ID: 928222086

View in Genome Browser
Species Human (GRCh38)
Location 2:29412284-29412306
Sequence AATTCAGGAAGGCATCTTGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 577
Summary {0: 1, 1: 0, 2: 9, 3: 54, 4: 513}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
928222081_928222086 10 Left 928222081 2:29412251-29412273 CCAAATAGCACTTCTCCATTTCA 0: 1
1: 0
2: 3
3: 16
4: 217
Right 928222086 2:29412284-29412306 AATTCAGGAAGGCATCTTGGAGG 0: 1
1: 0
2: 9
3: 54
4: 513
928222082_928222086 -5 Left 928222082 2:29412266-29412288 CCATTTCACTGAGACAGCAATTC 0: 1
1: 0
2: 2
3: 18
4: 248
Right 928222086 2:29412284-29412306 AATTCAGGAAGGCATCTTGGAGG 0: 1
1: 0
2: 9
3: 54
4: 513

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
928222086 Original CRISPR AATTCAGGAAGGCATCTTGG AGG Intronic
900089267 1:912588-912610 GATCCAGGAAGGCTTCGTGGAGG + Intergenic
900157075 1:1207409-1207431 AATCCAGGGAGGCTTCCTGGTGG - Intergenic
900759748 1:4462876-4462898 AACTCAGGAAGGGCTCTGGGGGG + Intergenic
901917874 1:12513772-12513794 AATTCAGCAAGCCGTCTTGCAGG + Intergenic
902106911 1:14045159-14045181 AATTCAGGAAGGGCTCTTCTGGG - Intergenic
902268877 1:15288946-15288968 AGTCCAGGAAGGCTTCCTGGGGG + Intronic
902293169 1:15448039-15448061 AATCCAGGATGGCTTCCTGGAGG + Intronic
902398111 1:16143385-16143407 AAGGCAGGTAGGCATCCTGGTGG - Intronic
902836010 1:19047247-19047269 AATCCAGGAAGACTTCTTGTGGG - Intergenic
902954332 1:19914637-19914659 AATTCGGGAAGGCTTGGTGGAGG + Intergenic
903047025 1:20572425-20572447 AGTTAAGGAGGGCCTCTTGGAGG + Intergenic
903154845 1:21436442-21436464 AAATCAGGAAGGCTTCTTGTAGG + Intergenic
903346015 1:22684792-22684814 ACGTCAGGAAGGCTTCTTGGAGG - Intergenic
903377451 1:22875831-22875853 AGTTCAGGAGGGCATCTCGGAGG + Intronic
903603237 1:24556831-24556853 GATTCTGGAAGGCCCCTTGGAGG + Intronic
903668785 1:25023299-25023321 GAATCAGGGAGGCTTCTTGGAGG - Intergenic
903828969 1:26163677-26163699 CATTCAGGACGGCTTCCTGGAGG - Intergenic
904086438 1:27912701-27912723 ACTTCAGGAAAGCATCTTGAAGG - Intronic
904248259 1:29203647-29203669 AATCCAGGAAGGCTTCATGAAGG - Intronic
904501334 1:30914508-30914530 AATCTAGGAAGGCTTCATGGTGG + