ID: 928220084

View in Genome Browser
Species Human (GRCh38)
Location 2:29396193-29396215
Sequence ATCCAGGATACTTGCCACCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 105
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 94}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
928220084_928220086 -6 Left 928220084 2:29396193-29396215 CCATGGTGGCAAGTATCCTGGAT 0: 1
1: 0
2: 1
3: 9
4: 94
Right 928220086 2:29396210-29396232 CTGGATAATAACGCTGTTGCAGG 0: 1
1: 0
2: 0
3: 5
4: 49
928220084_928220088 14 Left 928220084 2:29396193-29396215 CCATGGTGGCAAGTATCCTGGAT 0: 1
1: 0
2: 1
3: 9
4: 94
Right 928220088 2:29396230-29396252 AGGCTTGATAGATGTTAAGAGGG 0: 1
1: 0
2: 1
3: 6
4: 140
928220084_928220089 15 Left 928220084 2:29396193-29396215 CCATGGTGGCAAGTATCCTGGAT 0: 1
1: 0
2: 1
3: 9
4: 94
Right 928220089 2:29396231-29396253 GGCTTGATAGATGTTAAGAGGGG 0: 1
1: 0
2: 0
3: 6
4: 101
928220084_928220087 13 Left 928220084 2:29396193-29396215 CCATGGTGGCAAGTATCCTGGAT 0: 1
1: 0
2: 1
3: 9
4: 94
Right 928220087 2:29396229-29396251 CAGGCTTGATAGATGTTAAGAGG 0: 1
1: 0
2: 1
3: 9
4: 97
928220084_928220090 27 Left 928220084 2:29396193-29396215 CCATGGTGGCAAGTATCCTGGAT 0: 1
1: 0
2: 1
3: 9
4: 94
Right 928220090 2:29396243-29396265 GTTAAGAGGGGTCTGAGCCTTGG 0: 1
1: 0
2: 2
3: 7
4: 146

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
928220084 Original CRISPR ATCCAGGATACTTGCCACCA TGG (reversed) Intronic
901285927 1:8078876-8078898 ATCCAGGATCCTTCCCACAATGG - Intergenic
905679233 1:39855458-39855480 ATCCAAAATACTTGGGACCAAGG + Intronic
915815534 1:158961805-158961827 TTCCAGGATACTTGGATCCAAGG - Intronic
919848959 1:201659657-201659679 ATCCAAGACACTTGGCACAATGG + Intronic
921900847 1:220449112-220449134 AGCCTGGGTCCTTGCCACCACGG + Intergenic
924302518 1:242653689-242653711 ATCCAGGATAGTGGTCACCTAGG + Intergenic
1069596989 10:69678561-69678583 ATCCAGCTTCTTTGCCACCAGGG - Intergenic
1070589518 10:77791887-77791909 TTCCAGGAGAGGTGCCACCAAGG + Exonic
1071877084 10:89853398-89853420 ATACAGGACACTTGCAATCATGG - Intergenic
1078375660 11:10791243-10791265 ATTCAGGAAACTTGCAATCACGG - Intergenic
1084421011 11:69060594-69060616 ATCCAGGTGACTAGCCTCCAAGG - Intronic
1084670171 11:70601901-70601923 AGCCAGGAGACCTGCCACCCAGG + Intronic
1086191107 11:84080092-84080114 AATCAGGATCTTTGCCACCATGG - Intronic
1090944505 11:131417907-131417929 GCCCAGGACACTTTCCACCATGG - Intronic
1093295227 12:17381627-17381649 TTATAGGATACTTGACACCAGGG + Intergenic
1094470859 12:30799737-30799759 AGCCAGGCTCCTTGCCATCAGGG - Intergenic
1100001447 12:89841462-89841484 ATCCAGGGTTTTTTCCACCAGGG - Intergenic
1101001503 12:100362244-100362266 ACCCATGACCCTTGCCACCATGG - Intronic
1109402276 13:61849607-61849629 ATCCTGCAAACTTGCCACAATGG - Intergenic
1113723225 13:112577309-112577331 ATGGAGGATACCTGCCACCAGGG - Intronic
1118566219 14:67143743-67143765 ATGCATGATATTTACCACCAGGG + Intronic
