ID: 928221773

View in Genome Browser
Species Human (GRCh38)
Location 2:29409312-29409334
Sequence CAGTAGAAGGAGAAAAAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1362
Summary {0: 1, 1: 0, 2: 7, 3: 127, 4: 1227}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
928221773_928221778 30 Left 928221773 2:29409312-29409334 CCTTCCTTTTTCTCCTTCTACTG 0: 1
1: 0
2: 7
3: 127
4: 1227
Right 928221778 2:29409365-29409387 TCTCAGTGCTGCTTTCTGTGGGG 0: 1
1: 0
2: 3
3: 44
4: 372
928221773_928221776 28 Left 928221773 2:29409312-29409334 CCTTCCTTTTTCTCCTTCTACTG 0: 1
1: 0
2: 7
3: 127
4: 1227
Right 928221776 2:29409363-29409385 AGTCTCAGTGCTGCTTTCTGTGG 0: 1
1: 0
2: 3
3: 34
4: 289
928221773_928221777 29 Left 928221773 2:29409312-29409334 CCTTCCTTTTTCTCCTTCTACTG 0: 1
1: 0
2: 7
3: 127
4: 1227
Right 928221777 2:29409364-29409386 GTCTCAGTGCTGCTTTCTGTGGG 0: 1
1: 0
2: 3
3: 24
4: 279

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
928221773 Original CRISPR CAGTAGAAGGAGAAAAAGGA AGG (reversed) Intronic
900770611 1:4540324-4540346 CAATAAAAAGAGAATAAGGATGG + Intergenic
900894591 1:5474380-5474402 CAGTAGAAGGCGAGAGAGGCAGG + Intergenic
900915467 1:5635279-5635301 CTGGAGAAGGAGGAAAAGGGGGG - Intergenic
900972429 1:5998949-5998971 CCGTGAAAGGAGGAAAAGGAAGG + Intronic
900977159 1:6025141-6025163 AGGTAGAAAGAGGAAAAGGAAGG - Intronic
901118327 1:6867502-6867524 CAGGAGAGGGAGAGAAAGGGAGG + Intronic
901264915 1:7903032-7903054 CAGGAGAAGGAGGGGAAGGAGGG - Intergenic
901264924 1:7903059-7903081 CAGGAGAAGGAGGGGAAGGAGGG - Intergenic
901264933 1:7903086-7903108 CAGGAGAAGGAGGGGAAGGAGGG - Intergenic
901264942 1:7903113-7903135 CAGGAGAAGGAGGGGAAGGAGGG - Intergenic
901264956 1:7903158-7903180 CAGGAGAAGGAGGGGAAGGAGGG - Intergenic
901264970 1:7903203-7903225 CAGGAGAAGGAGGGGAAGGAGGG - Intergenic
901264979 1:7903230-7903252 CAGGAGAAGGAGGGGAAGGAGGG - Intergenic
901264993 1:7903275-7903297 CAGGAGAAGGAGGGGAAGGAGGG - Intergenic
901265002 1:7903302-7903324 CAGGAGAAGGAGGGGAAGGAGGG - Intergenic
901269636 1:7941983-7942005 GAGTATAAGGAGAAAGAAGAGGG + Intronic
901441768 1:9282447-9282469 GAGGAGGAGGAGGAAAAGGAGGG - Intergenic
901447913 1:9319418-9319440 GAGGAGAAGGAGGAAGAGGAGGG - Intronic
902726702 1:18340959-18340981 AAGAAGAAGGAGAAGAAGGAGGG - Intronic
903355261 1:22742488-22742510 CGGAAGAAAGAGAGAAAGGAAGG - Intronic
903799458 1:25955710-25955732 AAAGAGAAAGAGAAAAAGGAAGG + Intergenic
904068896 1:27777528-27777550 CAGTACAAGGGGAAAGAGGCAGG - Intronic
904295762 1:29518859-29518881 AAGGAGAAGGAGAATGAGGAAGG - Intergenic
904308196 1:29604199-29604221 CAGAAGAAAGCAAAAAAGGAAGG - Intergenic
904371313 1:30049149-30049171 CAGTAAAAGGAGAAACAGCTGGG - Intergenic
904538095 1:31214714-31214736 CAGGATAAGGAGGAAAGGGAGGG + Intronic
905441497 1:37999194-37999216 CAGTGGAAGGGGGCAAAGGATGG - Intronic
905475204 1:38221478-38221500 CATTAGGAGGAGCACAAGGAAGG - Intergenic
905638212 1:39570155-39570177 CAGCAGAAAGAGAAAAAGGCAGG + Intronic
906002456 1:42438558-42438580 GAGTAGGAGGAGAAAAAGGCTGG - Intronic
906391567 1:45421638-45421660 CACTAATAGGAAAAAAAGGAGGG - Intronic
906719177 1:47993357-47993379 CAGAAGTAGGAGAGAAGGGAGGG - Intronic
907609398 1:55852870-55852892 CACTAGAGGAAGCAAAAGGAAGG - Intergenic
907705530 1:56829158-56829180 GAGGAGAAGGAGACACAGGAAGG - Intergenic
907771482 1:57469397-57469419 CAGAAAAAGGAGAAAAAAGTTGG + Intronic
907874965 1:58476870-58476892 CAGTACATGGAGGAAGAGGACGG + Intronic
907952309 1:59195634-59195656 AAAAAGAAAGAGAAAAAGGAAGG - Intergenic
908122717 1:61001162-61001184 TAGAATAAGGAGACAAAGGAGGG - Intronic
908488051 1:64614781-64614803 CAGTAGCAGGGGAAAAAGAAAGG - Intronic
908677303 1:66619650-66619672 CAGGACAAGGAGAGAAAGGAGGG + Intronic
908959904 1:69684372-69684394 GAAGAGAAGGAGTAAAAGGAAGG + Intronic
908999322 1:70199524-70199546 GAGGAGGAGGAGGAAAAGGAGGG - Intronic
909130196 1:71725741-71725763 CAGAAAGAGGAGGAAAAGGATGG - Intronic
909346121 1:74589654-74589676 CAGGTGAAGGACAAAAAGGCAGG - Exonic
909514617 1:76492983-76493005 GCCTAGAAGGAGAAAGAGGAAGG + Intronic
909525660 1:76619853-76619875 CAGAGGAGGGAGAAGAAGGAGGG - Intronic
909681092 1:78293188-78293210 GAGGAGAAGGAGGAAAAGGAAGG - Intergenic
910036175 1:82791650-82791672 GAGGAGAAGGAGTAAAAGGAAGG + Intergenic
910479350 1:87641462-87641484 GAGGAGAAGGAGGAAGAGGAGGG - Intergenic
910484787 1:87701244-87701266 GAGGAGAAGGAGGAAGAGGAGGG + Intergenic
910564504 1:88628119-88628141 AAAAAGAAGAAGAAAAAGGAAGG + Intergenic
910593552 1:88953885-88953907 AAGAAGAAGAAGAAGAAGGAGGG - Intronic
910799774 1:91133428-91133450 AAGTTCCAGGAGAAAAAGGAGGG - Intergenic
911411860 1:97519848-97519870 CAGCAGATGGAGAAGAAAGATGG - Intronic
911835048 1:102608010-102608032 CAGTATAAGAATAAAATGGAAGG + Intergenic
911991280 1:104699738-104699760 GAGGAGAAGGAGGAAGAGGAAGG - Intergenic
912069557 1:105792708-105792730 TAGGAGGAGGTGAAAAAGGAAGG - Intergenic
912909155 1:113739432-113739454 TAGTAGAAGCAAAAAAAAGATGG - Intronic
912933677 1:113985019-113985041 CTGGAGGAGGAGGAAAAGGAGGG - Intergenic
912996768 1:114538379-114538401 CAGTAGTGGGGGAAAATGGAAGG - Intergenic
913182724 1:116337712-116337734 CCCTAGAAGCAGAAAAGGGAAGG - Intergenic
913251130 1:116912554-116912576 CAGTAGCCGTAGAAACAGGAAGG - Intronic
913669561 1:121083328-121083350 CAGCAGCAAGAGGAAAAGGATGG - Intergenic
913690341 1:121273840-121273862 CAGTAGCAGGAGAGAAAGCCTGG + Intronic
913691185 1:121281407-121281429 AAGAAGAAGGAGGAAAAGGAAGG - Intronic
914021318 1:143870727-143870749 CAGCAGCAAGAGGAAAAGGATGG - Intergenic
914147202 1:145006119-145006141 CAGTAGCAGGAGAGAAAGCCTGG - Intronic
914659809 1:149778645-149778667 CAGCAGCAAGAGGAAAAGGATGG - Intergenic
914889990 1:151613157-151613179 GAGTAGAAATACAAAAAGGAGGG - Intronic
915074853 1:153299582-153299604 CAGGAGGAGGAGAACAAGGAGGG - Intronic
915254692 1:154617589-154617611 CACTCAAACGAGAAAAAGGAGGG + Intronic
915480455 1:156181021-156181043 GAGGAGGAGGAGAAAGAGGAGGG + Intergenic
916128017 1:161588612-161588634 CCGTGGAAGGAGGAAAAGGAAGG - Intronic
916137935 1:161670442-161670464 CCGTGGAAGGAGGAAAAGGAAGG - Intronic
916152633 1:161810320-161810342 CAGGAGAAAGAGAGAAAAGAGGG + Intronic
916435908 1:164777592-164777614 CAGTAGTAGCAAACAAAGGAGGG + Intronic
916448987 1:164901623-164901645 CAGTGGGAGGAGAGGAAGGATGG + Intergenic
916452258 1:164932147-164932169 CACTAGAAGCAAAAAAAGGCTGG - Intergenic
916616377 1:166445531-166445553 CACTAGAAGAAGAAGAAGGAAGG + Intergenic
917014433 1:170513304-170513326 AGGTAGGAAGAGAAAAAGGATGG + Intergenic
917015282 1:170523844-170523866 CAAAAGAAGAGGAAAAAGGAAGG + Intergenic
917410607 1:174756636-174756658 AAGTAGCAGGGGAAAAAGGAAGG + Intronic
917989793 1:180362422-180362444 CAAAAGAAGGTGAAACAGGATGG + Intronic
918200067 1:182258343-182258365 AAGAAGAAGGGGAAGAAGGAAGG - Intergenic
918324429 1:183395987-183396009 CAGTGAGAGGAGCAAAAGGAAGG - Intronic
918460308 1:184769730-184769752 AAGTGGAAAGAGAAAGAGGAAGG + Intergenic
918708686 1:187700855-187700877 CTGTAGAATGAGAACAAAGAAGG + Intergenic
919133151 1:193476002-193476024 CAGTAGAAAGGGTAAAAGAATGG - Intergenic
919321637 1:196048101-196048123 CAGTAGCAGGAGAAAGAAGAGGG + Intergenic
919595845 1:199561519-199561541 AAGAAGAAGGAGAAGGAGGAGGG - Intergenic
920063264 1:203244057-203244079 AGGTAGAAGGAGAAGAAGAAGGG + Intronic
920133889 1:203754064-203754086 AAGAAGAAAGAGAGAAAGGAAGG + Intergenic
920407849 1:205732132-205732154 CATTAGAAAGAGAAAAAACAAGG + Intronic
920457871 1:206114878-206114900 CAGAAGCAGGATAAAGAGGAGGG + Intronic
920477661 1:206292328-206292350 CAGTAGCAGGAGAGAAAGCCTGG + Intronic
920478509 1:206299883-206299905 AAGAAGAAGGAGGAAAAGGAAGG - Intronic
920528667 1:206685882-206685904 CCGCAGAGAGAGAAAAAGGAGGG - Intronic
920690973 1:208146059-208146081 CAGGTCAAGGAGAAAAAGGTGGG + Intronic
920971819 1:210749332-210749354 AAGTAAAAGGAGATAATGGATGG + Intronic
921384648 1:214556426-214556448 CAGAAGAACGTGAAAAAAGAAGG - Intergenic
921650394 1:217671586-217671608 CAGAAGGAGAAGAGAAAGGAAGG - Intronic
922224790 1:223636930-223636952 CAGAAGTGGGAGAAAAAGGGGGG - Intronic
922244832 1:223785982-223786004 CAGTGGAAGGAAAGGAAGGAGGG + Intronic
922287465 1:224182976-224182998 CCGGAGAAGATGAAAAAGGAAGG - Intronic
922402712 1:225276928-225276950 AATAAGAAGAAGAAAAAGGAAGG + Intronic
922596237 1:226815635-226815657 CAGAGGAAGGAGAAAGAGGTGGG - Intergenic
922825836 1:228517866-228517888 AAGGAGAAGGAGATAAGGGAAGG - Intergenic
922943389 1:229489135-229489157 AAGAAGAAAAAGAAAAAGGAAGG - Intronic
922967075 1:229699305-229699327 GAGCAGGAGGAGGAAAAGGAGGG + Intergenic
923037214 1:230292638-230292660 CAAGAGAAGGAGAGAGAGGAAGG - Intergenic
923052068 1:230396082-230396104 CAGTAGGAGGAGCAGAAAGAGGG - Intronic
923145941 1:231197871-231197893 GAGAAGAAGGAGAAGAAGAAAGG + Intronic
923355137 1:233147463-233147485 GAGGAGAAGGAGGAAGAGGAGGG + Intronic
923357632 1:233176339-233176361 AGGAAGAAGGAGAGAAAGGAAGG - Intronic
923566439 1:235079988-235080010 CAGAGGAAGGAGAAAATGGGAGG - Intergenic
923754407 1:236777558-236777580 GAGGAGGAGGAGAAAGAGGAGGG - Intergenic
923762744 1:236862024-236862046 CAGCAGAAGGAAAACAAGGCTGG - Intronic
924005148 1:239600763-239600785 AAGGAAAAGAAGAAAAAGGAAGG - Intronic
924043483 1:240006285-240006307 CAGAAGAAAGAGAAGAAGCATGG - Intergenic
924107239 1:240661281-240661303 CAGAAGGAGAAGAAAAAGAATGG - Intergenic
924163709 1:241260775-241260797 TAGCAGAATGAGACAAAGGATGG - Intronic
924171052 1:241341545-241341567 AAGGAGAAGAAGGAAAAGGAAGG + Intronic
924258561 1:242206744-242206766 CAGGAGGAGGAGGAAGAGGATGG + Intronic
924366861 1:243303506-243303528 GAGTTGGAGGAGGAAAAGGAGGG - Intronic
924448775 1:244159018-244159040 GAGGAGAAGGAGAAGAAGAAGGG - Intergenic
924680363 1:246224879-246224901 AAACAGAAGCAGAAAAAGGAAGG + Intronic
924867155 1:247996087-247996109 CAGCTGAAGGAGGAAGAGGAAGG - Intronic
1063197835 10:3759675-3759697 CAGGAAAGGAAGAAAAAGGAAGG + Intergenic
1063264856 10:4436316-4436338 CAGTAGGTGGAGAAAGAGGGAGG + Intergenic
1063375023 10:5549179-5549201 CAGAAGTAAGAGAGAAAGGAAGG + Intergenic
1063774989 10:9252736-9252758 CACTATAGGGAGAAAAAGCATGG + Intergenic
1064121573 10:12623523-12623545 AAGTTGAGGGGGAAAAAGGAAGG - Intronic
1064448909 10:15423822-15423844 GGGCAGAAGGAAAAAAAGGAAGG + Intergenic
1064515149 10:16139163-16139185 CATTAACAGGAGAAAAAGAAAGG - Intergenic
1064617896 10:17181560-17181582 CAGAAACAGGAGAACAAGGAGGG - Intronic
1064639062 10:17397161-17397183 GAGCTGAAGGAGAAAAAGGTTGG - Intronic
1064809563 10:19179977-19179999 CAGAAGAAGAAAAAAAAAGAAGG + Intronic
1064911749 10:20409608-20409630 AAGGAAAAGGAGAAAAATGAGGG - Intergenic
1064939408 10:20715865-20715887 GAGAAGAAAGAGAAGAAGGAAGG + Intergenic
1065066148 10:21966991-21967013 AAGAAGAAGAAGAAAAAGGTGGG - Intronic
1065184244 10:23156825-23156847 AAGGAGAAGGAAAGAAAGGAAGG + Intergenic
1065416890 10:25498044-25498066 GAGCAGAAAGAGAAAGAGGAAGG + Intronic
1065505533 10:26426707-26426729 CAGAAAAAGGATAAAAAGGTTGG + Intergenic
1065506363 10:26433853-26433875 GAGTAGGAGGAGGAAGAGGAGGG - Intergenic
1065722764 10:28642498-28642520 TAGTAGAAGAAGAAAGAGGTAGG - Intergenic
1065900850 10:30206664-30206686 AAGTAGAAGGTGAAAGAGAATGG + Intergenic
1065973684 10:30824502-30824524 CAGAAGAAGGAGGAGATGGAGGG - Intronic
1065988515 10:30982082-30982104 AAAAAGAAAGAGAAAAAGGATGG - Intronic
1066011574 10:31199145-31199167 GAGAAGGAGGAGAAAGAGGAAGG - Intergenic
1066169710 10:32828413-32828435 AAGGAGAAGAAGAAGAAGGAAGG + Intronic
1066276064 10:33870090-33870112 CAGGAGAGGGAGAAAAAGATAGG + Intergenic
1066519741 10:36202761-36202783 CAATAGATGCAGAAAAAGCATGG - Intergenic
1066547481 10:36516479-36516501 GAGGAGAAGGAGGAAGAGGAAGG + Intergenic
1067169045 10:43890827-43890849 GAGGAGAAGGAGAAATAGAAAGG - Intergenic
1067292927 10:44957591-44957613 AAGGAAAAGGACAAAAAGGAAGG - Intergenic
1067687496 10:48475975-48475997 GAGTAGAAGGAAAGAAAGGGTGG - Intronic
1067798796 10:49342213-49342235 CAGGAGAAGGAGCAATAGAAAGG + Intergenic
1068038606 10:51793349-51793371 TAGTCAAAGGAGAAAAATGATGG + Intronic
1068123946 10:52814770-52814792 AAGTAGAAGGAAAAAGAAGAAGG - Intergenic
