGGAGG - Intergenic
989574333 5:42975495-42975517 CTATATGGGGGCAAGTATACAGG + Intergenic
991222803 5:64235863-64235885 CACCATGATTGCAAGTTTCCTGG + Intronic
991223087 5:64237912-64237934 CTCCATGATTGCAAGTTTCCTGG + Intronic
998239089 5:140426684-140426706 CTCCCTGGTCTCAAGTACCCAGG - Intronic
999600990 5:153265086-153265108 CTCCATGGGGGCAAGCTGCCTGG + Intergenic
1004181599 6:13385285-13385307 CTCCATGGGGGCAGGTACCTGGG - Intronic
1006357412 6:33568063-33568085 CTGCATGGTGCCAAGCAGCCTGG - Intergenic
1006611241 6:35295711-35295733 GTCCCTGGTGCCAAGTAGCCAGG - Exonic
1021031556 7:15743418-15743440 CTTCATGGGGGCAAGTATGGTGG + Intergenic
1022411453 7:30141636-30141658 CTTCATCCTGGCAAGTAGCCAGG + Intronic
1022422456 7:30236851-30236873 CTCCATGGTGTCAGGGACCCAGG + Intergenic
1029232762 7:99085045-99085067 CACCATGGTTGAAAGTTTCCTGG + Intronic
1030640597 7:112001805-112001827 ATCCAAGGTTGCAGGTATCCTGG + Intronic
1030677525 7:112399492-112399514 CTCCATGGTGGCAGAGATCGAGG + Intergenic
1032675254 7:134124257-134124279 ACCCAAGGTGGCAAGGATCCAGG + Intergenic
1037984594 8:23280819-23280841 CTCCAAGGTGGATAATATCCTGG - Intronic
1039894262 8:41705191-41705213 CTCCTTGGTCCCAAGTGTCCCGG + Intronic
1040277418 8:46021129-46021151 CCCCATCGTGGCAAGAATGCTGG - Intergenic
1040933452 8:52759480-52759502 CTACATGATGTCAAATATCCAGG - Intergenic
1041118946 8:54566972-54566994 CTCCCTGGTGGCAGGGAGCCCGG + Intergenic
1044852441 8:96442189-96442211 CAGCATGGTGGCAATTGTCCAGG + Intergenic
1047220933 8:122917468-122917490 CTCCATGGTAGAAAGTAACATGG - Intronic
1049316531 8:141971823-141971845 CTCCTGGCTGGCAAGAATCCTGG - Intergenic
1189204930 X:39229728-39229750 CTCCAGGGTGGCAAAGGTCCAGG - Intergenic
1195544485 X:106100074-106100096 CTACATGGAGGCAGGTATCCTGG - Intergenic
1197781245 X:130162662-130162684 CTCCTTGTGGGCAAGGATCCTGG - Intronic
1199144345 X:144348145-144348167 GACCATGGTGGCAAGGATGCAGG - Intergenic
1200223029 X:154401328-154401350 CTCCTTGGTGGGAATCATCCAGG + Exonic