1124059951 15:26282183-26282205 ATCCAAAATACTTGAGACCAGGG - Intergenic
1128866435 15:71118188-71118210 ATCCAGGTTACTTTTCATCAGGG + Intronic
1129547264 15:76409743-76409765 ATCGAGGATAGTTGAAACCATGG - Intronic
1132091533 15:98951325-98951347 ATCAAGGAAACTTCCCAGCATGG + Intronic
1136029839 16:27494939-27494961 AGCCAGGATACCAGTCACCATGG + Intronic
1136784092 16:32924713-32924735 AGCCAGGAGACTCGTCACCACGG - Intergenic
1136885690 16:33929093-33929115 AGCCAGGAGACTCGTCACCACGG + Intergenic
1140149423 16:72347257-72347279 AACCAAGACACTTGCCAGCATGG + Intergenic
1141846086 16:86609986-86610008 ATCCAGGAAACTCGTCACCAAGG - Intergenic
1203086747 16_KI270728v1_random:1188715-1188737 AGCCAGGAGACTCGTCACCACGG - Intergenic
1142557899 17:791981-792003 AAGCAGGATGCTTGCCGCCATGG - Exonic
1145786314 17:27595957-27595979 ATCCACGCTACGTGCCACCATGG - Intronic
1146301703 17:31694656-31694678 ATCCTGGGTCCTTGCCACCTTGG - Intergenic
1146452641 17:32986954-32986976 CCTCAGGAAACTTGCCACCATGG - Intronic
1151627889 17:75288963-75288985 ATCCAGGACACCTGCCACTCGGG - Intronic
1152258564 17:79254407-79254429 ATCCAGGACACATGGCACCAGGG + Intronic
1153818809 18:8814649-8814671 CTCCAGGCAACTTGTCACCAGGG + Intronic
1158936505 18:62369459-62369481 ATGCAGGGGACTGGCCACCAGGG - Exonic
1164702939 19:30298598-30298620 ATCTAGGAGACTTGAGACCAAGG + Intronic
925873060 2:8287373-8287395 TTCCAGGACACCTGCCATCATGG - Intergenic
928220084 2:29396193-29396215 ATCCAGGATACTTGCCACCATGG - Intronic
929014692 2:37482403-37482425 AGCCAGCATACCTGCCACAATGG - Intergenic
930600798 2:53440560-53440582 ATCCAGGACTTTTGCCAACATGG - Intergenic
932627531 2:73309495-73309517 ATCCAGGAGACTTGCCAGCGGGG + Intergenic
933795177 2:85913828-85913850 CTCCAGCATTCTTGCTACCATGG - Intergenic
935806878 2:106757577-106757599 TCCCAGGATATTTGCCACCTAGG - Intergenic
936656903 2:114499106-114499128 ATCAGGGATAGCTGCCACCATGG - Intronic
939687558 2:145217549-145217571 CTCAAGGATACCTGCCTCCATGG - Intergenic
939749436 2:146023992-146024014 ACACAGTATCCTTGCCACCAGGG + Intergenic
940072103 2:149700336-149700358 ATTCAGAGTACATGCCACCAGGG + Intergenic
940703994 2:157081231-157081253 TTCCAGCTTACTTGCCACAATGG + Intergenic
943909956 2:193551165-193551187 AACCAGTAGACTTGCAACCAAGG + Intergenic
946425533 2:219593594-219593616 ACCCAGGATCCTTGCCTACAGGG - Intergenic
1171236001 20:23525606-23525628 TTCCAGTATACTTGGCACCAGGG + Intergenic
1172068395 20:32238015-32238037 ATCCAGGCTACATACCAACAGGG - Exonic
1172339911 20:34148889-34148911 ATCCTGGGTACTTGCAACCCAGG - Intergenic
1180912845 22:19464933-19464955 AACCAGCAGCCTTGCCACCAAGG + Intronic
1183808273 22:40231948-40231970 TTCCAGGTTAGCTGCCACCAAGG - Intronic
952538988 3:34346224-34346246 CATCAGGATACTTGCCAACAAGG + Intergenic
957222276 3:77399332-77399354 ATCCTGACTACTTGTCACCAAGG - Intronic
963433845 3:145242849-145242871 ATTCAGAAAACTTGCAACCATGG + Intergenic
965258671 3:166450674-166450696 ATACAGGATAATTTCCACCTTGG + Intergenic