1068318696 10:55381770-55381792 AAGTAAAAGAAGAAAAAGAAAGG + Intronic
1068376068 10:56182735-56182757 AAGAAGAAAAAGAAAAAGGAAGG + Intergenic
1068510055 10:57954402-57954424 GAGGAGGAGGAGAAGAAGGAGGG - Intergenic
1068692351 10:59930223-59930245 AAGAAGAAAGAGAAAAATGAAGG - Intergenic
1069040505 10:63691128-63691150 CAGTCGAAAGAAAGAAAGGAAGG - Intergenic
1069277892 10:66615454-66615476 AAGAAGAAGGAGACACAGGAAGG + Intronic
1069362701 10:67661269-67661291 AGGAAGAAAGAGAAAAAGGAGGG + Intronic
1069718521 10:70535600-70535622 GAGGAGAAGGAGGAAGAGGAAGG - Intronic
1070326430 10:75392499-75392521 TGGTAGAAAGGGAAAAAGGAAGG + Intergenic
1070433206 10:76361839-76361861 TGGTACAAGGAGAAAATGGATGG - Intronic
1070471672 10:76786538-76786560 CTGTGGAAGGTGAAAAAGAAGGG - Intergenic
1070543834 10:77437279-77437301 CAAGACAGGGAGAAAAAGGAAGG + Intronic
1070744565 10:78925481-78925503 AGGGAGAAGGAGAAAAAGGAGGG + Intergenic
1071030277 10:81171736-81171758 CTGGAAAAGGTGAAAAAGGAAGG + Intergenic
1071110774 10:82152766-82152788 AAGGAGAAGGAGAAGAAGGAAGG - Intronic
1071191424 10:83105882-83105904 AAGAAGAAGAAGGAAAAGGAAGG - Intergenic
1071403983 10:85310709-85310731 TACTAGAAGGAGAAGAAAGAAGG - Intergenic
1071928898 10:90443030-90443052 CAATAAAAAGAGAAAAAGAAGGG + Intergenic
1072323668 10:94275182-94275204 AATGAGAAGGAGGAAAAGGAAGG - Intronic
1072594254 10:96856430-96856452 GGGTAGAAGGAAAGAAAGGAAGG - Intronic
1073163981 10:101427497-101427519 GAGAAGAAAGAGAAGAAGGAAGG - Intronic
1073407337 10:103309425-103309447 CAGAAGAGAGAGAATAAGGAGGG - Intronic
1073662656 10:105493909-105493931 GAACAGAAGGAAAAAAAGGAGGG + Intergenic
1073696320 10:105873066-105873088 CAGGAGAGGGAGAGAAATGAGGG + Intergenic
1073724698 10:106216377-106216399 AACTAGAAGGAGCAAAAGGTGGG - Intergenic
1074204451 10:111270736-111270758 GAAGAGGAGGAGAAAAAGGAAGG - Intergenic
1074217054 10:111395234-111395256 GAGCAGAAGGAGAAGAGGGAGGG + Intergenic
1074388087 10:113033201-113033223 CAGCAGAAGGAGGAGGAGGAAGG - Intronic
1074484424 10:113860045-113860067 AAGTAAAAGGAGACAAAGGTAGG + Intronic
1074617369 10:115082852-115082874 CATTAAAAGGAGAAAAAATATGG - Intergenic
1074732174 10:116390825-116390847 AAGGAGAAGAAGAAGAAGGAAGG + Intergenic
1074874265 10:117602173-117602195 AAGTAGATGGAGAAAAGGGAAGG + Intergenic
1074875264 10:117608624-117608646 CACTGGAAGAAAAAAAAGGAAGG - Intergenic
1075908903 10:126106466-126106488 AAGAAGAAGAAGAAAAAGAAGGG - Intronic
1075963025 10:126585560-126585582 CAGGAGAAAGAGAGGAAGGAAGG + Intronic
1076034067 10:127184373-127184395 CAGTAGGAGAAGCAACAGGAAGG - Intronic
1076068069 10:127464588-127464610 CAGCAGAAGACAAAAAAGGAAGG + Intergenic
1076437917 10:130459306-130459328 CAGGAGAAGGTGAAGAGGGAGGG + Intergenic
1076437924 10:130459336-130459358 CAGGAGAAGGTGAAGAGGGAGGG + Intergenic
1076473296 10:130735201-130735223 CAGTAGCTGCAGAAAAAAGAGGG + Intergenic
1078441176 11:11369772-11369794 CAACACAATGAGAAAAAGGAAGG - Intronic
1078520272 11:12057423-12057445 CAGGAGAAAGAGAAAAGGGGAGG - Intergenic
1078586011 11:12589749-12589771 AAGAGGCAGGAGAAAAAGGATGG - Intergenic
1078591450 11:12643809-12643831 CACTAGAAGGAGAAGAAAAAAGG + Intergenic
1078610517 11:12815262-12815284 AAGAAGAAAGGGAAAAAGGAAGG - Intronic
1078777007 11:14403044-14403066 GAGAAGAAAGAGAAAAAGGAAGG - Intergenic
1079078238 11:17396735-17396757 CAATAGAAGGAGAGGAAAGATGG + Intronic
1079262006 11:18891499-18891521 CAGAAGAAGGAGGAAAGGTAAGG - Intergenic
1079300019 11:19269622-19269644 CAGTGGAAGGAGGAAAAGTGAGG - Intergenic
1079540924 11:21573750-21573772 AAGTAGAAAGAAAAGAAGGAAGG + Intronic
1079816206 11:25062108-25062130 AGGGAGAAGAAGAAAAAGGAGGG + Intronic
1079914883 11:26356784-26356806 CACTAGAAGTTGAAAAAGGCAGG - Intronic
1080083590 11:28251903-28251925 TAGCAGAGGAAGAAAAAGGAAGG - Intronic
1080360277 11:31505730-31505752 GAGCAGAAGGAGGAAGAGGAGGG - Intronic
1080394211 11:31875069-31875091 CAGTAGCAGGAGCAGCAGGAGGG - Intronic
1080435490 11:32237649-32237671 GAGTAGCAGGAAAAACAGGACGG + Intergenic
1080612843 11:33919812-33919834 CAGTAGAAAGAGGAAGGGGAGGG - Intergenic
1081157536 11:39714068-39714090 AAGTAAAGGGAAAAAAAGGAGGG - Intergenic
1081206439 11:40281003-40281025 CAGAGGGAGGAGAAAAGGGATGG + Intronic
1081288161 11:41298256-41298278 CAGAAGAAAGAGATAAAAGAAGG + Intronic
1081467149 11:43331565-43331587 TAGTAGGTGGAGAAAGAGGAGGG + Intronic
1081708432 11:45200586-45200608 CAGTAGTAGGAGCACATGGAGGG - Intronic
1081761499 11:45579599-45579621 GAGAAGGAGGAGAAGAAGGAAGG - Intergenic
1082176283 11:49063802-49063824 GAGAAGGAGGAGAAAGAGGAGGG + Intergenic
1082217733 11:49595192-49595214 CATGGGAAGGAGAACAAGGAGGG + Intergenic
1082651528 11:55799846-55799868 CAGGTTATGGAGAAAAAGGAAGG + Intergenic
1082762098 11:57136929-57136951 AAGGAGGAGGAGGAAAAGGAAGG + Intergenic
1082825366 11:57573899-57573921 CAGGAGGAGGCGGAAAAGGAAGG + Intergenic
1083278276 11:61609746-61609768 TGATAGAAGGAGAGAAAGGAAGG + Intergenic
1083978627 11:66145413-66145435 CAGTAGCAAGAGAACAAGGAAGG + Intronic
1084702584 11:70796944-70796966 CCGTAAAAGGACAGAAAGGAAGG + Intronic
1084888841 11:72226708-72226730 CAGTAGGGGGAGACTAAGGAGGG + Intronic
1085189319 11:74604526-74604548 CAGTTGAAAAAAAAAAAGGATGG - Intronic
1085713354 11:78850690-78850712 AGGTGGAAGGAGAAAGAGGATGG + Intronic
1086078880 11:82882122-82882144 CAGGAGGAGGAGAAAGAGGAGGG + Intronic
1086079574 11:82889397-82889419 AAGAAGAAGGAGAAGGAGGAGGG + Intronic
1086218853 11:84417412-84417434 TAGTACAAGGAGAAAAGGGAAGG - Intronic
1086689435 11:89772064-89772086 GAGAAGGAGGAGAAAGAGGAGGG - Intergenic
1086716422 11:90067890-90067912 GAGAAGGAGGAGAAAGAGGAGGG + Intergenic
1086737935 11:90329940-90329962 AAGAAGAAGGAGGAGAAGGAGGG - Intergenic
1086866567 11:91986868-91986890 GAGTAGAGGGAGATCAAGGAAGG - Intergenic
1086998927 11:93393024-93393046 AAGTAGAAGGAGGAGGAGGAGGG - Intronic
1087058144 11:93953264-93953286 GAGGAGGAGGAGAAAGAGGAGGG - Intergenic
1087340666 11:96901921-96901943 GAGTATAAGGAGAAAATGGTAGG + Intergenic
1087474527 11:98619715-98619737 CAGGAAAAGGTGAAAAAGGTTGG + Intergenic
1087591784 11:100198528-100198550 TAGTCAAAGAAGAAAAAGGAAGG + Intronic
1087813034 11:102629179-102629201 AAAAAGAAAGAGAAAAAGGAAGG + Intergenic
1088500924 11:110481462-110481484 AAGTAGAAAGAGAAAAAGAAAGG + Intergenic
1088709697 11:112496790-112496812 CAGGGGAAGGAGTAAAAGGGAGG - Intergenic
1088759205 11:112913228-112913250 CAGAGGCAGGAGAAAAAGGCTGG + Intergenic
1089044400 11:115486886-115486908 CATTAGAGGGATATAAAGGAGGG - Intronic
1089098044 11:115936103-115936125 CAGTAGACGGAGAATAAGAAGGG + Intergenic
1089605847 11:119640776-119640798 CAGCAGAAGGAGGAACTGGAAGG - Intronic
1089637989 11:119828651-119828673 CACTAGAGGGGGAAAAGGGAGGG + Intergenic
1089712569 11:120325997-120326019 CTTTAGAAGGAGATAAGGGAGGG + Intronic
1089905903 11:122038251-122038273 AAAAAGAAGGAAAAAAAGGAAGG + Intergenic
1089965884 11:122655060-122655082 AAGGAGGAGGAGAAGAAGGAAGG - Intergenic
1089980992 11:122772439-122772461 GAGTAGAAGGAAAAGAAAGAAGG + Intronic
1090143885 11:124297263-124297285 CGGTATAAGGAGAAAAACAATGG - Intergenic
1090276281 11:125422051-125422073 GGGTAGGAAGAGAAAAAGGAGGG + Intronic
1090717341 11:129442043-129442065 CAGTAGAATGGAAAACAGGAAGG + Intronic
1090721356 11:129476648-129476670 CAAAAGAAGGAGGGAAAGGAGGG - Intergenic
1090902332 11:131044050-131044072 AAGAAGAATGAGAAAAAGAAAGG - Intergenic
1091337143 11:134780705-134780727 GAGAAGAAGGAGAAAGAGGAGGG - Intergenic
1092078555 12:5693678-5693700 CAGTGGCTGGAGAAGAAGGAAGG - Intronic
1092085403 12:5754168-5754190 CAATAGATGGAGAAAAAAAATGG - Intronic
1092092246 12:5812589-5812611 AAGAGGAAGAAGAAAAAGGAAGG + Intronic
1092131141 12:6114157-6114179 CAGGAGAAGGAGAAACACCAAGG - Intronic
1092388890 12:8057776-8057798 AAGTGGAAGGAGAAAGAGGGTGG - Intergenic
1093163185 12:15773405-15773427 CAGAAGAAGGAGGAAATGAATGG + Intronic
1093246975 12:16750831-16750853 CATAAGAAGGAGAAAAAGCAAGG - Intergenic
1093372909 12:18386118-18386140 CAGTGGAAGGAGATAACCGAGGG - Intronic
1093417988 12:18942434-18942456 CAATAGGTGGAGAAGAAGGAAGG + Intergenic
1093629522 12:21391940-21391962 CAATTGTGGGAGAAAAAGGAAGG - Intronic
1094008328 12:25779842-25779864 CAGGAGATGGAAATAAAGGAAGG + Intergenic
1094013291 12:25832167-25832189 CTACAGAAGGAAAAAAAGGAAGG - Intergenic
1094016346 12:25868625-25868647 CAATAGAAAGAGTAAAAAGATGG + Intergenic
1094078846 12:26510281-26510303 TATGAGAAGGAGTAAAAGGATGG - Intronic
1094207944 12:27860386-27860408 CACTTGAAGGGGAAACAGGATGG - Intergenic
1094442989 12:30500207-30500229 GAGTACAATGAGAGAAAGGAAGG - Intergenic
1094632612 12:32191203-32191225 CAGCAGAAGGAGACAAAGATTGG + Intronic
1095149149 12:38770639-38770661 CAGTTGAAGGTGGAAAAGGCTGG - Intronic
1095259672 12:40083597-40083619 GAGAAAAAGGAAAAAAAGGATGG + Intronic
1095337715 12:41048710-41048732 AAGAAGAAGGAAAAAAATGAAGG + Intronic
1095881978 12:47147499-47147521 CAGTAGAAATAGAATATGGATGG - Intronic
1096603349 12:52746419-52746441 CAGTGGCAGGGGACAAAGGAAGG - Intergenic
1097043343 12:56169662-56169684 AAGGAGAAGGAGCCAAAGGAAGG - Exonic
1097720633 12:63016596-63016618 CAGTTGAAGGAGAAAAGAAAAGG + Intergenic
1097729169 12:63108031-63108053 CGGAAGAAGGAGAAAGAGGAAGG - Intergenic
1097950632 12:65423571-65423593 CAATAGAAGTAGAAAAGGCATGG - Intronic
1098196615 12:68008720-68008742 AAGTAGAAGGGGAAACAGCATGG + Intergenic
1098217502 12:68235858-68235880 GAGAAGAAGGAGAAGGAGGAAGG + Intergenic
1098435315 12:70462515-70462537 CAGAAGAATGAAAAAAGGGAGGG - Intergenic
1098458402 12:70703031-70703053 CAGTAGAAAAAAAAAAAGGAAGG - Intronic
1098568227 12:71959078-71959100 CAGTATAAGCAGGAAGAGGAGGG - Intronic
1098623213 12:72630951-72630973 CATTAGAAAGAAAAAAATGAAGG - Intronic
1098630174 12:72713341-72713363 AAGAAGGAGGAGAAGAAGGAAGG + Intergenic
1098695550 12:73549690-73549712 AAGTATATCGAGAAAAAGGAAGG - Intergenic
1098701310 12:73631187-73631209 AAGAAGAAGGAGAAGGAGGAGGG + Intergenic
1099019252 12:77382616-77382638 CAGTACAAGAGGGAAAAGGAGGG - Intergenic
1099064911 12:77963917-77963939 CAGAAGGAGGAGAAGAAGGAAGG - Intronic
1099779918 12:87181767-87181789 GAGGAGGAGGAGAAAAAGAAGGG - Intergenic
1099811500 12:87588067-87588089 GAAGAGGAGGAGAAAAAGGAAGG + Intergenic
1099950044 12:89291825-89291847 CTGAAGAAGGAGAAAGAAGAGGG + Intergenic
1100093054 12:90995452-90995474 CAGAAGAAGCAGAAAAAGAATGG + Intronic
1100213567 12:92423999-92424021 CAGAGGAAGGAAATAAAGGAGGG + Exonic
1100449210 12:94689292-94689314 CTGTAGAACGAGAAAAGCGAAGG + Intergenic
1100760230 12:97798963-97798985 AATTAGGAGGAGAAACAGGAAGG + Intergenic
1102052163 12:109870626-109870648 AAGCAGAAGGAGAGGAAGGAAGG + Intronic
1102487307 12:113266940-113266962 ATGAAGAAGGAGAAACAGGAAGG - Intronic
1102942027 12:116951531-116951553 CAAAAGAAAGAGAAAAGGGAAGG - Intronic
1103235374 12:119368171-119368193 GGGGAGGAGGAGAAAAAGGAGGG + Intronic
1103655859 12:122469891-122469913 CAGTACCAGGAGAAAATAGAGGG - Intergenic
1103696209 12:122817752-122817774 CACTAGCAGGACAAAAATGAGGG - Intronic
1103793819 12:123490037-123490059 CAGGAGAAGGAGAAAGGGGATGG - Intronic
1103882113 12:124174166-124174188 CAGTAAAATGAGAAAAAAAATGG + Intronic
1104152826 12:126100922-126100944 AAGAAGAAAGAAAAAAAGGAAGG + Intergenic
1104395433 12:128428342-128428364 CAGGAGAAGGAGAACAATGTGGG - Intronic
1104477894 12:129085216-129085238 CAGTAGAAGGGGAAGAAGAGGGG - Intronic
1105309010 13:19189871-19189893 AATGAGAAGGGGAAAAAGGAAGG - Intergenic
1105486259 13:20835840-20835862 CAGGAGGAGGAGGAAGAGGAGGG - Intronic
1105528594 13:21198276-21198298 AATGAGAAGGGGAAAAAGGAAGG + Intergenic
1105631577 13:22174863-22174885 GAGAAGGAGGAGGAAAAGGAGGG - Intergenic
1105711245 13:23011441-23011463 TAGAAGAAGCAGGAAAAGGAGGG + Intergenic
1105967724 13:25399723-25399745 GAGGAGAAGGAGGAAGAGGAAGG - Intronic
1106198158 13:27511653-27511675 AAGTAGAGGGAGATAAAGTAGGG - Intergenic
1106243061 13:27925387-27925409 GAGGAGGAGGAGAAAGAGGAGGG - Exonic
1106358477 13:29007614-29007636 GAGGAGGAGGAGAAAGAGGAGGG - Intronic
1106546188 13:30732851-30732873 CAGAAGAGAGAGAAAAAAGAGGG + Intronic
