ID: 928220086

View in Genome Browser
Species Human (GRCh38)
Location 2:29396210-29396232
Sequence CTGGATAATAACGCTGTTGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 55
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 49}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
928220081_928220086 10 Left 928220081 2:29396177-29396199 CCGTGCTGCTTATACTCCATGGT 0: 1
1: 0
2: 0
3: 17
4: 134
Right 928220086 2:29396210-29396232 CTGGATAATAACGCTGTTGCAGG 0: 1
1: 0
2: 0
3: 5
4: 49
928220084_928220086 -6 Left 928220084 2:29396193-29396215 CCATGGTGGCAAGTATCCTGGAT 0: 1
1: 0
2: 1
3: 9
4: 94
Right 928220086 2:29396210-29396232 CTGGATAATAACGCTGTTGCAGG 0: 1
1: 0
2: 0
3: 5
4: 49
928220078_928220086 14 Left 928220078 2:29396173-29396195 CCTCCCGTGCTGCTTATACTCCA 0: 1
1: 0
2: 0
3: 6
4: 68
Right 928220086 2:29396210-29396232 CTGGATAATAACGCTGTTGCAGG 0: 1
1: 0
2: 0
3: 5
4: 49
928220077_928220086 15 Left 928220077 2:29396172-29396194 CCCTCCCGTGCTGCTTATACTCC 0: 1
1: 0
2: 1
3: 7
4: 81
Right 928220086 2:29396210-29396232 CTGGATAATAACGCTGTTGCAGG 0: 1
1: 0
2: 0
3: 5
4: 49
928220079_928220086 11 Left 928220079 2:29396176-29396198 CCCGTGCTGCTTATACTCCATGG 0: 1
1: 0
2: 0
3: 8
4: 127
Right 928220086 2:29396210-29396232 CTGGATAATAACGCTGTTGCAGG 0: 1
1: 0
2: 0
3: 5
4: 49

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
928220086 Original CRISPR CTGGATAATAACGCTGTTGC AGG Intronic
1076273469 10:129176421-129176443 CTGGGTTGTAACTCTGTTGCAGG + Intergenic
1087543849 11:99558585-99558607 CTGTATAATAGCTCTTTTGCAGG - Intronic
1089797959 11:120998554-120998576 CAGGAGAAGAATGCTGTTGCAGG + Intergenic
1090263452 11:125339227-125339249 GTGGGTAATAACCCTGCTGCTGG + Intronic
1096154285 12:49333162-49333184 GTGCAGAATGACGCTGTTGCTGG + Exonic
1097357107 12:58614226-58614248 CTGCATGATAATGCTGTTTCGGG - Intronic
1117273071 14:54164682-54164704 CTGGAGAATAACTCTGAGGCTGG - Intergenic
1123765844 15:23477806-23477828 CTGGGCAACAAAGCTGTTGCAGG - Intergenic
1125422646 15:39519914-39519936 CTGGGTAGGAACGCTGCTGCTGG - Intergenic
1126839094 15:52698368-52698390 CTGGATCATAAAGCAGATGCAGG - Intronic
1127270088 15:57392686-57392708 CTGGATAATAAAGCTGTATAAGG + Intronic
1132083201 15:98884879-98884901 CTGGATTAAAAGGCTGTTCCAGG + Intronic
1135235084 16:20747591-20747613 CTAAATAATAAAACTGTTGCAGG - Intronic
1137706525 16:50539442-50539464 CTGGATTCTAACTCTCTTGCAGG - Intergenic
1149557855 17:57587020-57587042 CTGGGTAAAAACGCAGTTCCTGG + Intronic
928220086 2:29396210-29396232 CTGGATAATAACGCTGTTGCAGG + Intronic
931737411 2:65209053-65209075 GTGGATAATAATGCAGATGCTGG + Intergenic