965923185 3:173944526-173944548 ACCTAGGATGTTTGCCACCAAGG + Intronic
966651230 3:182303340-182303362 TTCCTGGCTACTTGCCACCTTGG - Intergenic
967525070 3:190482850-190482872 CCTCAGGAAACTTGCCACCATGG - Intergenic
977037810 4:91977088-91977110 ATCAATTATACTTGCCAACAAGG - Intergenic
979011817 4:115380566-115380588 AGCAAGGACATTTGCCACCAGGG + Intergenic
979608555 4:122666206-122666228 ATCCAGGAAACTTGCTTCTAAGG - Intergenic
982290334 4:153774555-153774577 ATCCTGGATACTTGCCATCCAGG - Intergenic
984080449 4:175242712-175242734 TTATAGGATACTTGCCACTAGGG + Intergenic
986087293 5:4464139-4464161 ATCCTCCATCCTTGCCACCATGG + Intergenic
988409072 5:30863274-30863296 ATGCATGATCCTTGCCATCAAGG + Intergenic
991222805 5:64235865-64235887 ACCCAGGAAACTTGCAATCATGG - Intronic
992660017 5:78950126-78950148 ATTCTGGATGCTTGTCACCATGG - Intronic
1002300122 5:178253154-178253176 CTGCAGGCTACCTGCCACCAGGG + Intronic
1004290662 6:14363999-14364021 ATGTAGGATTCTGGCCACCATGG + Intergenic
1012313986 6:97762356-97762378 ATACAGGATACTTGCCTCCAAGG - Intergenic
1013294984 6:108751105-108751127 ATCCAGAATAGTTTCCACTAAGG - Intergenic
1014973730 6:127851593-127851615 ATCCTGAATACATGCCATCAGGG + Intronic
1016428287 6:143957030-143957052 ATCCAGTATAGTACCCACCAGGG + Intronic
1018542867 6:164901919-164901941 ATACAGAGTATTTGCCACCAAGG - Intergenic
1019201190 6:170317477-170317499 ATCCAGGATACTTGCTTCGGTGG - Exonic
1026977404 7:74506969-74506991 AGCCAGGAGACTTGGCATCAGGG - Intronic
1029093994 7:98070723-98070745 TGCCAGGATTCCTGCCACCAAGG + Intergenic
1034890001 7:154831213-154831235 CTCCAGGCCACCTGCCACCAAGG + Intronic
1037052006 8:14385365-14385387 CTCTAGGATACATGCCACTAGGG + Intronic
1038429656 8:27490163-27490185 ATCCAAGATACCCTCCACCACGG - Intergenic
1039787404 8:40846256-40846278 ATCCATGATCCATTCCACCATGG + Intronic
1040277416 8:46021127-46021149 TTCCAGCATTCTTGCCACGATGG + Intergenic
1041931840 8:63295566-63295588 ATGCATGATGATTGCCACCAAGG - Intergenic
1046004727 8:108464907-108464929 ATCCAGGTTCCCTGCCCCCAAGG - Intronic
1049498233 8:142946762-142946784 AACAAGGATACCTGCCCCCATGG - Intergenic
1052172940 9:25424681-25424703 ATTCAGGAAACTTACCATCATGG - Intergenic
1052813330 9:33080686-33080708 AAACAGGCTACTTGGCACCAGGG - Intergenic
1054820756 9:69518089-69518111 ATCCAGGATACAACCAACCACGG + Intronic
1186112140 X:6269723-6269745 ATCCAGGATATTTACCACAAAGG - Intergenic
1187639451 X:21272825-21272847 TTCCACAAGACTTGCCACCATGG + Intergenic
1188519626 X:31023484-31023506 ATCCAGGATAGTGGTCACCTAGG - Intergenic
1195674511 X:107497600-107497622 ATCCAGGATATTTGCCCAGAAGG - Intergenic
1196771294 X:119296916-119296938 CTCCAGGATACTTTTCACAATGG - Intergenic
1197781244 X:130162660-130162682 AGCCAGGATCCTTGCCCACAAGG + Intronic
1198295782 X:135284959-135284981 ATCCAGGATGCTAGCAAACATGG + Intronic
1198866598 X:141129788-141129810 ATCCAGGCTTCTTGACCCCAAGG - Intergenic
1199144344 X:144348143-144348165 AACCTGCATCCTTGCCACCATGG + Intergenic