1106736607 13:32593786-32593808 GAGGAGAAGGAGGAAAAGGAAGG + Intronic
1106824698 13:33507906-33507928 GAGGAGGAGGAGGAAAAGGAGGG + Intergenic
1107131388 13:36900067-36900089 GAGTAGAAGGAAAAGAAGGCAGG - Intronic
1107155360 13:37160343-37160365 CAGTAAAAAGAGACAAAGAAGGG - Intergenic
1107370336 13:39738468-39738490 CAAAAGAAGGTGAAAAAGGAGGG + Intronic
1107436567 13:40385557-40385579 GAGGAGAAGGAGGAAAAAGAGGG + Intergenic
1107629863 13:42332447-42332469 GTATAGAAGGAGAAGAAGGAGGG + Intergenic
1109157717 13:58931358-58931380 CAGAACAAGCAGAAAAAGAATGG + Intergenic
1109181898 13:59223889-59223911 CAGGAGAAGGGGAGAAGGGAAGG + Intergenic
1109351473 13:61188006-61188028 CAGAAGAAGGAGGCAGAGGAAGG + Intergenic
1109469511 13:62787458-62787480 CAGGGGACGGTGAAAAAGGATGG - Intergenic
1110150629 13:72248718-72248740 CAGAATAAGAGGAAAAAGGATGG + Intergenic
1110398527 13:75062625-75062647 GAGAAGAAGGAGGAGAAGGAAGG + Intergenic
1110502643 13:76246725-76246747 AAGAAGAAGAAGAAAAAGAAGGG - Intergenic
1110945568 13:81411369-81411391 AAGGAGAAGGAGAAGAACGAGGG - Intergenic
1111714486 13:91862986-91863008 GAGAGGGAGGAGAAAAAGGAAGG - Intronic
1111986368 13:95070581-95070603 CAGTGAAAGGAAAACAAGGAGGG - Intronic
1112164729 13:96906148-96906170 GAGGAGAAGGAGGAAGAGGAAGG - Intergenic
1112182732 13:97100918-97100940 AACTACAGGGAGAAAAAGGAGGG - Intergenic
1112383761 13:98918793-98918815 AAGTAGAACAAGAAAGAGGAAGG + Intronic
1112542282 13:100326671-100326693 GAGGAGAAGGAGGAAGAGGAGGG - Intronic
1112884510 13:104152082-104152104 GAGGAGAAGGAGGAAGAGGAAGG + Intergenic
1113053056 13:106236262-106236284 AAGAAGAAGAAGAAAAAGAAAGG - Intergenic
1113163936 13:107416428-107416450 GAGGAGAAGGAGGAAGAGGAGGG - Intronic
1113303876 13:109054968-109054990 AGGAAGAAGGAGGAAAAGGAGGG - Intronic
1113751288 13:112778051-112778073 CTGTAGAAGAAGGAACAGGAAGG - Intronic
1113754879 13:112804104-112804126 GAGGTGAAGGAGGAAAAGGAGGG - Intronic
1114392226 14:22322368-22322390 AAGAAGAAGGAGAAAGAGAAAGG + Intergenic
1114775043 14:25472389-25472411 GAGGAGGAGGAGAAAAAAGAAGG - Intergenic
1115275589 14:31605751-31605773 AAGGAGAAGGAGAAGGAGGAAGG - Intronic
1115366093 14:32558800-32558822 CACAAGAAGGGGAAAATGGAGGG + Intronic
1115815567 14:37160957-37160979 GAGGAGGAGGAGAAAGAGGAAGG + Intronic
1115867666 14:37766155-37766177 CAGAAGGAAGAGAAAAAGAAAGG - Intronic
1115875095 14:37852503-37852525 CGGCATAAGGAGAAAAAGGACGG + Intronic
1116020535 14:39454918-39454940 CAGGAGAGAGAGAGAAAGGAAGG + Intergenic
1116023795 14:39491937-39491959 GAGGAGGAGGAGAAAGAGGAGGG - Intergenic
1116198643 14:41761269-41761291 CAGGAGAAAGAGAGGAAGGAAGG + Intronic
1116215669 14:42014099-42014121 AAGGAGAAAGAGAAAAAGGATGG - Intergenic
1116255843 14:42554258-42554280 GAGGAGAAGAAGAAAGAGGAAGG + Intergenic
1116663139 14:47738199-47738221 CAGTAGAAGGATAGAATTGAAGG - Intergenic
1116739498 14:48736144-48736166 CAGGAGAAGGAGAGCAAGGTGGG + Intergenic
1117242885 14:53853093-53853115 AAGGAGAAGGAGAAAGAGGAGGG - Intergenic
1117582987 14:57171698-57171720 AAGGGGAAGGAGAAAAAGTAAGG + Intergenic
1118186373 14:63542546-63542568 CAGAAGGTGGAGAAAAAGGGGGG + Intronic
1118459552 14:65976033-65976055 GAGGAGGAGGAGAAGAAGGAGGG + Intronic
1118478384 14:66140504-66140526 CTATAGAAGGAGAAAAAAGCAGG + Intergenic
1118618878 14:67596570-67596592 GACTAGAAGTAGATAAAGGAGGG - Intronic
1119089335 14:71765888-71765910 CAATAAAAGGAAGAAAAGGAAGG - Intergenic
1119093016 14:71801849-71801871 GAGGAGGAGGAGTAAAAGGAAGG + Intergenic
1119235746 14:73017787-73017809 CTGTAGAGGGACAAGAAGGAAGG - Intronic
1119531886 14:75367557-75367579 ATGAAGAAGGAAAAAAAGGAAGG + Intergenic
1119745083 14:77038303-77038325 TAGGAGAAGGAGGAAGAGGAGGG - Intergenic
1119770198 14:77215823-77215845 CAGTAGAAGAAGTAGGAGGAGGG - Intronic
1119977845 14:79045231-79045253 CAGTAGGAGATGAAGAAGGAGGG - Intronic
1120254530 14:82102420-82102442 AAGTAGAAAGATAAAAAGCATGG + Intergenic
1120315703 14:82889935-82889957 CAAAAGAAGGAAAGAAAGGAAGG - Intergenic
1120367751 14:83592047-83592069 GAATAGAAGGAGAGGAAGGAAGG - Intergenic
1120395958 14:83967002-83967024 AAGAAGAAAGAGAAGAAGGAAGG - Intergenic
1120625936 14:86826556-86826578 CAGAAGAAAGAGAAAGAGGAGGG + Intergenic
1120848894 14:89150782-89150804 CAGGAGAAGAAGACAAAGGCTGG + Intronic
1120880740 14:89413764-89413786 AAGAAGAAGGAAAAAAAGAAGGG + Intronic
1121488159 14:94336347-94336369 GAGGAGGAGGAGAAAGAGGAGGG + Intergenic
1121592886 14:95132533-95132555 CAGCAGAAATGGAAAAAGGACGG - Exonic
1121842682 14:97147591-97147613 CTCTAGAAGCTGAAAAAGGAAGG - Intergenic
1122038161 14:98963298-98963320 AAGGAGAAGGAGAAAGAAGAAGG + Intergenic
1122054805 14:99087902-99087924 CAGTAGAGGGAGAATAAAAATGG + Intergenic
1122317440 14:100834554-100834576 CAACAGAAGCAGAAAAAGCAGGG - Intergenic
1122546517 14:102525748-102525770 AAAGAGAAAGAGAAAAAGGAGGG - Intergenic
1123109754 14:105860549-105860571 AAGTAGAGGGAGACAAAAGATGG - Intergenic
1123131264 14:105987452-105987474 TAGGAGATGGAGAAAAGGGATGG - Intergenic
1124573718 15:30889364-30889386 GAGTACAAGGAGAAAATGAATGG - Intergenic
1124817546 15:33010624-33010646 GATTATAAAGAGAAAAAGGAAGG + Intronic
1125264491 15:37863437-37863459 ACGTAGAAGGAACAAAAGGAAGG - Intergenic
1125330736 15:38579826-38579848 CAGTAGGATGAGAAATGGGATGG + Intergenic
1125409901 15:39395254-39395276 CAATGGAAGGAGAAAGAGGAAGG + Intergenic
1125682643 15:41541876-41541898 AAGTAGATGAAGAAAAAGTAAGG - Intronic
1125786042 15:42319011-42319033 GAGTAGAAAGAAAAAAAGGAAGG - Intronic
1125998455 15:44186737-44186759 CTGGAAAAGGAGAAAAAGAAGGG - Intronic
1126118637 15:45231519-45231541 AAGTAGAAAGAGATGAAGGAAGG + Intergenic
1126348599 15:47721151-47721173 AAATAGAAGGAAATAAAGGATGG + Intronic
1126496377 15:49295147-49295169 AAGAAGAAAGAGAAGAAGGAGGG + Intronic
1126870577 15:52982716-52982738 AGGAAGAAGGGGAAAAAGGAAGG - Intergenic
1126908735 15:53396485-53396507 CAGTAGCAGGAGATAAAAGGAGG - Intergenic
1127091039 15:55467677-55467699 CAGTAGAAAAGGAAATAGGAAGG + Intronic
1127149832 15:56061992-56062014 GAGAAGAAAGAGAAAAAGAATGG + Intergenic
1128109225 15:65066186-65066208 AAAGAGAAAGAGAAAAAGGAAGG + Intronic
1128160521 15:65420746-65420768 CTGTAGAAGGAGAATGATGATGG - Intronic
1128442494 15:67725231-67725253 CTGTACAAGGTAAAAAAGGATGG - Intronic
1128808165 15:70549400-70549422 CAAAAGAAGGCAAAAAAGGAGGG + Intergenic
1128880353 15:71236833-71236855 CAGTGGAAGGACAAAAGAGAAGG + Intronic
1128885052 15:71279131-71279153 CAGGAAAGGGAGAAAATGGAGGG + Intronic
1128982841 15:72199093-72199115 CAGTAGTGGGGGAAAATGGAAGG + Exonic
1129064949 15:72894382-72894404 AAGTAGAAGGAGAAAACTAAAGG - Intergenic
1129658829 15:77541920-77541942 AAGAAGGAGGAGAAAAAGAAGGG - Intergenic
1129716190 15:77852482-77852504 CAGAAGAGAGAGGAAAAGGAGGG + Intergenic
1130146146 15:81275145-81275167 GAGGAGGAGGAGGAAAAGGAAGG + Intronic
1130348297 15:83068112-83068134 CACTGAAGGGAGAAAAAGGAAGG - Intergenic
1130763988 15:86851697-86851719 CAGTAGCAGGAAAGAAAGGCAGG + Intronic
1130929401 15:88412022-88412044 CAGTAGAGTGAGAAAAACCAGGG - Intergenic
1131048146 15:89329116-89329138 GAGGAGGAGGAGAAAAGGGAAGG + Intronic
1131284840 15:91048191-91048213 AAGAAGAAGAAGAAGAAGGAGGG - Intergenic
1131340005 15:91590204-91590226 AAGAAGAAAGAGGAAAAGGAAGG + Intergenic
1131727180 15:95239414-95239436 CAGGAGGGGGAGAAGAAGGAAGG + Intergenic
1132510730 16:340022-340044 AAGAAGAAGAAGAAAAAGAAAGG - Intronic
1133520221 16:6549363-6549385 GAGGAGGAGGGGAAAAAGGAGGG + Intronic
1133867068 16:9654255-9654277 AAGGAGAAGGAGAGGAAGGAAGG + Intergenic
1133970180 16:10561892-10561914 CAATAAAAGGAGAAAAAAAAGGG + Intronic
1134111030 16:11515751-11515773 GAGGAGGAGGAGAAAAAGGGAGG + Intronic
1134398663 16:13889078-13889100 CCGGAGAAGGAGAAAGGGGAGGG - Intergenic
1134513490 16:14867925-14867947 CAGTGGGAGGAGATAAAGAAGGG - Intronic
1134638648 16:15811601-15811623 CAGTAGAGGCAGAGAGAGGAAGG - Intronic
1134701127 16:16266420-16266442 CAGTGGGAGGAGATAAAGAAGGG - Intronic
1134970701 16:18528226-18528248 CAGTGGGAGGAGATAAAGAAGGG + Intronic
1135808526 16:25566422-25566444 CCGTAAAAGGAGAAAAAAGAAGG + Intergenic
1136053612 16:27671656-27671678 CAGTTGCAGGTGAAAGAGGAAGG - Intronic
1136144951 16:28311078-28311100 GTGTGGAAGGAGAAGAAGGAGGG + Intronic
1136539128 16:30918976-30918998 GAGGAGAAGGAGAAGAAGAAAGG - Intergenic
1136939666 16:34510991-34511013 GGGAAGAAGGAGGAAAAGGAGGG - Intergenic
1136960154 16:34837569-34837591 GGGAAGAAGGAGGAAAAGGAGGG + Intergenic
1137400085 16:48146277-48146299 CAGAAGAAGGACAGAAGGGAGGG - Intronic
1137557141 16:49477641-49477663 AAGAAGAAGGAGAAGAAGGAGGG + Intergenic
1137708023 16:50548648-50548670 CGGGAGAAGGAAAGAAAGGAAGG - Intronic
1137819019 16:51425827-51425849 CATTACAAGGAGAAATAGAAGGG - Intergenic
1137840625 16:51637474-51637496 CAAGAGAGGGAGAAGAAGGAGGG + Intergenic
1137880685 16:52044375-52044397 CTGTAAAAGGAGACAAAAGAAGG - Intronic
1137884396 16:52086926-52086948 CACTAGAAGCAGAAGGAGGAGGG + Intergenic
1137895097 16:52203676-52203698 CATAAGAAGGAGAAAAAAAATGG + Intergenic
1137960358 16:52876423-52876445 CACCAGAAGCAGAAAAATGAGGG + Intergenic
1138041946 16:53680840-53680862 AGGGAGAAGGAGAAATAGGAGGG + Intronic
1138053687 16:53810493-53810515 CAGGATAAGGAGCAAAAGGAAGG - Intronic
1138460117 16:57143098-57143120 CTGTAGATGGAGAGAACGGAGGG - Intronic
1138828114 16:60345780-60345802 GAGTGAGAGGAGAAAAAGGAGGG - Intergenic
1138877642 16:60972177-60972199 AAGAAGGAGGAGAAAAAAGAAGG - Intergenic
1138891740 16:61151037-61151059 CAGTAGAGGAAAAAAATGGATGG - Intergenic
1138991598 16:62397064-62397086 AAGAAGAAGGAAGAAAAGGAAGG + Intergenic
1139090681 16:63643249-63643271 AAGTAGAAGGAGAAAATACATGG - Intergenic
1139155591 16:64437917-64437939 GAGGGGAAGGAGAAAAAGGCCGG + Intergenic
1139602181 16:67993515-67993537 CAGTGGGAGGAGTAAAAGGGAGG - Exonic
1139769303 16:69260407-69260429 AGGTAGAAGGAGAAAAAGGGAGG - Intronic
1139813826 16:69649406-69649428 AAGTAGAAGCAGAAAAATGAAGG - Intronic
1140067464 16:71623988-71624010 GAGTAGAAGGAAAAAGAAGAGGG - Intergenic
1140153146 16:72392903-72392925 AAAGAGAATGAGAAAAAGGATGG + Intergenic
1140230363 16:73112758-73112780 CAGTAGACTGAGAAAGGGGAAGG + Intergenic
1140513107 16:75522408-75522430 AATAAAAAGGAGAAAAAGGAAGG - Intergenic
1140647348 16:77047166-77047188 CATCAGAAGAAGAAAATGGAAGG + Intergenic
1140675422 16:77324165-77324187 CAGAAGAGGAAGTAAAAGGAGGG + Intronic
1140797098 16:78448792-78448814 CCATAAAAGGATAAAAAGGAAGG - Intronic
1140939702 16:79709892-79709914 CAGCCAATGGAGAAAAAGGAAGG - Intergenic
1141007136 16:80363136-80363158 GAGGAGGAGGAGAAAGAGGAGGG + Intergenic
1141263073 16:82471333-82471355 AAGGAGAAGGAGAAACAGAAGGG - Intergenic
1141514594 16:84535193-84535215 AAGGAGAAGGAGGAAGAGGAGGG - Intronic
1142305657 16:89283501-89283523 CGAGAGAAGGAGAAGAAGGATGG - Exonic
1142917754 17:3155917-3155939 CCACAGAATGAGAAAAAGGAAGG + Intergenic
1143391349 17:6561031-6561053 GAGGAGAAGGAGGAAGAGGAAGG - Intergenic
1143391364 17:6561092-6561114 AAGGAGAAGGAGGAAGAGGAAGG - Intergenic
1143391375 17:6561128-6561150 GAGGAGAAGGAGGAAGAGGAGGG - Intergenic
1143391467 17:6561436-6561458 GAGGAGAAGGAGGAAGAGGAAGG - Intergenic
1143724339 17:8835181-8835203 CAGGAGAAGGAGGAAGAGCAGGG + Intronic
1144291953 17:13834981-13835003 CAGGAGAAGGATGACAAGGAGGG - Intergenic
1144350851 17:14394707-14394729 CAGAAAAAGGAAAGAAAGGAAGG + Intergenic
1144620700 17:16816679-16816701 CAGGAGAAGGAAAAAGGGGAGGG + Intergenic
1144884942 17:18451468-18451490 CAGGAGAAGGAAAAAGGGGAGGG - Intergenic
1145147279 17:20492909-20492931 CAGGAGAAGGAAAAAGGGGAGGG + Intergenic
1145262360 17:21361970-21361992 TGGTAGAAGAAGAAAGAGGAGGG - Intergenic
1145732433 17:27200955-27200977 CAATAAAAGGGGAAAAAGCAAGG - Intergenic
1145754072 17:27377494-27377516 CATCACAAGAAGAAAAAGGATGG + Intergenic
1145984364 17:29035199-29035221 GAGAAGAAGGAGAAGAAAGAAGG - Intronic
1146495111 17:33314858-33314880 AAGAAGAAGAAGAAAAAGAAAGG - Intronic
1146554770 17:33813923-33813945 CAGTGGAGGGAGAATGAGGAAGG + Intronic
1146805624 17:35863065-35863087 CAGCTGAAGGAGAAAAATGAGGG - Exonic
1147129737 17:38400044-38400066 TAGGAGCAGGAGAGAAAGGAGGG + Exonic