935176363 2:100652873-100652895 CTGGTTAAAACTGCTGTTGCAGG - Intergenic
935264171 2:101380641-101380663 ATGGTTAAAAATGCTGTTGCAGG + Intronic
937162227 2:119775328-119775350 CTGGACAATAACTCTTTTTCTGG + Intronic
942316280 2:174699363-174699385 CTGGATAATAACTCCTTTGAGGG - Intergenic
1169339476 20:4785437-4785459 CTGGAGAATAAAGCCGCTGCTGG - Intronic
1180014081 21:45071737-45071759 CTGGAAAATAAACCTGATGCTGG - Intergenic
1182730308 22:32484425-32484447 CTGCATAATACCAATGTTGCTGG + Intronic
955043904 3:55341934-55341956 CTGGAGAATGTCACTGTTGCTGG - Intergenic
955089696 3:55737322-55737344 CTGGATATTAATGCTGCTGCCGG - Intronic
957515690 3:81247959-81247981 CTTGATAATAACTATGTTACTGG + Intergenic
958751524 3:98197276-98197298 CTGGAAAATACCCCTGTTCCTGG + Intronic
967770826 3:193331758-193331780 CTGGATACTAACTCTGGAGCAGG + Intronic
967917647 3:194590675-194590697 CTGGCTAAAAACACTGATGCTGG + Intronic
976651364 4:87438503-87438525 CTGCACAATAACCCTGTTGGTGG + Intronic
980179450 4:129386300-129386322 CTGGATAAAGAAACTGTTGCTGG - Intergenic
981144296 4:141307219-141307241 CTGGAAAATAACACTGATGAGGG - Intergenic
981173868 4:141657896-141657918 CTTGATTATAACTATGTTGCTGG - Intronic
987070434 5:14332212-14332234 CTGGATAATAACTTTGTGACAGG - Intronic
988842816 5:35099458-35099480 CTTGATAATAACTATGTTACTGG + Intronic
990813944 5:59761839-59761861 CTTAATAATAACTATGTTGCTGG - Intronic
998192448 5:140038386-140038408 CTGGAGAATAAAGATCTTGCTGG - Intronic
1002108581 5:176892741-176892763 CTGGATAATAAGGCCGCTCCAGG + Intronic
1003123919 6:3340106-3340128 CTGGATAATACCGCTTTTGTGGG - Intronic
1003588831 6:7419479-7419501 CTGGGTCATAAGGCTGTGGCTGG + Intergenic
1007090753 6:39183390-39183412 CTGGGTAATAACACTGTTGTGGG + Intergenic
1011128104 6:84028709-84028731 CTGAATAACAAAGCTGTAGCTGG - Intergenic
1015983574 6:138863570-138863592 CAGGGTATGAACGCTGTTGCTGG + Intronic
1016268956 6:142266054-142266076 CTGGATAAGAACAGTGTTTCAGG - Intergenic
1020193763 7:6020978-6021000 CTGGACAAGAACGCTTTTTCTGG + Intronic
1023262865 7:38375640-38375662 CTGGAGAAGAAGGCTGCTGCGGG + Intergenic
1044181932 8:89206918-89206940 CTTGAAAAAAACACTGTTGCCGG + Intergenic
1045137158 8:99233498-99233520 CTTGATAAGAATGCTGATGCGGG + Intronic
1049127175 8:140802011-140802033 CTGGATAATGACTATGTTACTGG + Intronic
1051521639 9:17995803-17995825 CTGGATAAAAATGCTGGTGCTGG + Intergenic
1186006668 X:5079733-5079755 CTGGTTAATAACACTGTTGATGG - Intergenic
1192428105 X:71095264-71095286 CTGGAGAATATCGGTGTTGAAGG + Intergenic
1195387930 X:104330626-104330648 CTTGATAATAACTCTTTTCCAGG + Intergenic
1198397459 X:136234775-136234797 CTGGCTAATGACGCTTTTGTTGG + Intronic