1147383926 17:40070986-40071008 CAGTAGAGGGAGAGGAAGAAAGG - Intronic
1147572089 17:41577577-41577599 CAGGAGAAGGACAAAGGGGAGGG + Intergenic
1147600297 17:41740979-41741001 CAGAGGATGGAGATAAAGGAAGG + Intergenic
1147754180 17:42757355-42757377 AAGGGGAAGGGGAAAAAGGAAGG - Intergenic
1148546119 17:48520338-48520360 AAGGAAAAGGAGAAAAAAGAGGG - Intergenic
1148828869 17:50416103-50416125 AACTAGAAGGAGAAAAAATAAGG - Intergenic
1148882977 17:50745787-50745809 GAGAAGAAAGAGAAAAAGAACGG + Exonic
1149114164 17:53071726-53071748 AAGGAGAAGAAGAAAAAGGAGGG + Intergenic
1149216026 17:54356054-54356076 CAAGAAAAAGAGAAAAAGGAGGG - Intergenic
1150129084 17:62657126-62657148 CAATACAAGGAGAACAAGAAGGG + Intronic
1150297078 17:64017128-64017150 CAGTAAAAGGAAAGGAAGGAAGG + Intronic
1150425348 17:65073098-65073120 CAGAAGTGAGAGAAAAAGGAAGG + Intergenic
1150521793 17:65876003-65876025 CAGTAAAAGCAGAAAATGCAAGG - Intronic
1150827098 17:68486615-68486637 TAGGAGAAGGAGAAGGAGGAAGG - Intergenic
1150908226 17:69361436-69361458 CAGTAGCTGGAGTTAAAGGATGG - Intergenic
1151190605 17:72395076-72395098 CAGTAGAGGGAGAAACAGGAAGG + Intergenic
1151478890 17:74358627-74358649 CAGTAGGAGAGGAAAAAGAAAGG - Intronic
1151815876 17:76471167-76471189 AGGTAGGAGGAGAAAGAGGAAGG + Exonic
1152310995 17:79549661-79549683 CTGGGGAAGGAGACAAAGGAAGG + Intergenic
1152439200 17:80295167-80295189 CAGTAAAAGGAGGAAAATGGGGG - Intronic
1152495719 17:80669815-80669837 AAGTATCAGGAAAAAAAGGAAGG - Intronic
1153147940 18:2055140-2055162 CTGTAAAAGGACAAAAAGGAAGG - Intergenic
1153296538 18:3551775-3551797 CAAAAGAAAGAAAAAAAGGAAGG - Intronic
1153636069 18:7115007-7115029 AAGAAGAAGGAAAAAAAGAATGG + Intronic
1154299277 18:13178795-13178817 GAGGAGAAGGAGGAAGAGGAGGG - Intergenic
1155417476 18:25614488-25614510 AAGGAAAAGTAGAAAAAGGAGGG + Intergenic
1155495369 18:26437099-26437121 CAGTAGAAGAAAATTAAGGAGGG + Intergenic
1155712406 18:28899458-28899480 AAGAAGAAAGAGAAAAAGGAAGG - Intergenic
1155727009 18:29099281-29099303 CAGGAGGAAGAGAGAAAGGATGG - Intergenic
1155756249 18:29500349-29500371 GAGGAGAAGGAGGAAAAGGAGGG + Intergenic
1155759054 18:29541369-29541391 GAGGAGAGGGAGAAAGAGGAAGG - Intergenic
1155766174 18:29635750-29635772 GAGAAGATGGAGAAAAGGGAGGG + Intergenic
1155881732 18:31157658-31157680 CATGAGAAGCAGAAAAAGGGAGG + Intronic
1156036919 18:32774301-32774323 AAAAAGAAGCAGAAAAAGGAAGG + Exonic
1156078086 18:33304837-33304859 CCATAAAAGGATAAAAAGGAAGG + Intronic
1156086255 18:33407402-33407424 AAGTAGAAGGAAGAGAAGGAAGG + Intronic
1156281966 18:35648033-35648055 AAGAAGAAGAAGAAGAAGGAAGG + Intronic
1156315458 18:35965129-35965151 AAGGAGAAGGAGAAAAAAGAAGG - Intergenic
1156666810 18:39418544-39418566 AAGCAGAAGAAGAAAAAGAAGGG + Intergenic
1156685585 18:39641634-39641656 AAGTACAAGGAGTAACAGGACGG + Intergenic
1156691809 18:39716175-39716197 AAGTAAAAGTAGAAAAAAGAAGG + Intergenic
1156729239 18:40170372-40170394 CAGAAGAAGGAGAAGAAAAAAGG + Intergenic
1156861873 18:41846427-41846449 AAGGAGAAGGAGAAAAACAATGG - Intergenic
1156927038 18:42594919-42594941 CAGTAAAAAGAGACAAAGAAGGG - Intergenic
1157049632 18:44147168-44147190 AAGTAGATGAAGAAAAAGGAAGG + Intergenic
1157077553 18:44481791-44481813 GAGGAGGAGGAGGAAAAGGAGGG - Intergenic
1157405859 18:47422342-47422364 CAAGTGAAGGAGAAAAGGGAAGG - Intergenic
1157643392 18:49241713-49241735 CAGGGTAGGGAGAAAAAGGAGGG + Intronic
1158087506 18:53670042-53670064 GAGGAAAAGAAGAAAAAGGAGGG - Intergenic
1158087510 18:53670066-53670088 AAGAAAAAGGACAAAAAGGAGGG - Intergenic
1158096434 18:53777542-53777564 CAGTAAAAGGAGTACCAGGAGGG - Intergenic
1158205261 18:54985656-54985678 CAGTAGAAGGAGAGAGATAATGG - Intergenic
1158209537 18:55031879-55031901 CAGAAGGAGGAGGAGAAGGAAGG - Intergenic
1158296134 18:55998576-55998598 CAGGAGAAGGAATGAAAGGAAGG + Intergenic
1159228229 18:65569091-65569113 CAGTACAAGAAGGAAAAGGGTGG - Intergenic
1159351452 18:67280378-67280400 AAGTAGAAGGATAAGAAGAAGGG + Intergenic
1159379181 18:67634174-67634196 CAGCAAAAGAAGAAAAGGGAAGG + Intergenic
1159693467 18:71522111-71522133 CCCTAGAAGGAGAAAAGGCAAGG + Intergenic
1159933083 18:74334305-74334327 AAGCAGAAGGGGAAAGAGGAAGG + Intronic
1160174569 18:76582189-76582211 GAGGAGAAGGAGGAAGAGGAGGG - Intergenic
1160378034 18:78429101-78429123 CCGTAGAAGGAGCAAAACGTTGG + Intergenic
1161417438 19:4155341-4155363 AAGAAGAAAGAGAGAAAGGAAGG - Intronic
1161756594 19:6138511-6138533 AAGAGGAAGGAGGAAAAGGAAGG + Intronic
1161756658 19:6138743-6138765 TAGGAGAATGGGAAAAAGGAAGG + Intronic
1162815817 19:13193778-13193800 AAGAAGAAAGAGAAAAAGGAAGG - Intergenic
1163048448 19:14662742-14662764 CAGAAGCAGGAGCAAAAGGGAGG - Intronic
1163142860 19:15362252-15362274 CTGTAGAAGGAAAACAAGGAGGG + Intronic
1163375303 19:16926720-16926742 CAGCAGATGGAGAAAAAGCTGGG - Intronic
1163538116 19:17889873-17889895 AAGTAGAAGGAGACAAAGAGGGG + Intronic
1163730066 19:18943793-18943815 TAGTAGAGGGAGAAACATGAAGG + Intergenic
1164234971 19:23323839-23323861 GAATAGGAGGAGGAAAAGGATGG - Intronic
1164250190 19:23469049-23469071 GAGAAGAAGGAAAAAGAGGATGG - Intergenic
1164436055 19:28230485-28230507 CAGTAGAAAAAGAAAAAAAAAGG + Intergenic
1164906853 19:31974862-31974884 CAGTAGACAAAGAACAAGGAGGG + Intergenic
1167145072 19:47676498-47676520 CAGAAGAGGGAGAAGGAGGAAGG - Intronic
1167301396 19:48680051-48680073 AAGTAGAAGGTGGAGAAGGAAGG - Intergenic
1167660924 19:50795584-50795606 CTGTAGAAGCTGAAACAGGAGGG - Intergenic
1168220357 19:54956118-54956140 CAACAGAGGGAGAGAAAGGAAGG + Intronic
1168356953 19:55706615-55706637 CAGGAAAGAGAGAAAAAGGAGGG + Intronic
1168620774 19:57877760-57877782 CACTAGTTGAAGAAAAAGGAGGG - Intronic
1168704270 19:58459702-58459724 CAGGAGCAAGAGAGAAAGGAAGG - Intergenic
925485274 2:4321860-4321882 GAGAACAAGGAGAAAAAGGAAGG - Intergenic
925554693 2:5117048-5117070 AAGTAGAAAGAGGAAAAGCAGGG + Intergenic
925618597 2:5768314-5768336 CAATAGAATTAGAAAGAGGAGGG - Intergenic
925885214 2:8389636-8389658 AATTTGAAGGTGAAAAAGGACGG - Intergenic
925940436 2:8811949-8811971 TAAGAGAAGGGGAAAAAGGAAGG + Intronic
926510407 2:13770042-13770064 GAGGAGAAGGAGAAGGAGGAGGG - Intergenic
926558302 2:14386558-14386580 CAGAAGGAGGAGAAGCAGGAGGG + Intergenic
926783830 2:16500419-16500441 CAGTAGAAGGAGGAGAAACAGGG - Intergenic
926923162 2:17959449-17959471 AAGAAGAAGAAGAAAAAGAATGG - Intronic
926928026 2:18007886-18007908 CAATAGAAGGAGCCCAAGGAAGG - Intronic
926951505 2:18248481-18248503 CAGGAGCAAGAGAAAGAGGAAGG + Intronic
927107678 2:19841953-19841975 GAGAAGAAGAGGAAAAAGGAGGG + Intergenic
927276285 2:21265115-21265137 CAGTGGATGGAGATGAAGGAAGG - Intergenic
927339830 2:21970585-21970607 CAGAAGCAGCAGAAAAAGGATGG + Intergenic
927399211 2:22691270-22691292 CAGAAAAAGAAGAAAAAGGGAGG + Intergenic
927611308 2:24544038-24544060 CAGTAGGAGGATCATAAGGATGG + Intronic
927848717 2:26485682-26485704 CGGTAGAAGGTGGAAGAGGAGGG - Intronic
928108440 2:28488172-28488194 GAGGAGAAGGAGGAGAAGGAGGG + Intronic
928221773 2:29409312-29409334 CAGTAGAAGGAGAAAAAGGAAGG - Intronic
928239075 2:29570990-29571012 GAAAGGAAGGAGAAAAAGGAGGG + Intronic
928383267 2:30839531-30839553 CAGTAGTAAGAGAAAATGCATGG - Intergenic
928746725 2:34424749-34424771 AAAGAGAAGGAGAGAAAGGAGGG + Intergenic
928870647 2:35973812-35973834 AAGTAGAAGGAGAAAAAGAGAGG + Intergenic
929362119 2:41104280-41104302 CAGGAGAAGGAAAAGAAAGAAGG - Intergenic
929368140 2:41186876-41186898 CAGGAGAAAGAGAAAAGGAAAGG - Intergenic
929437181 2:41937955-41937977 CAGTAGAAATGGAAAATGGAAGG - Exonic
929564509 2:42976125-42976147 CAGGAAAAGAAAAAAAAGGAAGG + Intergenic
929651512 2:43684356-43684378 CAGTTAAAGGAGAGAAAGGAAGG - Intronic
929993708 2:46811869-46811891 AAGGAGAAGGAGACAAAAGAAGG - Intergenic
930146692 2:48014303-48014325 TAGTACATGGAGAAAAAGCAAGG + Intergenic
930325611 2:49913640-49913662 TAGTTGAGGGAGAAACAGGAAGG + Intergenic
930389673 2:50745417-50745439 CAATGGAAAGAGAAAAAGGGAGG - Intronic
930564016 2:52996869-52996891 TAGTAGAAGGAAGAGAAGGAAGG + Intergenic
930792174 2:55345307-55345329 CAGTATTAGGATAAGAAGGAGGG - Intronic
930833546 2:55771086-55771108 CAGCAGAAGGAGGAAGAGCATGG + Intergenic
930943182 2:57038438-57038460 CCGTAAAAGGAAACAAAGGAAGG - Intergenic
931171943 2:59812983-59813005 AAGTAGCAGGATAAAAAGAAAGG - Intergenic
931380230 2:61746059-61746081 AAGAAGAAGGAGAAGAAGAAAGG + Intergenic
931484149 2:62673044-62673066 CATGAGAAGGAAAAAAAGAAAGG + Intergenic
931528016 2:63179482-63179504 CTGGAGAAGGAGAAAGAGAAGGG - Intronic
931613667 2:64132092-64132114 TAGTGGAAAGAGAAAAAGGAGGG - Intronic
932505486 2:72226488-72226510 CAGTAGAAGGAAAGACATGAAGG + Intronic
932649209 2:73537397-73537419 CTGTACAAGAAGAAAAGGGAAGG + Intronic
932752031 2:74377371-74377393 GAGGGGAAGGAGAAAGAGGAGGG - Intronic
933018274 2:77159645-77159667 GAGGAGGAGGAGAAATAGGAGGG + Intronic
933031244 2:77331497-77331519 CAATAAAAGGAGAGAATGGATGG - Intronic
933130836 2:78672806-78672828 CATTAGAATAAGAATAAGGATGG + Intergenic
933204725 2:79493201-79493223 AAGTAGAAAGAAAAACAGGAGGG + Intronic
933284136 2:80366295-80366317 CAGTAGAAGTTGGAAAAGCAGGG + Intronic
933337356 2:80975513-80975535 AAGGAGAAGGAAAGAAAGGAAGG - Intergenic
933577855 2:84090279-84090301 GAGGAGGAGGAGAAAAAGAAAGG - Intergenic
934586167 2:95498051-95498073 GAGAAGGAGGAGAAAGAGGAGGG - Intergenic
935098533 2:99970304-99970326 AAGCAGAAGGGGAGAAAGGATGG - Intronic
935104087 2:100023525-100023547 CAGAAGAGGGAGAAACAGCAAGG + Intronic
935164465 2:100558096-100558118 CAGAAGAAAGAGAGAGAGGACGG + Intergenic
935445600 2:103153091-103153113 CAGCAGACAGAGCAAAAGGAGGG + Intergenic
935792879 2:106610154-106610176 TAGTGGAAGGGGAATAAGGAGGG - Intergenic
936346778 2:111681530-111681552 GAGCAGATGGAGAAATAGGAAGG - Intergenic
936832835 2:116669860-116669882 AAGGAGAAGGAGAAGAGGGAAGG - Intergenic
936837622 2:116727087-116727109 CAGTAAGAGAAGAAAAGGGAAGG + Intergenic
937345966 2:121125482-121125504 AAGGAGAAGGAGAAGAAGGAAGG + Intergenic
937528390 2:122798986-122799008 GAGGGGAAGGAGAAAGAGGAGGG - Intergenic
937552830 2:123115524-123115546 CAGTAAAAGGAAAAAATTGAAGG + Intergenic
937554997 2:123143165-123143187 CAGTGGCAAGAGAAAAATGACGG - Intergenic
937617856 2:123947201-123947223 AAGTATAAGGAGAGAAAAGAAGG + Intergenic
937828107 2:126389626-126389648 CAGGAGAAAGAGAGAAAGAAGGG - Intergenic
937992356 2:127671730-127671752 CAGAAGTAGAAGAAAAAGGAAGG + Intronic
938443816 2:131360792-131360814 CAGTAAAAGGTAAAAAGGGAAGG + Intergenic
938597307 2:132801100-132801122 CAGTGGAAGGATAAAGAGCATGG - Intronic
938628101 2:133133918-133133940 CAGTAGTAGGGGAAAAAAGTGGG - Intronic
938719818 2:134056669-134056691 CAGAGGAAGGAGAAAAAGACAGG + Intergenic
939484563 2:142794415-142794437 GAGTAGAAGGATAAACATGAAGG - Intergenic
939581178 2:143947851-143947873 CAGGAGGAGGTGAAGAAGGAAGG + Intronic
939656979 2:144838017-144838039 CAGTAGTAGAAAAAAAAAGAAGG + Intergenic
939751890 2:146058299-146058321 AATTAGAATGAGAAACAGGAGGG - Intergenic
939773940 2:146360976-146360998 GAGGAGAAGAGGAAAAAGGAGGG + Intergenic
939967367 2:148623682-148623704 CAAGAAAAGGAGAAGAAGGATGG - Intergenic
940137219 2:150451603-150451625 AAATAGAAGGAGAAGGAGGAGGG - Intergenic
940479710 2:154212715-154212737 CCTTAGAAGGAGAAGAAGGATGG - Intronic
940594189 2:155768493-155768515 CAGGAAAAGGGGTAAAAGGAAGG - Intergenic
940614225 2:156029858-156029880 GAGGGGAAGGAGAAAAAGTAAGG + Intergenic
940786423 2:157986458-157986480 TAATAGAAGAAGAAGAAGGATGG + Intronic
941465190 2:165817242-165817264 AAGAAGGAGGAGAAGAAGGAAGG + Intergenic
941503272 2:166308453-166308475 CAGGAGAGGGAGAAAGAGGAGGG - Intronic
941506909 2:166357581-166357603 CCATAAAAGGACAAAAAGGAAGG + Intronic
941512185 2:166425583-166425605 CACTAGAAGCTGAAAAAGGAAGG - Intronic
941558619 2:167016178-167016200 AGGAGGAAGGAGAAAAAGGAGGG - Intronic
941696199 2:168553847-168553869 GAGTAGAAGGGGAAGAAGGTGGG + Intronic
941959733 2:171241746-171241768 TAGTAGAAGAGAAAAAAGGAGGG - Intergenic
942124191 2:172806843-172806865 CTGTAGAAGGAAAAAAGAGAAGG - Intronic
942266633 2:174234046-174234068 AAGTGGAAGGAGAGGAAGGAGGG - Intronic
942282744 2:174383241-174383263 AGGTAGAAGGAGAAAAAGGCAGG + Intronic
942283620 2:174391635-174391657 GGGGAGAAGGAGAAAAACGATGG + Intronic
942635305 2:177997785-177997807 CAGAAGAAGCAGAAAATGGAGGG - Intronic
942745460 2:179226912-179226934 AGGAAGCAGGAGAAAAAGGAAGG + Intronic
943201001 2:184823645-184823667 CTTTAGAATGGGAAAAAGGAGGG + Intronic
943291314 2:186075562-186075584 AAGGAGAAGGAGGAAGAGGAGGG - Intergenic
943498344 2:188653059-188653081 CAAAACAAGGAGAAAAATGATGG + Intergenic
943596009 2:189857553-189857575 AAGAAGAAGGAAGAAAAGGATGG - Intronic
944404422 2:199366609-199366631 CAGTAGGAGGAGAAAAGGGAAGG - Intronic
944453501 2:199869425-199869447 AAGAAGAAAGAGAAAAAGGAAGG - Intergenic
944855386 2:203762245-203762267 GAGTAGAAGGAAAAGAATGAAGG - Intergenic
945188793 2:207166077-207166099 CAGGAGGAGGAGAAAAGGGAGGG - Intronic
945698568 2:213141206-213141228 CAGTAGTGGGATAAAAAGGAAGG - Intronic
945754693 2:213831678-213831700 CAGTTCAAGGAGATAAGGGAAGG - Intronic
945933105 2:215876029-215876051 CAATAGAAGAAGCAAATGGAAGG - Intergenic
946168356 2:217878920-217878942 GATTAGAAGGGAAAAAAGGAAGG - Intronic
946380875 2:219348015-219348037 CAGTAGGAGGTGATAAAGTATGG - Intergenic
946648316 2:221864391-221864413 GATAAGAAGGAAAAAAAGGATGG - Intergenic
946705399 2:222453535-222453557 GAGGAGAAGGAGGAAAAGGAGGG - Intronic
946964944 2:225027608-225027630 CAGGAGAAGGAGAGAGAGGGAGG - Intronic
947232400 2:227901729-227901751 CAGAAGATGGACAAAAATGATGG + Intronic
947252188 2:228120150-228120172 CAGTAAAAGGAGAGAATGAATGG - Intronic
947295663 2:228627759-228627781 AAGGAGAAGAAGAAGAAGGAGGG - Intergenic
947298166 2:228656277-228656299 CAATTCAAGGAGAGAAAGGAAGG + Intergenic
947511033 2:230754457-230754479 GAGTAGGAGGGGAAGAAGGAGGG - Intronic
947894583 2:233657444-233657466 AAGAAGCAAGAGAAAAAGGAGGG + Intronic
948120569 2:235527108-235527130 CAGTAGAAATAGATAAAGGATGG + Intronic
948127211 2:235572968-235572990 AAGAAGAAGAAGAAAAAAGATGG - Intronic
948197844 2:236108353-236108375 CAGAGGAAGGAGAGAAAAGAGGG - Intronic
948488314 2:238295350-238295372 GAGAAGAAGTAGAAGAAGGAGGG - Intergenic
948732569 2:239976402-239976424 CAGTTGAGGGAGAAGGAGGATGG - Intronic
1169979075 20:11363416-11363438 AAGGAGAAGGAGAGAATGGAAGG - Intergenic
1170173749 20:13444048-13444070 CAGATGAAGGAAAAAAAGCACGG - Intronic
1170306344 20:14942379-14942401 AAGGAGAAGGAGAAAAAAAAAGG - Intronic
1170730475 20:18970577-18970599 CAGGAGTAGGAGAGAAAGCAGGG - Intergenic
1171030076 20:21669185-21669207 CAGGAGAAGCAGAGAAAGGAGGG - Intergenic
1171094082 20:22315134-22315156 CAGGAGAGAGAAAAAAAGGAGGG + Intergenic
1171152124 20:22836354-22836376 AAATAGAAGGAAAAGAAGGAAGG - Intergenic
1172253502 20:33496809-33496831 CAGGATAGGGTGAAAAAGGATGG - Intronic
1172439332 20:34954616-34954638 CTGTAGAATGAGAAAAACAAAGG - Intronic
1172741628 20:37172947-37172969 GAGAAGAAGGAGAAAAATGCAGG - Intronic
1172870480 20:38132501-38132523 CTGCAGAAGGGGAGAAAGGAGGG + Intronic
1173156505 20:40616916-40616938 CAGCTGAAGGAGCAGAAGGAAGG - Intergenic
1173485687 20:43439362-43439384 GAGAAGAGGGGGAAAAAGGAAGG - Intergenic
1173690714 20:44959198-44959220 CAAGAAAAGGAAAAAAAGGAAGG + Intronic
1173775124 20:45698979-45699001 AAGAAGAAGGAGGAGAAGGAGGG + Intronic
1173900384 20:46583447-46583469 CAGTGAAAGGAGAAGCAGGAAGG + Intronic
1173920528 20:46741447-46741469 GATTGGATGGAGAAAAAGGATGG - Intergenic
1174013454 20:47469278-47469300 GAAAAGAAGGAAAAAAAGGAAGG - Intergenic
1174059531 20:47822769-47822791 GAGTAGGAGGAGGAAGAGGAGGG - Intergenic
1174199266 20:48795600-48795622 CAGAAGAAAAAGAAAAAGGCAGG + Intronic
1174520538 20:51126804-51126826 GACTAGGAGGAGAAAAGGGAAGG - Intergenic
1174726486 20:52868106-52868128 CTGTGGAAGGACAAAATGGAAGG - Intergenic
1174835392 20:53852073-53852095 AGGAAGAAGGGGAAAAAGGACGG - Intergenic
1175200512 20:57273797-57273819 CAGAAGAAGGAGAAAAGGCAGGG - Intergenic
1175262993 20:57686422-57686444 CATTTGAGAGAGAAAAAGGAAGG - Intronic
1175452084 20:59077886-59077908 AAGGAGAAGGAGAAAAAGGAGGG + Intergenic
1175502580 20:59460887-59460909 CAGGAGATGGTGAAAATGGAGGG - Intergenic
1176668966 21:9714178-9714200 AAGAAGAAAGAGAAAAAAGAAGG - Intergenic
1176720448 21:10388294-10388316 CAGGAGGAGAAGAAGAAGGAGGG + Intergenic
1177093741 21:16804421-16804443 CAGAAGAAGGAGCAAAATTATGG + Intergenic
1177447843 21:21221199-21221221 GAGAAGAGGGAGAAAAATGAGGG - Intronic
1177555480 21:22682457-22682479 CAGAAGAAGAAGGAAAATGAGGG - Intergenic
1178123793 21:29496033-29496055 CAGGAAAAGGATAAGAAGGAAGG - Intronic
1178403034 21:32303539-32303561 GAGGGGAAGGAGAGAAAGGAAGG + Intronic
1178496222 21:33088700-33088722 AAAAAGAAGGAGAAAAAGGAGGG + Intergenic
1178670481 21:34586655-34586677 AAGTAGAAGGAGAAAAGGACAGG + Intronic
1178691672 21:34755064-34755086 CAGGAAAAGGAGAAGAAGGAAGG + Intergenic
1178729164 21:35083165-35083187 GATAAGAAGGAGGAAAAGGAGGG + Intronic
1179068082 21:38045111-38045133 TAGTAGACACAGAAAAAGGAGGG - Intronic
1179116694 21:38499806-38499828 CAGAAGAGAGAGAGAAAGGAAGG + Intronic
1179185399 21:39081804-39081826 AAGGAGAAGGAGAAGAAGGAGGG + Intergenic
1180102767 21:45597191-45597213 CAGTAGAGAGAGAAAAAGAGGGG + Intergenic
1180301652 22:11041143-11041165 CAGGAGGAGAAGAAGAAGGAGGG + Intergenic
1181348765 22:22240415-22240437 CAGGAGGAGGAGGAAGAGGAGGG + Intergenic
1181544421 22:23593270-23593292 CAGTAGAAGAAGTCAATGGAAGG + Intergenic
1181896385 22:26111583-26111605 AAAAAGAAGGAGAAGAAGGAGGG - Intergenic
1182172152 22:28242211-28242233 CATTAGAAGGAGTAAAGGGCCGG - Intronic
1182286327 22:29250352-29250374 CAAGAGAAGAAGAAAAAGGCAGG - Intronic
1182395884 22:30035685-30035707 CAGAAGCAGGAGGAAGAGGAAGG - Intergenic
1182801814 22:33037904-33037926 GAGAAGAAAGAGAAAAAGAAAGG + Intronic
1182843469 22:33411036-33411058 CAGTAGAAGGGAAAGAAGGAAGG - Intronic
1183237973 22:36634332-36634354 AACTAGAAGGAGAAAAATCATGG - Intronic
1183651762 22:39159423-39159445 GAGGAGGAGGAGGAAAAGGAGGG - Intergenic
1184295925 22:43525541-43525563 AAGGAGGAGGAGAAAGAGGAAGG - Intergenic
1184763081 22:46556338-46556360 CAGGAAAAAAAGAAAAAGGAAGG + Intergenic
1184929021 22:47666749-47666771 CAGAAGAAGAAGAAAAAAGGAGG - Intergenic
1184999419 22:48235326-48235348 AAGGAAGAGGAGAAAAAGGAGGG - Intergenic
1185079781 22:48703331-48703353 CACCTGAAGGAGAAGAAGGAAGG - Intronic
949142860 3:655892-655914 AAGCAGAAGAAGCAAAAGGAAGG - Intergenic
949347769 3:3092782-3092804 CAGTAGAAGGAAAAAGAAGAAGG - Intronic
949385055 3:3491913-3491935 CAGTAAAAAGAAAAAAAGAAAGG + Intergenic
949539564 3:5021290-5021312 AAAGAGAAGGAAAAAAAGGAAGG + Intergenic
949562553 3:5215808-5215830 CACTAGAAAGACAAAAACGAGGG - Exonic
949882018 3:8669001-8669023 AAGAAGAAAGGGAAAAAGGAAGG + Intronic
950528158 3:13536619-13536641 CAGTGGAAGGACAGGAAGGAGGG - Intergenic
950582024 3:13868638-13868660 GAGGAGAAAGAAAAAAAGGAGGG + Intronic
950855248 3:16098517-16098539 GAGCAAAAGGGGAAAAAGGATGG - Intergenic
950918609 3:16670099-16670121 AAGCAGAAGAAGAAAAAGAAGGG + Intronic
950996419 3:17502404-17502426 AAGTAGAAGGAAAACCAGGATGG - Intronic
951117334 3:18880392-18880414 CAGAAGGAGGAGAAAAAGAGAGG + Intergenic
951150076 3:19278377-19278399 CAGTTGAAAGGAAAAAAGGAAGG + Intronic
951272951 3:20649963-20649985 CAGTAGAGGGAGAAAGTGAAGGG - Intergenic
951773902 3:26287412-26287434 GAGTAGAAATAGAAATAGGAGGG + Intergenic
951839005 3:27013471-27013493 CAGTAGAGGAAGATAAAGAATGG + Intergenic
952039892 3:29249297-29249319 CAGGAGAAAGAGAGAAAGAAGGG - Intergenic
952169488 3:30791241-30791263 CTGAAAAGGGAGAAAAAGGATGG - Intronic
952596406 3:35023844-35023866 CAGTAGAATGAGAACCAGGGTGG - Intergenic
953361184 3:42298358-42298380 GAGAAGGAGGAGTAAAAGGAGGG + Intergenic
953498729 3:43412354-43412376 TAGGAGAATGAGGAAAAGGAGGG + Intronic
953724419 3:45385303-45385325 CAGTTGAAGATGAAAAAGGCAGG - Intergenic
953763860 3:45717662-45717684 ATGTGGAAGGAGAAAAAGTAAGG + Intronic
954006644 3:47596596-47596618 AAGAAGAAGAAGAAAAAAGATGG + Intronic
954253418 3:49386265-49386287 AAGTATAAGGAGAAAACGGAAGG - Intronic
954294175 3:49665004-49665026 ATGTGGGAGGAGAAAAAGGAGGG + Intronic
954367399 3:50154001-50154023 GAGGAGAAGGAGGAAAAGGAGGG + Intergenic
954879904 3:53827270-53827292 CAGTAGGAAGAGAGAGAGGAGGG - Intronic
954955177 3:54512515-54512537 AAGGTGCAGGAGAAAAAGGAAGG - Intronic
954987564 3:54809263-54809285 GAGAAGAAAGAGATAAAGGAAGG - Intronic
955444468 3:58994751-58994773 CAGGAAGAGGAGAGAAAGGATGG + Intronic
955823827 3:62924146-62924168 CATTAGAAGTAGAAAAGGGTTGG - Intergenic
955879674 3:63530143-63530165 GACTGGAAGGAGATAAAGGAAGG + Intronic
955987923 3:64594433-64594455 CACTGGAAGAAGGAAAAGGAAGG + Exonic
955990394 3:64621031-64621053 CAGCAGGAGAAGCAAAAGGAGGG - Intronic
956082027 3:65567534-65567556 AAGAAGAAAGAGGAAAAGGATGG + Intronic
956198845 3:66684173-66684195 AAGTAGAAGAAGGAGAAGGAGGG - Intergenic
956202630 3:66722314-66722336 AAGAAGAAGGAGAAAGAGGGAGG - Intergenic
956313961 3:67913835-67913857 TAGAAGAAGGAGGAAAAGGAGGG - Intergenic
956637808 3:71383622-71383644 GAGTGGAGGGAGAAAAAGCAGGG + Intronic
956672803 3:71707133-71707155 CAGTAGAAGTAGACAAATTATGG + Intronic
956750017 3:72337808-72337830 GAGGAGAGGGAGGAAAAGGAAGG + Intergenic
956778946 3:72589479-72589501 CATGAGAAGAAGAAGAAGGATGG - Intergenic
956807512 3:72830820-72830842 CAGAAGATGGAGAAAAATAAGGG + Intronic
957193374 3:77039184-77039206 CACAAGGGGGAGAAAAAGGAGGG - Intronic
957347856 3:78984926-78984948 TAGGAGGAGGAGAAAGAGGAGGG - Intronic
957477562 3:80745980-80746002 CATTATAATGAGAAAAAGTAAGG - Intergenic
957538325 3:81534609-81534631 GAGAAGAAACAGAAAAAGGAAGG + Intronic
957540220 3:81558992-81559014 CAAGAGAAGGAGAAAAAGCAAGG + Intronic
957573289 3:81976712-81976734 AAGAAGGAGGAGAAAGAGGAGGG + Intergenic
957692412 3:83589046-83589068 GAGTGGGAGAAGAAAAAGGAAGG - Intergenic
957805892 3:85148871-85148893 GAGGAGGAGGAGAAAGAGGAGGG + Intronic
958075835 3:88677033-88677055 GAGGAGGAGCAGAAAAAGGAAGG - Intergenic
958121377 3:89293714-89293736 CAGTAGACGAAGGAAAAGCAAGG - Intronic
958187968 3:90147922-90147944 CAGGAGAAAGAGAGAAAGAAGGG + Intergenic
958410511 3:93809819-93809841 CAGGAGAAAGAGAGAAAGAAGGG + Intergenic
958479320 3:94626647-94626669 GAGTGCAAGCAGAAAAAGGAGGG - Intergenic
958524248 3:95233366-95233388 CAGCAGTAGGAGAGAAAGGAAGG - Intergenic
958590486 3:96152754-96152776 GAGAAGGAGGAGAAAAAGAAAGG + Intergenic
958964832 3:100547580-100547602 GAGGAGGAGGAGGAAAAGGAGGG + Intronic
959015081 3:101124642-101124664 CAGTTATAGGAGAAAATGGAGGG + Intergenic
959061307 3:101618897-101618919 CCATAAAAGGACAAAAAGGAAGG + Intergenic
959580988 3:107982086-107982108 AAGAGGAAGGTGAAAAAGGAAGG + Intergenic
959655444 3:108799408-108799430 AAAGAAAAGGAGAAAAAGGAAGG - Intergenic
959768705 3:110066902-110066924 AAGGAGCAGGAGAAAGAGGAAGG - Intergenic
960217377 3:115058363-115058385 AAGTAAGAGGAGAAAAATGAAGG - Intronic
960325077 3:116285772-116285794 GAGTGGAAGGAAAAAAAAGAAGG - Intronic
960620699 3:119633940-119633962 CAATAGAGCGAGAAAAAGGTGGG + Intergenic
960757120 3:121027509-121027531 CTTTAGAAGCTGAAAAAGGAAGG - Intronic
960876695 3:122303063-122303085 CAGTTCAAGTAGAGAAAGGAAGG - Intergenic
960931822 3:122859327-122859349 CAGTAGAAGAAGAGAGAGCAGGG + Intronic
961227051 3:125260009-125260031 CAGTAGAGGCAGAGAAATGAGGG + Intronic
961635803 3:128331538-128331560 GAGGAGAAGGGGAGAAAGGAAGG - Intronic
961879406 3:130050281-130050303 AAGAAGAAGGAGAAGAAGGAAGG + Intergenic
962680791 3:137797981-137798003 CAATAGGAGGAAAGAAAGGAAGG - Intergenic
963414308 3:144975141-144975163 GAGGAGAAGGAGGAAAAGAAGGG - Intergenic
963464921 3:145667246-145667268 GAGGAGGAGGAGGAAAAGGATGG + Intergenic
963745367 3:149119524-149119546 CAGGAGCAAGAGAAAAGGGAAGG - Intergenic
963873096 3:150441386-150441408 AGGTAGAAGGAAAAACAGGAGGG - Intronic
964012507 3:151907881-151907903 CATTAGAAGGAGACAAAATAGGG + Intergenic
964092253 3:152891542-152891564 CAGGAGCAAGAGAAAAGGGAGGG + Intergenic
964177654 3:153844285-153844307 CAGTAAGAGAAGATAAAGGAAGG + Intergenic
964394237 3:156228800-156228822 CTGTGGAAGGAGAAATAGGGTGG - Intronic
964447138 3:156771340-156771362 CAGCAGAAGGAGAAAATGTGAGG - Intergenic
964564315 3:158033109-158033131 AAGAAGAAGAAGAAAAAGAAGGG + Intergenic
964637029 3:158869415-158869437 AAGAAGAAGACGAAAAAGGAGGG - Intergenic
964746799 3:160020195-160020217 GAGAAGAAAGAGAGAAAGGAAGG + Intronic
965043947 3:163551167-163551189 ATGTAGAAAGAGAAAAATGAAGG - Intergenic
965056530 3:163723805-163723827 CAGAAGAAGAAAAAAAAAGAGGG - Intergenic
965153474 3:165013564-165013586 GAGTAGAAGGAAAAAAATGTTGG - Intronic
965611359 3:170547131-170547153 GAGGAAAAGGAGAAGAAGGAAGG - Intronic
965835242 3:172843854-172843876 CAGTATAAGGAGAATATGAAAGG - Intergenic
966071254 3:175881204-175881226 CAGGAAAAGGAGAAAAAAGAGGG - Intergenic
966139930 3:176745408-176745430 CTGTAGAAGGACAGAAAGGGAGG + Intergenic
966370944 3:179250150-179250172 GAGGAGGAGGAGAAAGAGGAGGG + Intronic
966449797 3:180045236-180045258 CACTTGAAGGAGAAGAAGGAAGG - Intergenic
966564433 3:181360760-181360782 AAGAAGAAGAAGAAGAAGGAAGG + Intergenic
966598045 3:181745089-181745111 GAGGAGAAAGAAAAAAAGGAAGG - Intergenic
967690104 3:192463970-192463992 GAGTAGGAGTAGAAAAAAGAGGG - Intronic
968212050 3:196856933-196856955 CAAAAGAAAAAGAAAAAGGAAGG + Intergenic
968359941 3:198139733-198139755 GAGAAGGAGGAGAATAAGGAGGG + Intergenic
969031913 4:4222412-4222434 CGGCAGGAGGAGCAAAAGGAGGG - Intronic
969070750 4:4536631-4536653 GAGTAGAGTGAGCAAAAGGAGGG + Intronic
969689714 4:8697855-8697877 CAGGAGCAGGAGAAGCAGGAAGG - Intergenic
969727189 4:8927306-8927328 TAGTAAAAGGAGAAACAGGAGGG - Intergenic
969823717 4:9740263-9740285 AAGCAGAAGGAGAAGAAGGAAGG - Intergenic
970166861 4:13247755-13247777 AAGTAGAAGGAGAAAGAAGATGG - Intergenic
970301079 4:14681854-14681876 CAGGAGAAAGAGAAAGAGAATGG + Intergenic
970620939 4:17817603-17817625 CACCAGGAGGGGAAAAAGGAAGG - Intronic
970681376 4:18512349-18512371 GAGTAAAAGGAAAAAGAGGAGGG - Intergenic
971040373 4:22745062-22745084 CAGTATAAGGAGGAATAGAATGG - Intergenic
971234547 4:24829416-24829438 CAGAAGATGGAGAAAAAAGATGG + Intronic
971278366 4:25219555-25219577 GAGAAGGAGGAGAAACAGGAGGG + Intronic
971353620 4:25874504-25874526 AAGCAGAAGGAAAATAAGGAGGG + Intronic
971394338 4:26214641-26214663 AAAAAGAAAGAGAAAAAGGAAGG + Intronic
971447950 4:26772454-26772476 AAGTTGAAGGAAAAAAAAGATGG - Intergenic
971595381 4:28520996-28521018 AGGTAGAAGGAGAGGAAGGAAGG - Intergenic
971667802 4:29513874-29513896 GAGCAGAAGGATAAGAAGGAAGG - Intergenic
971777427 4:30984767-30984789 CAGTAGAATGTGGCAAAGGAAGG + Intronic
971783850 4:31074927-31074949 GAGTAGGAGGAGAAGAAGAAAGG - Intronic
971823685 4:31593193-31593215 AAAAAGAAAGAGAAAAAGGAAGG - Intergenic
971978412 4:33721312-33721334 TAGCAGAGGGAGAATAAGGATGG + Intergenic
972162988 4:36247630-36247652 AAGTAGAAGGAGGAAAAGGAGGG - Intergenic
972213682 4:36870131-36870153 CAGAAAAGGGAGAGAAAGGAGGG + Intergenic
972686428 4:41358148-41358170 CAGGAGAAAGAGAACAAAGAGGG + Intergenic
972995432 4:44873099-44873121 CAGTAGAAGGTGATAAATGTTGG - Intergenic
973100964 4:46270274-46270296 CAGTAAAAAGACAAAAAGAAAGG - Intronic
973169587 4:47122857-47122879 CAGTAGAGGGAGCTAGAGGAAGG - Intronic
973246049 4:48012510-48012532 CAGCAAAAGGAAAAAGAGGAAGG - Intronic
973881451 4:55275382-55275404 GAGCAGAAGGAGGAAGAGGAGGG + Intergenic
974332859 4:60502888-60502910 AAAAAGGAGGAGAAAAAGGAGGG - Intergenic
974382189 4:61155159-61155181 CAGTAAAAGAACAAAAAGAAAGG + Intergenic
974404510 4:61448682-61448704 CAGTAGAAGGATAGGAACGAAGG + Intronic
974970845 4:68824425-68824447 CAGCAGAAGGAAATATAGGAAGG + Intronic
974984943 4:69011978-69012000 CAGCAGAAGGAAATATAGGAAGG - Intronic
974999707 4:69207532-69207554 CAGCAGAAGGAAATATAGGAAGG - Intronic
975329571 4:73099089-73099111 CTGGAGAAGGAGGAAGAGGAGGG + Intronic
975483338 4:74906433-74906455 CAGAAGAAGGAGGAAGAGAAAGG + Intergenic
975486311 4:74936845-74936867 CTCAAGAAGGACAAAAAGGAAGG + Intronic
975825128 4:78311486-78311508 ATGCAGATGGAGAAAAAGGAGGG - Intronic
975891347 4:79032413-79032435 CAGAAGAAAGAAGAAAAGGAAGG - Intergenic
975905334 4:79204553-79204575 AAGTAGAAGGAGAGAAGGAAGGG - Intergenic
976071496 4:81245227-81245249 CGGTAGAAGCAAAAAAAGGTAGG + Intergenic
976344241 4:83981768-83981790 GTGTAGAATGAGAAAAAGCAAGG + Intergenic
976615277 4:87069655-87069677 CAGTAAAATGAAAGAAAGGAGGG - Intronic
977058288 4:92220959-92220981 GAGGAAGAGGAGAAAAAGGAAGG + Intergenic
977166171 4:93700907-93700929 CATTAAAAGGAGAAAAAAAAAGG - Intronic
977263572 4:94827624-94827646 CATTAGGAGAAGAAAAAGAAGGG - Intronic
977265532 4:94849192-94849214 AAGGAGAATGAGAAAAAGCAAGG + Intronic
977277084 4:94991164-94991186 CAGTAGAAGGAGAATGAAAAAGG - Intronic
977374213 4:96180571-96180593 CAGGGGAAGGAGAGAGAGGAGGG - Intergenic
977462665 4:97344281-97344303 AAGGAGAAGAAGAAAAAGAATGG + Intronic
977931914 4:102758869-102758891 CAGTGGAATGAGAAATGGGAAGG - Intronic
978011442 4:103689741-103689763 CAGAAGAAGAGGAAAAAGAAGGG + Intronic
978043509 4:104098686-104098708 CAGTAGAAGTAGAAATATGTGGG + Intergenic
978277343 4:106967871-106967893 AAGCAAAAGGAGAAGAAGGAAGG + Intronic
978850666 4:113332107-113332129 CAGAAGAAGGAGAAGAATGGGGG - Intronic
979098396 4:116581402-116581424 GAGTAGAAAGAGAAAAAGGAAGG - Intergenic
979363203 4:119788876-119788898 CATAAGAGAGAGAAAAAGGAGGG + Intergenic
979382492 4:120024168-120024190 CTGAAGAAGGAGAAAAAAAAAGG + Intergenic
979387430 4:120085938-120085960 CAGTAGCAGAAGGCAAAGGATGG - Intergenic
979405014 4:120299168-120299190 AAGAAAAAGGAGAAAGAGGAAGG - Intergenic
979769210 4:124501768-124501790 CAGTATAATGAGAAAACTGAAGG - Intergenic
979821640 4:125180743-125180765 GAAGAGAAAGAGAAAAAGGAAGG + Intergenic
980066151 4:128190992-128191014 CAGTCAGAGGAGAAAAAGAAAGG - Intronic
980176867 4:129356460-129356482 CATCAGAAGGAGAAAGAGGAGGG - Intergenic
980420083 4:132547491-132547513 CAGAAGGTGGAGAAAAAGAAGGG - Intergenic
980445563 4:132902470-132902492 TAGTAGAAGCACAAAAGGGATGG - Intergenic
980576636 4:134690941-134690963 AAGGAAAAGGAAAAAAAGGATGG + Intergenic
980767850 4:137331503-137331525 CAGTATAAGAAGAAACAGGCAGG - Intergenic
980833034 4:138154741-138154763 AAGAAGAAGAAGAAGAAGGATGG - Intergenic
980888502 4:138788909-138788931 CAGAAGAATTAGAGAAAGGAAGG + Intergenic
980995783 4:139778471-139778493 CAGTGGAAGGAGAAAAAGATGGG + Intronic
981188154 4:141829931-141829953 TAGCAGAAGGAGGAAGAGGAAGG - Intergenic
981515063 4:145598842-145598864 TAGTGGAAGGTGGAAAAGGAAGG + Intergenic
982293727 4:153805880-153805902 AAATTGAAGGAGAAAAAAGATGG + Intergenic
982334599 4:154220005-154220027 TAGTAGAAAAAAAAAAAGGAAGG - Intergenic
982601535 4:157457122-157457144 AAAAAGAAAGAGAAAAAGGAAGG - Intergenic
982824204 4:159981826-159981848 CAGAAGAAGGAAAGAAGGGAGGG - Intergenic
983129652 4:164001425-164001447 CAGTAGGAGGTTAAAAATGAAGG + Intronic
983169989 4:164524664-164524686 CACTAGAAAGAGAAAAAGTCTGG + Intergenic
983379832 4:166978676-166978698 GAGGAGAAGGAGGAAGAGGAGGG + Intronic
983655966 4:170084974-170084996 GAGGAGAAGGAGGAAGAGGAGGG - Intronic
983862527 4:172725317-172725339 CAGTAGAAGGTGAAAAAGTTTGG - Intronic
984112012 4:175628444-175628466 CAATAAAAAGAGAAAAAGCAGGG + Intergenic
984123922 4:175781476-175781498 AAGTAGAAGTTCAAAAAGGAAGG - Intronic
984189552 4:176589019-176589041 TAGTAGAAGGAGAAAGAGGAAGG + Intergenic
984361897 4:178744618-178744640 CATTAGAATAAGAAAAAGAAGGG - Intergenic
984406255 4:179334956-179334978 CAGGAGAAAGAGAATAATGATGG + Intergenic
984530101 4:180905558-180905580 GAGGAGGAGGAGGAAAAGGAGGG + Intergenic
984632567 4:182076187-182076209 AAGAAGAAGGAGAAAGAGGCTGG - Intergenic
985168343 4:187121810-187121832 AAGTAGAAGGAGGAAGAGGAGGG + Intergenic
985405816 4:189637337-189637359 AAGAAGAAAGAGAAAAAAGAAGG + Intergenic
986009734 5:3701177-3701199 GAGAAGGAGGAGAAGAAGGAGGG - Intergenic
986026726 5:3858193-3858215 CAGTGGGAGGTGAATAAGGAGGG + Intergenic
986221734 5:5774775-5774797 AAGTAGGAGGAGAAGGAGGAGGG - Intergenic
986465111 5:8013054-8013076 GAGGAGAAGGAGAAAATGAATGG + Intergenic
986566769 5:9123467-9123489 AAGGAGAAGGAGAAGAATGATGG + Intronic
986707581 5:10464191-10464213 CAGAGGAAGGAGGAAAAAGAGGG - Intronic
987032852 5:13991503-13991525 AAGGAGAAGGAGGAAGAGGAGGG + Intergenic
987069784 5:14325439-14325461 GAGAAGCAAGAGAAAAAGGAGGG + Intronic
987493262 5:18609092-18609114 CACGAGAAGGAAGAAAAGGATGG - Intergenic
987518598 5:18948220-18948242 GAGAAGAAGAAGAAGAAGGAGGG + Intergenic
987566371 5:19593530-19593552 AGGGAGAAGGAGAAGAAGGAAGG - Intronic
987734064 5:21816170-21816192 GAGGAGAAGGAGGAAGAGGAGGG - Intronic
988174005 5:27696795-27696817 AAAGAGAGGGAGAAAAAGGAGGG + Intergenic
988243461 5:28645072-28645094 CAGAAGAAGAAGAAAGAGAAAGG + Intergenic
988297287 5:29382064-29382086 CAAAAGAAGGAGAATATGGATGG - Intergenic
988452860 5:31360903-31360925 TATTAGAAGGAGGAAAAGGTGGG - Intergenic
988626333 5:32879199-32879221 GAGGATAAGGAGAAATAGGAAGG + Intergenic
989459445 5:41680570-41680592 CAGGAAGAGGAGAAAAAGAAGGG + Intergenic
989592449 5:43124226-43124248 CAGTAGCAGAAGAAAAAGCATGG - Intronic
990059967 5:51635717-51635739 CAGCAAAAGGAAAAAAAGGCAGG + Intergenic
990123430 5:52484364-52484386 AAGAAGAAGGAGAATGAGGAGGG + Intergenic
990156376 5:52882202-52882224 CAAGAGAAGGATAAGAAGGATGG - Intronic
990528258 5:56649956-56649978 CGGTGGAAGGAGACAAAGGCAGG - Intergenic
990570999 5:57078773-57078795 GAGGAGAAGGAGGAAGAGGAGGG + Intergenic
990758972 5:59107598-59107620 CAGTAGAAGGAGAAGTAGAGGGG + Intronic
991416493 5:66397880-66397902 CATGAGAAGGAGAAACGGGAGGG + Intergenic
991518938 5:67472604-67472626 CAGTAAAAGAAGAAAACAGATGG + Intergenic
991630600 5:68653027-68653049 AAGGAAAAGGAGAAAAAGAATGG - Intergenic
991924801 5:71694492-71694514 GAGGAGAAGTAGAAAAAGGGAGG - Intergenic
992193824 5:74320229-74320251 AAGGAGATGAAGAAAAAGGAGGG - Intergenic
992296045 5:75327806-75327828 CAGAATAAGGATAAAAAGAAAGG - Intergenic
992603829 5:78434551-78434573 AAGAAGGAGGAGGAAAAGGAAGG - Intronic
992846442 5:80753832-80753854 CAGTGGAAGGAGAAAGAACAGGG + Intronic
993033373 5:82729877-82729899 GAGGAGAAGGAGGAAGAGGAAGG - Intergenic
993048659 5:82898680-82898702 AAGTTGAAGGAGAGAAAGGAAGG + Intergenic
993215534 5:85018254-85018276 CAGGAGGAGGAGAAAGAGAAGGG + Intergenic
993218190 5:85053395-85053417 CAGTAAAAGGAGAAAACTGCTGG - Intergenic
993284271 5:85970369-85970391 CAGTAAAAAAAGATAAAGGAGGG - Intergenic
993361508 5:86982168-86982190 CAGCAAAAGGGGAAAGAGGAAGG - Intergenic
993425541 5:87759748-87759770 GAGTAGAAGGAGAAGATGGGTGG + Intergenic
993621381 5:90172277-90172299 CAGTAGGATGAGAAGAAGAATGG - Intergenic
993701367 5:91122941-91122963 CAGGAGTAGGAGAAACAGGCAGG - Intronic
994019560 5:95007108-95007130 GAGGAGAATGAGAAAAAGGGGGG + Intronic
994569989 5:101503857-101503879 CAGGAGCAAGAGAAAGAGGAAGG - Intergenic
994641835 5:102420565-102420587 CAAAAGAAAGAGAAAAAGGAGGG + Intronic
994933165 5:106216431-106216453 CAAGAAAATGAGAAAAAGGAAGG + Intergenic
995035147 5:107525709-107525731 GAGGAGAAGGAGAAAGAAGAGGG + Intronic
995203114 5:109448406-109448428 GAGTAGAAGCTGAAAAAAGATGG - Intergenic
995288872 5:110426117-110426139 TAGAAGAAGGAGAAAGAGAAAGG - Intronic
995674553 5:114648716-114648738 CGATACATGGAGAAAAAGGAAGG + Intergenic
995767931 5:115639073-115639095 CAGTAGATTTAGAAAAAGAAGGG + Intergenic
995980243 5:118093160-118093182 GAGAAGAAAGAGAAGAAGGAAGG + Intergenic
996022472 5:118606552-118606574 CAACAGAAGAAAAAAAAGGAAGG + Intergenic
996497189 5:124172601-124172623 GAGTAGAAAGAGAAAGAGAATGG + Intergenic
997126647 5:131233854-131233876 CAATAAAAGCAGAAAAAGTATGG - Intergenic
997132028 5:131286640-131286662 GAAGAGAAGGAGGAAAAGGAGGG - Intronic
997401622 5:133607898-133607920 CGGTAGAAGGAAAGAAGGGAGGG + Intronic
997506534 5:134421993-134422015 AAGGAGAAGGAGGAAGAGGAAGG - Intergenic
997806586 5:136923987-136924009 CTGTAGCAGGAGTAAAAGCAGGG - Intergenic
997868855 5:137489288-137489310 CAGTGGAAGGGGAAAAGGTAAGG + Intronic
998601998 5:143593973-143593995 TTGTAAAAGGAGAAAAAGAACGG + Intergenic
998809371 5:145950640-145950662 AAGAAGGAGGAGAAAAGGGAGGG + Intronic
998821819 5:146064135-146064157 GAGGAGAAGGAGAAAGAGGAGGG + Intronic
998852430 5:146364002-146364024 CAGAAGAAGGAGATGAAGGGTGG + Intergenic
998981526 5:147708471-147708493 ACGTAGAAGGAGAAACAGGTTGG + Intronic
999178365 5:149648382-149648404 CAGGAGGAGGAGAGCAAGGAGGG - Intergenic
999412184 5:151360479-151360501 GAGGAGGAGGAGGAAAAGGAGGG + Intergenic
999563698 5:152833837-152833859 CAGTAAAAGGACATAAAAGAAGG - Intergenic
999773867 5:154795472-154795494 CAAGAGAGGGAGAGAAAGGAAGG - Intronic
1000060780 5:157653105-157653127 CAGTAGAAAGAGAATGATGATGG - Intronic
1000065786 5:157691934-157691956 CAGTAGAAAGAGAATGATGATGG - Intergenic
1000828252 5:166072966-166072988 CAATAAAAGAAGAAAAAGAAAGG + Intergenic
1000859374 5:166438249-166438271 CGGCAGAAGGCGAAAAAGCAAGG - Intergenic
1001142674 5:169158021-169158043 AAGAAGAGGGAGAGAAAGGATGG + Intronic
1001692716 5:173644710-173644732 CAGTGGAACCAGAAAATGGAGGG - Intergenic
1002167249 5:177355853-177355875 CAGCTGAAGGAGAAAGAGGGAGG + Intergenic
1002663251 5:180804830-180804852 CAGGTGAAGGGGAAACAGGATGG + Intronic
1002761558 6:206285-206307 CAGTAGAAGAAGAAAAGGCCTGG + Intergenic
1002829172 6:803455-803477 AAGTAGAAGAAAAAGAAGGACGG - Intergenic
1002865106 6:1115010-1115032 CAAGAGAGGAAGAAAAAGGAAGG - Intergenic
1002969140 6:1996162-1996184 TAGAAGAATGAGAAAGAGGAAGG - Intronic
1003138625 6:3453811-3453833 AAGTAGAAGCAGAAAGTGGAAGG - Intronic
1003282961 6:4710282-4710304 CTGCAGAAAGAGAAAGAGGAAGG + Intronic
1003403361 6:5809088-5809110 AAGGAGAAGGGGAAAAAGGAAGG - Intergenic
1003422982 6:5974543-5974565 CAGTAGTGGGGGAAAATGGAAGG - Intergenic
1003509929 6:6771287-6771309 AAGAAGAAGGAGAAGGAGGAAGG + Intergenic
1003509940 6:6771330-6771352 AAGAAGAAGGAGAAGGAGGAAGG + Intergenic
1003509951 6:6771373-6771395 AAGAAGAAGGAGAAGGAGGAAGG + Intergenic
1003529272 6:6924598-6924620 CAGGAGCAGGAGAGAGAGGAGGG - Intergenic
1004274721 6:14225526-14225548 AAGTTGATGGAGAAAAAGGCAGG + Intergenic
1004307263 6:14512318-14512340 CAGTCGAAAGAAAAAAATGATGG + Intergenic
1004368474 6:15031865-15031887 GAGAAGAAGAAGAAAGAGGAGGG + Intergenic
1004404982 6:15324481-15324503 AAAAAGAAGAAGAAAAAGGAGGG - Intronic
1004726021 6:18312091-18312113 CAGTAGAGGGATAAAAGAGATGG + Intergenic
1004945609 6:20609354-20609376 AAGGAGAAGGAGAAGAAGGGAGG - Intronic
1005100324 6:22165989-22166011 CAATAGATGCAGAAAAAGCATGG - Intergenic
1005122574 6:22406004-22406026 AAGGAGGAGGAGAAAAAGGTGGG + Intergenic
1005654429 6:27919534-27919556 CAGTATCAGGAGGAGAAGGAGGG + Intergenic
1006020207 6:31113285-31113307 CTCTAGAAGGTGAAAAAGCAGGG - Intergenic
1006030885 6:31175780-31175802 CTGCAGAAGGAGAGAAGGGAAGG - Intronic
1006175782 6:32120745-32120767 CTGAAGAAGGAGAAAAGGGCCGG - Intronic
1006176573 6:32125997-32126019 CAGGACAGGGAGAAAAAGGTGGG - Intronic
1006474283 6:34244828-34244850 CAGGAGAAGGAGGAAGAGGAGGG + Exonic
1006633830 6:35448289-35448311 GAGTAGAAGGACGAAGAGGAGGG + Intergenic
1006731639 6:36240367-36240389 AAGGAGAAGGAGACAAAGAAGGG - Intergenic
1006937289 6:37727335-37727357 AAGAGGAAGGAGAAAAAGTAGGG + Intergenic
1006994931 6:38250680-38250702 AAGTAGAATGGGAAAAATGAGGG + Intronic
1007950272 6:45866023-45866045 CAGAAAAAGGAGAGAAGGGAAGG - Intergenic
1008479294 6:51968383-51968405 CAGGAAAAGAAGAAAAGGGAGGG - Intronic
1008635905 6:53410701-53410723 CAGAAGCAGGAGAACACGGATGG + Intergenic
1008777021 6:55052173-55052195 TTGTAGAAGGACAAAAAGGAGGG - Intergenic
1009234456 6:61105664-61105686 GAGAAGGAGGAGAAAGAGGAGGG + Intergenic
1009683610 6:66928440-66928462 CAGTAGTAGCACAAAATGGATGG + Intergenic
1010091883 6:71992488-71992510 GAGGAGAAGAAGAAAAAGAAGGG - Intronic
1010290013 6:74124604-74124626 AAGAAGAAAGAGAAAAAGGCAGG - Intergenic
1010646826 6:78399419-78399441 CACTAGAAGGTGAAAATTGATGG - Intergenic
1011013653 6:82730523-82730545 CAGTACAAAGAGAATAAAGATGG + Intergenic
1011274276 6:85614745-85614767 CAGTGGAAGTAGAAACAGTAGGG - Exonic
1011354666 6:86461708-86461730 GAGGAGGAGGAGGAAAAGGATGG + Intergenic
1011484727 6:87829897-87829919 GAGGAGAAGGAGGAACAGGAGGG - Intergenic
1011517968 6:88173109-88173131 CTCTAGAAGGTGACAAAGGAGGG - Intergenic
1012232525 6:96777215-96777237 AAGGAGAAGGAGAAGAAAGAGGG - Intergenic
1012713184 6:102634369-102634391 AAGAAGAAGAAGAAGAAGGAAGG + Intergenic
1013007824 6:106090558-106090580 CTTTAGAAGGTGAAAGAGGATGG + Intronic
1013556966 6:111266248-111266270 CAGAAAAAGGAGACAAAGAAGGG - Exonic
1014041736 6:116835112-116835134 GAGAAGAAGGAGGAAAAGGAGGG - Intergenic
1014453745 6:121613321-121613343 CAGTAGAATGAAAAGAAGGGTGG + Intergenic
1014594187 6:123312335-123312357 GAGGAGGAGGAGGAAAAGGACGG - Intronic
1014642070 6:123924605-123924627 CAGTAGAAAGAGAACAGGGATGG + Intronic
1014755994 6:125302181-125302203 CAGGAGGAGGAGGAAGAGGAGGG - Intergenic
1014920769 6:127212475-127212497 CAGAAGAAGGACAAAAGGCAAGG - Intergenic
1015334153 6:132017120-132017142 AAGTTCAATGAGAAAAAGGATGG - Intergenic
1015445577 6:133300211-133300233 GAGGAGGAGGAGAAAGAGGAGGG + Intronic
1015480651 6:133704338-133704360 CAGTAAAAGGAGAAAACTGAAGG - Intergenic
1015706013 6:136088460-136088482 GCCTAGAAGGAGAAAAAGCAGGG + Intronic
1015857104 6:137636511-137636533 GAGGAGGAGGAGAAAGAGGAGGG + Intergenic
1016739213 6:147509777-147509799 GAAAAGAAAGAGAAAAAGGAAGG - Intronic
1016801470 6:148173501-148173523 AAGGAGAAGGAGAAGAAGAAGGG + Intergenic
1017293335 6:152766203-152766225 CAGCAGTAGGAGAAAGATGAAGG + Intergenic
1017297236 6:152812085-152812107 AAGGAGGAGGAGAAGAAGGAAGG - Intergenic
1017587439 6:155942764-155942786 AAGAAGAAGGAGGAAAAGAAAGG + Intergenic
1017669517 6:156756648-156756670 AAGGAGAAGGAGAGGAAGGAAGG + Intergenic
1017795835 6:157843530-157843552 GAGTAGGTGGAGGAAAAGGAGGG + Intronic
1018050224 6:160002503-160002525 GAGTAGGAGGAGGAAGAGGAGGG + Intronic
1018781964 6:167076250-167076272 CATTTGAAGCAAAAAAAGGAAGG - Intergenic
1019013341 6:168860923-168860945 GAGGAGAGGGAGAAAGAGGAAGG + Intergenic
1019135638 6:169905974-169905996 GAGCAGAAGGAGAGAAGGGAAGG + Intergenic
1019351811 7:557552-557574 CAGAGGAGGGAGAAACAGGATGG + Intronic
1020026813 7:4905350-4905372 GAGGAGAAGGAGGAAGAGGAAGG + Intergenic
1020042038 7:5011599-5011621 GAGTAAAAAAAGAAAAAGGAAGG + Intronic
1020334683 7:7053682-7053704 CAGCAGAAGAAAAGAAAGGAGGG - Intergenic
1020425203 7:8057717-8057739 CAGATTAAGAAGAAAAAGGAAGG - Intronic
1020719217 7:11720446-11720468 CAGTAGAAAGAGATTAAGCATGG - Intronic
1021201593 7:17733737-17733759 GAGGAGAAGGAGGAACAGGAGGG - Intergenic
1021482919 7:21137354-21137376 CAGGAGGAGGAGAAAGAGGAAGG - Intergenic
1022525651 7:31035329-31035351 CAGCAGCAGGGGAAGAAGGAGGG + Intergenic
1022858498 7:34340823-34340845 TAGCAGAAGGGGAAGAAGGAAGG - Intergenic
1022959708 7:35414832-35414854 CAGTTGAATGAGAAAGTGGATGG + Intergenic
1023047089 7:36219590-36219612 AAGAAGAAGGAGGAAGAGGAAGG + Intronic
1023047096 7:36219639-36219661 AAGAAGAAGGAGGAAGAGGAAGG + Intronic
1023148341 7:37175076-37175098 GAGTGGAAGGGAAAAAAGGAAGG + Intronic
1023214496 7:37847531-37847553 AAGAAGAAGGAGAAAGAAGAAGG + Intronic
1023250471 7:38254893-38254915 CAAAAGAAGGAGAAAAAGGTAGG - Intergenic
1023251772 7:38270992-38271014 CAAAAGAAGGAGAAAAAGGTAGG - Intergenic
1023565693 7:41521966-41521988 AAGAAGAAGAAGAAGAAGGAAGG + Intergenic
1023586856 7:41739781-41739803 GAGGAGGAGGAGAAAAAGGAGGG + Intergenic
1023602092 7:41890318-41890340 AAGAAGGAGGAGAAAAAGAAGGG - Intergenic
1023643719 7:42287629-42287651 CAGAAGAGGGAGAATAAAGATGG - Intergenic
1023808663 7:43893572-43893594 AAGTAAAAGGACAAAAAGGCTGG + Intronic
1024420415 7:49159305-49159327 AAGGAGGAGGAGAAAAAGGGAGG + Intergenic
1025607550 7:63050288-63050310 AAGAAGAAGAAGAAGAAGGAAGG + Intergenic
1025617243 7:63131315-63131337 GAGGAGGAGGAGGAAAAGGAGGG + Intergenic
1026191892 7:68136436-68136458 GAGGAGAAGGAGAAGAAGGAAGG + Intergenic
1026284147 7:68948375-68948397 AAGGAGGAGGAGAAAGAGGAGGG - Intergenic
1026350341 7:69510072-69510094 CTTGAGAAGGATAAAAAGGAGGG + Intergenic
1026659257 7:72284928-72284950 CTGTAGAGGAAAAAAAAGGAAGG - Intronic
1027703660 7:81501013-81501035 GGGAAGAAGGAAAAAAAGGAAGG - Intergenic
1027882216 7:83855132-83855154 AAGAAGAAGGAGAAAGAGGCAGG + Intergenic
1028110365 7:86933585-86933607 CCATAAAAGGACAAAAAGGAAGG + Intronic
1029184727 7:98730397-98730419 CAGGAGAAAGAGACAGAGGAAGG + Intergenic
1029321157 7:99761475-99761497 AAGAAGAAGGAGGAGAAGGAGGG - Intronic
1029377618 7:100189365-100189387 GAGTAGAAGGAAAAAATAGAAGG - Intronic
1029835143 7:103301514-103301536 AAGGAGAAACAGAAAAAGGAAGG + Intronic
1029923596 7:104292402-104292424 CAGGAGCAGGAGAATAAGGAGGG - Intergenic
1029956686 7:104647772-104647794 AGGAAGAAGGAGAAAGAGGAAGG + Intronic
1029966397 7:104745245-104745267 AGGAAGAAGGAGAAAGAGGAAGG - Intronic
1030190535 7:106806112-106806134 AAATGGAAGGAGAAAGAGGAGGG + Intergenic
1030724430 7:112909030-112909052 CCATAAAAGGACAAAAAGGATGG + Intronic
1030828026 7:114185986-114186008 AAAGAGAAAGAGAAAAAGGAGGG + Intronic
1031007655 7:116492259-116492281 AAGGAGCAGGAGAAAAGGGAAGG + Intronic
1031153023 7:118076250-118076272 GAAGAGAAGGAGGAAAAGGAGGG + Intergenic
1031282849 7:119826451-119826473 CAGTAGAAACATAAGAAGGAAGG + Intergenic
1031510561 7:122643701-122643723 AAGGAGAGGGAGAAAAAGGAGGG + Intronic
1031866902 7:127047485-127047507 AAGGAGAAGGGGAAAAAGAAAGG - Intronic
1032059006 7:128707990-128708012 GAAAAGAAGGAGAGAAAGGAAGG - Intergenic
1032204115 7:129846828-129846850 TAGTAGAAGGAGAAAGGGGATGG - Intronic
1032254154 7:130283852-130283874 CTAGAGAAGGAGAAAAAGGATGG + Intronic
1032309777 7:130774362-130774384 GAGGAGGAGGAGAAAAGGGATGG - Intergenic
1032450332 7:132025072-132025094 GAGTAGAGGAGGAAAAAGGAGGG + Intergenic
1032523275 7:132561942-132561964 GAGGAGGAGGAGAAAGAGGAGGG - Intronic
1032639781 7:133753042-133753064 CAGGATAAGGATAAAAAGAATGG - Intronic
1032669375 7:134069323-134069345 GAGGAGAAGGAGGAGAAGGAGGG - Intergenic
1032982792 7:137304188-137304210 GAGAAGGAGGAGAAAAAAGAAGG - Intronic
1033174526 7:139112142-139112164 AAGGAAAAGGAAAAAAAGGAAGG + Intergenic
1033318616 7:140319206-140319228 GAGCAGAAAGAGAAACAGGATGG + Intronic
1033854390 7:145540714-145540736 AAGAAGAAGGAAAAAAAGGAAGG - Intergenic
1033865705 7:145687977-145687999 CAGTGGCAAGAGAAAAATGAAGG + Intergenic
1033903148 7:146168018-146168040 CAGTATGGGGAGAAAAATGAAGG + Intronic
1034248609 7:149670048-149670070 CAGAAGAAGGAGGAGGAGGAGGG - Intergenic
1034393342 7:150802014-150802036 CAGGAGGAGGAGAAAAGAGAAGG - Intronic
1035232727 7:157476125-157476147 CTGGAGAATGAGAAACAGGATGG + Intergenic
1035741331 8:1930410-1930432 CAGTAGAAGCGGAAGAATGAAGG - Intronic
1036076492 8:5507999-5508021 CAGTAGAAGTAGAAAAATAGAGG - Intergenic
1036116784 8:5967697-5967719 CACTTGAAGGAGAAAGAGGAGGG - Intergenic
1036472994 8:9067430-9067452 TAGTAGAAGGGAAAAAAGAAAGG + Intronic
1036508453 8:9378399-9378421 AAGTAGAAAGAAAAGAAGGAAGG + Intergenic
1036612138 8:10359648-10359670 CAGTGGAAGGAGTGAAAAGAAGG - Intronic
1036719100 8:11156152-11156174 CAGTAAAAGGTGAAGAGGGAAGG - Intronic
1037154954 8:15688707-15688729 GAGGAGAAGGAGGAAATGGAAGG - Intronic
1037382563 8:18302928-18302950 GAGGAGGAGGAGGAAAAGGAGGG + Intergenic
1037470171 8:19200844-19200866 AAGTAGGAGGAGAAGAAGAAGGG + Intergenic
1037549289 8:19954579-19954601 CAGTAGCAAGAGAAAAAGGTGGG + Intronic
1037598401 8:20373614-20373636 GAGGAGGAGGAGAAGAAGGAAGG + Intergenic
1037717210 8:21410620-21410642 CACTAGAATTTGAAAAAGGAGGG + Intergenic
1037897225 8:22666072-22666094 CAGTAGTTTGACAAAAAGGAAGG - Intronic
1038044026 8:23750819-23750841 CAGGGAAAGGAGAACAAGGAAGG - Intergenic
1038138243 8:24814068-24814090 AAGTAGAAGGAGAGACAGGAAGG - Intergenic
1038261467 8:25999720-25999742 CGATAGAAAGAGAAAATGGAAGG - Intronic
1038386013 8:27146064-27146086 CTGGAGAAGGAAATAAAGGATGG - Intergenic
1039340112 8:36638741-36638763 GAGGAGGAGGAGAAAGAGGAGGG - Intergenic
1039345371 8:36698122-36698144 CACTAGTAGGAGAAAGAGGCGGG + Intergenic
1039577076 8:38632281-38632303 GAGAAGCAGGAGGAAAAGGAGGG + Intergenic
1039583333 8:38684743-38684765 CACTAGAAAGAGAAAGAGGTTGG - Intergenic
1039674505 8:39646885-39646907 AAGTAGAAGGAGAATGAAGAGGG + Intronic
1039824523 8:41161719-41161741 AAGAAGAAGGAAAGAAAGGAAGG - Intergenic
1040399545 8:47034574-47034596 CAGGAGAAGCAGAGAAAGAAAGG + Intergenic
1040564804 8:48555894-48555916 CAAAAGAAAGAGAAAGAGGAGGG - Intergenic
1040790081 8:51218215-51218237 CAGTAAAAGAAGACAAAGAAGGG + Intergenic
1040821863 8:51568790-51568812 AAATACAAAGAGAAAAAGGATGG - Intronic
1040949587 8:52924002-52924024 CAGGAGATGGGGAACAAGGAGGG - Intergenic
1040984849 8:53282229-53282251 AAGGAGAAGGAGGAAAACGAGGG - Intergenic
1041180110 8:55238396-55238418 GAGGAGGAGGAGGAAAAGGAAGG + Intronic
1041273208 8:56129956-56129978 CAGGAGATGGAGAAGAAGGAAGG + Intergenic
1041392361 8:57358445-57358467 CAGGAGGAGGAGAGAGAGGAGGG + Intergenic
1041529971 8:58854521-58854543 CAATGGAAGGAGAAGAAGGTGGG + Intronic
1041682070 8:60604136-60604158 CAGGAGAAAGAGAAAGAGGTGGG - Intronic
1041838748 8:62246210-62246232 GAAAAGAAGGAAAAAAAGGAAGG + Intergenic
1042076670 8:65003246-65003268 GAGGAGAAGGAGGAAGAGGAAGG + Intergenic
1042685746 8:71438657-71438679 GAGCAGATGGAGAGAAAGGAAGG + Intronic
1042893982 8:73645801-73645823 CAGGAGGAAGAGAGAAAGGAGGG + Intronic
1042942189 8:74118755-74118777 AAGGAGAAGGAGAAGGAGGAGGG - Intergenic
1043050351 8:75377550-75377572 CAGTAGTAGGGGAAAATGGAAGG - Intergenic
1043115602 8:76250045-76250067 GAGAAGAAGGAGGAAGAGGAAGG - Intergenic
1043132050 8:76473657-76473679 TTGGAGAAGGAGGAAAAGGAGGG - Intergenic
1043665000 8:82799329-82799351 GAGGAGGAGGAGAAAATGGAGGG + Intergenic
1044041070 8:87368923-87368945 CATGAGAAGGAAAAGAAGGAGGG - Intronic
1044252895 8:90024892-90024914 TTGTATAAGGAGTAAAAGGAAGG + Intronic
1044315244 8:90743218-90743240 CAGTAGAAAGGGACAAAGAATGG - Intronic
1044538889 8:93388222-93388244 AAGTGGAAGAAGAAAATGGAGGG + Intergenic
1045195967 8:99930867-99930889 CAGTTGGAGAAGAAAAGGGAAGG + Intergenic
1045985640 8:108246717-108246739 GAGGAGGAGGAGTAAAAGGAGGG - Intronic
1046015600 8:108601126-108601148 AAGAAGAAGGAGAAGGAGGAGGG + Intergenic
1046186616 8:110729759-110729781 AGGTAGAAGGAGGAGAAGGAGGG + Intergenic
1046233104 8:111383698-111383720 CAGTAGATCCAGAAAAAGCATGG - Intergenic
1046292590 8:112182283-112182305 GAGGAGGAGGAGGAAAAGGAAGG - Intergenic
1046321776 8:112587665-112587687 GAGTATTAGGAGAAAAAAGAAGG - Intronic
1046461178 8:114538333-114538355 CAGTAGATGCAGGAAGAGGAGGG + Intergenic
1046668095 8:117027200-117027222 GAATACAGGGAGAAAAAGGAGGG + Intronic
1046731262 8:117728785-117728807 CAGGAAAAGGAGAACAAGGATGG - Intergenic
1046825415 8:118685521-118685543 CAATAAAAGGGCAAAAAGGAAGG - Intergenic
1046827107 8:118703411-118703433 TTGTTGAAGGAGAAAAAGGTCGG + Intergenic
1046890516 8:119416588-119416610 CAGGAGATGGAGAAGCAGGAAGG - Exonic
1047099672 8:121663037-121663059 CAGAAGAAAGAGAGAAAGGTGGG + Intergenic
1047568487 8:126072785-126072807 AAGAAAAAGGAGAAAAAGAAGGG + Intergenic
1047626063 8:126657327-126657349 CAGTAAAAGGAAACAAAGAAGGG - Intergenic
1047868018 8:129050314-129050336 GACAAGGAGGAGAAAAAGGAGGG - Intergenic
1047874991 8:129126296-129126318 AAGAAGAAGAAGAAAAAAGAAGG + Intergenic
1048156192 8:131955777-131955799 TTGCAGAAGGAGAAGAAGGAGGG - Exonic
1048517449 8:135123800-135123822 CAGGAGAAGAAGGAAAGGGAAGG - Intergenic
1049041893 8:140118759-140118781 GAGTAGAAAAAGACAAAGGAAGG + Intronic
1049614236 8:143569230-143569252 CATGAGAGGGAGAAACAGGAGGG + Intronic
1050014129 9:1215449-1215471 CAGGAGGAGGAGGAAAAGGAAGG + Intergenic
1050302206 9:4271034-4271056 GAGGAGAAGGAGGAAGAGGAAGG - Intronic
1050940979 9:11457140-11457162 AAGTAGAAAGAGAAAAAGCTAGG + Intergenic
1051240985 9:15055486-15055508 CAGAAGAGGGAGAAAGAGAAAGG + Intergenic
1051464672 9:17364308-17364330 GAGCAGAAGGAGGTAAAGGAAGG - Intronic
1051749964 9:20330538-20330560 CAGTTCAAAGAGAAAGAGGAGGG + Intergenic
1052036826 9:23692144-23692166 CAGAAAAAGGAAAAAAAGGGGGG + Exonic
1052066241 9:24024122-24024144 CTGTAGAAGGGGAAAAACGTAGG - Intergenic
1052186984 9:25609905-25609927 TAGAAGAAGGAGGAAAATGAGGG + Intergenic
1052241128 9:26275075-26275097 CACTAAAAGGAGATAAAGGGTGG - Intergenic
1052607623 9:30724698-30724720 CAGGAGAAGAAAAAAAAGAAAGG + Intergenic
1052743384 9:32415717-32415739 CAAAAGAGGGAGAGAAAGGAGGG - Intronic
1052994511 9:34544070-34544092 GAGGAGGAGGAGGAAAAGGAGGG + Intergenic
1053037827 9:34840535-34840557 AAGAAGAAGAAGAAGAAGGAAGG - Intergenic
1053184959 9:36008230-36008252 GAGGAGAAGGAGAAGGAGGAGGG - Intergenic
1053540110 9:38964952-38964974 CAGTAGGAGGGGAAGGAGGAAGG + Intergenic
1053804460 9:41787109-41787131 CAGTAGGAGGGGAAGGAGGAAGG + Intergenic
1054140824 9:61528353-61528375 CAGTAGGAGGGGAAGGAGGAAGG - Intergenic
1054626030 9:67398969-67398991 CAGTAGGAGGGGAAGGAGGAAGG - Intergenic
1054865795 9:69999738-69999760 CAGTCATAGGATAAAAAGGATGG - Intergenic
1055113740 9:72585512-72585534 CAATACAAGAAGAAAAGGGAAGG + Intronic
1055280496 9:74668744-74668766 GAGGAGAAGGAGGAAGAGGAGGG + Intronic
1055707475 9:79022133-79022155 CACTAGAAGCCGAAAAAGTAAGG - Intergenic
1056124751 9:83524229-83524251 TTGTAAAAAGAGAAAAAGGAAGG - Intronic
1056283235 9:85062762-85062784 CCATAAAAGGACAAAAAGGAAGG - Intergenic
1056482952 9:87024303-87024325 CAGTAGCAAGAGAAAGAGAAGGG + Intergenic
1056515078 9:87342647-87342669 CTGGAGAAAGAGAAAAAGAAAGG + Intergenic
1057403885 9:94750227-94750249 CAGTAGCTGGAGAGAAAAGAAGG - Intronic
1058556404 9:106173312-106173334 AAGAAGAAGGAGAACAAGAAGGG - Intergenic
1058669696 9:107350491-107350513 TACTAGAAAGAGTAAAAGGAAGG + Intergenic
1058760383 9:108125202-108125224 CAGTAGAAGGAGGAAAAAGGGGG + Intergenic
1058779337 9:108317669-108317691 AAATAGAAGCAGAAAAAGAATGG + Intergenic
1058894260 9:109386210-109386232 CAGGAGAGGGAGGAAAAGGGAGG + Intronic
1059311427 9:113391198-113391220 CAATACAAACAGAAAAAGGAAGG - Intronic
1059619253 9:115985252-115985274 ATGTAGAAGGAGAAAACTGAGGG - Intergenic
1059663096 9:116420812-116420834 GAGGAGAAGGAGGAAGAGGAGGG + Intergenic
1059692101 9:116695595-116695617 CAGGAGAAGGAGGAAGTGGAGGG - Intronic
1059944229 9:119391483-119391505 CAAAAGAAGCAAAAAAAGGAGGG + Intergenic
1059986150 9:119822663-119822685 CAGTGGCAAGAGAAAAATGAGGG - Intergenic
1060168014 9:121436041-121436063 AAGTTGAAGGAGAAAAATGTAGG - Intergenic
1060255613 9:122027145-122027167 CAGGAGCAAGAGAGAAAGGAGGG + Intronic
1060769810 9:126324555-126324577 AAGAAGAAGAAGAAGAAGGAAGG + Intergenic
1061476659 9:130872106-130872128 CTGCAGAAGGAAAAAAACGAAGG - Intronic
1061961791 9:133992427-133992449 GAGTAGGAGGAGGAAGAGGAGGG - Intronic
1062092580 9:134686221-134686243 AAGGAGAAGGAGAAGGAGGAAGG - Intronic
1062638406 9:137503569-137503591 AAGGAGAAGGAGAAGGAGGAGGG + Intronic
1203656900 Un_KI270753v1:6757-6779 AAGAAGAAAGAGAAAAAAGAAGG + Intergenic
1185501716 X:601800-601822 AAAGAGAAGAAGAAAAAGGAAGG - Intergenic
1185501748 X:602078-602100 AAAGAGAAGAAGAAAAAGGAAGG - Intergenic
1185504972 X:625227-625249 GAGTAGAAGGAGGAGGAGGAGGG - Intronic
1185666366 X:1768470-1768492 AAGTGGAAGGAGGAAAAGAATGG + Intergenic
1185773527 X:2784107-2784129 AAATAGCAGGAGAAAAAGGTGGG - Intronic
1185802834 X:3029141-3029163 GAGGAGGAGGAGGAAAAGGAAGG - Intronic
1185840078 X:3381154-3381176 GAGCAGGAGGAGGAAAAGGAGGG - Intergenic
1185948692 X:4406311-4406333 GAGGAGAAGGAGGAAGAGGAGGG + Intergenic
1186064102 X:5742947-5742969 GAGGAGAAGGAGGAGAAGGAGGG + Intergenic
1186071482 X:5826014-5826036 GAGTAGGAGGAGGAAGAGGAGGG + Intergenic
1186072904 X:5842106-5842128 AAGCAGAAGCAGAAACAGGAGGG + Intronic
1186459946 X:9740034-9740056 CAGGAGAAGGAGAAAGTGGGAGG + Intronic
1186813449 X:13212490-13212512 GAGTAGAAGGACAGGAAGGAAGG + Intergenic
1186988422 X:15041081-15041103 GAGAAAAAAGAGAAAAAGGATGG - Intergenic
1187025797 X:15434169-15434191 AAGAAGAAGGAGGAGAAGGAAGG + Intronic
1187025825 X:15434363-15434385 AAGGAGGAGGAGAAAAAAGAAGG + Intronic
1187072872 X:15905660-15905682 CAGATAAAGGAGAAAAAGGCTGG - Intergenic
1187073544 X:15912006-15912028 CAACAGAAGGGGAAGAAGGAGGG - Intergenic
1187167544 X:16818543-16818565 AAGGAGAAGGAGAAAAAAGATGG - Intronic
1187563548 X:20425690-20425712 CAATTGAAGGAGGGAAAGGAGGG - Intergenic
1187656023 X:21474648-21474670 CAGTAGCTGGAGAAAAAAGTGGG + Intronic
1188036461 X:25322941-25322963 GAGAAAAAGGAGAAAGAGGAAGG - Intergenic
1188096068 X:26023491-26023513 TAGTAGAAGGAAATAAATGATGG + Intergenic
1188156399 X:26748296-26748318 CTGGAGAAGGAGGAAGAGGAGGG + Intergenic
1188687508 X:33086829-33086851 CGATAGAGGGAGATAAAGGAAGG + Intronic
1189118028 X:38363745-38363767 CAGTAGAAGGAAGAAAATGAAGG + Intronic
1189300125 X:39946513-39946535 CATGAGAAGGAGGAAAGGGAAGG - Intergenic
1189407949 X:40742790-40742812 CAAAAGAAGAAGAAAAAGAAGGG + Intergenic
1189420464 X:40852735-40852757 AAGTAGAAGCTGAAAGAGGAAGG + Intergenic
1189534599 X:41923507-41923529 CGGGAGGAGGAGAAAGAGGAGGG - Intergenic
1189540246 X:41979985-41980007 CAGAAGGAACAGAAAAAGGAAGG + Intergenic
1189645890 X:43131021-43131043 CAGAAGCAGGAGAAAGAAGAAGG + Intergenic
1189709704 X:43796555-43796577 AAGGAGGAGGAGAAAGAGGAGGG + Intronic
1190023615 X:46902396-46902418 GAGAGAAAGGAGAAAAAGGAAGG + Intergenic
1190048010 X:47128002-47128024 CAGGAGAAGGAGAGAGAGGTAGG + Intergenic
1190417053 X:50190528-50190550 CAGTTCAGGGAGAAATAGGAAGG + Intergenic
1190445075 X:50515696-50515718 CAGTTGAAGCAGAAAAGAGAAGG + Intergenic
1190522141 X:51291194-51291216 CAGTAGAAAGAGAGAAAAGAAGG - Intergenic
1191171439 X:57451499-57451521 CAGTAGAAGAAAACAAAGGAAGG + Intronic
1191838356 X:65489558-65489580 CAGTGGAAGAAGAAAAGGCAAGG - Intronic
1191840368 X:65509461-65509483 CAGAACAAGGAGTAGAAGGAAGG - Intergenic
1191882970 X:65860670-65860692 CTGGAGAAGTAGACAAAGGATGG + Intergenic
1192039503 X:67603478-67603500 TAGGAGAAGGTGAAGAAGGAAGG + Intronic
1192447790 X:71223569-71223591 CAGTAGCAGGAAAGGAAGGATGG - Intronic
1192560484 X:72124853-72124875 CAGTAGAAGGGTGACAAGGATGG - Intergenic
1192874130 X:75210635-75210657 CAGCCAAAGGAGAATAAGGAGGG + Intergenic
1193291603 X:79779580-79779602 AAGGAAAAGGAGGAAAAGGAGGG - Intergenic
1193364489 X:80615281-80615303 CAGTTGAATAAGAAAATGGAGGG - Intergenic
1193584137 X:83299983-83300005 CAGTAGAAGGAGGAAAAGTACGG - Intergenic
1194009988 X:88549599-88549621 TAGGAGGAGGAGAAAAACGAAGG - Intergenic
1194859940 X:98985600-98985622 CAGGAGAAAGAGAAAGAAGAGGG + Intergenic
1195457564 X:105085988-105086010 GAGGAGAAGGAGGAAGAGGAGGG + Intronic
1195891924 X:109704759-109704781 GGGTAGAGGGAGAAACAGGATGG + Intronic
1195995000 X:110722805-110722827 CAGTGGAAGGAGAGAAATCAGGG + Intronic
1196011647 X:110894427-110894449 CTGAAGAAGAAGAAAAAGGAAGG + Intergenic
1196065446 X:111459144-111459166 GAGGAGAAGGAGAAAGAGGAGGG - Intergenic
1196101722 X:111853858-111853880 CAGGAGAAGCATAAAGAGGAAGG + Exonic
1196221677 X:113118383-113118405 CAGTAACAGGAACAAAAGGAGGG + Intergenic
1196340097 X:114585004-114585026 GAGTGGGAGGAGAGAAAGGAGGG + Intronic
1196364413 X:114907702-114907724 CAAAAGAAAGAGAGAAAGGAAGG - Exonic
1196491292 X:116270378-116270400 AAGTAGACTGAGAAAAAGGTAGG - Intergenic
1196731105 X:118942311-118942333 AAGGAGAAGGAGAAGAAAGAAGG + Intergenic
1196964184 X:121037817-121037839 GAGGAGGAGGAGAAAGAGGAGGG - Intergenic
1197293238 X:124685490-124685512 CAGTAGGAGGAACGAAAGGAAGG + Intronic
1197537174 X:127705173-127705195 GAGGAGGAGGAGGAAAAGGAGGG + Intergenic
1197882470 X:131181349-131181371 CAGAAGGAAGAGAAACAGGAAGG - Intergenic
1198671223 X:139083176-139083198 TAGGAGGAGGAGAAAAAGAAAGG - Intronic
1198708576 X:139476673-139476695 AAGTAGAAGGTGGAAAAGGTTGG + Intergenic
1199066749 X:143428309-143428331 TAGTGGAGGGAGAAAAAGGGAGG - Intergenic
1199250912 X:145660419-145660441 CAGGAGGAAGAGAAAAAGGCGGG - Intergenic
1199701887 X:150385632-150385654 GAGGAGAAGGAGGAAGAGGAAGG + Intronic
1199751549 X:150824131-150824153 GAGGAGGAGGAGAAGAAGGAAGG + Intronic
1200379708 X:155822197-155822219 CAGAAGAAGGAGAAGGAGAAGGG + Intergenic
1200686456 Y:6263948-6263970 CAGATCAAGGAGAAAGAGGATGG + Intergenic
1200827590 Y:7660084-7660106 CAGAAGGAGGAGGAAAAGGTTGG + Intergenic
1200830053 Y:7680498-7680520 GCCAAGAAGGAGAAAAAGGATGG - Intergenic
1200976654 Y:9218743-9218765 AAGTTGAAGGAGAAAAGGCAGGG - Intergenic
1201274894 Y:12287625-12287647 AAGTAGAAGGGGAGAAAGGGAGG + Intergenic
1201461675 Y:14232565-14232587 AAGAAGAAGCAGAAGAAGGAAGG - Intergenic
1202099397 Y:21290116-21290138 CAGGAGAAAGAGAAAAATGCAGG + Intergenic
1202594133 Y:26519504-26519526 CAGGAGAAGGAGAAAGATGGGGG - Intergenic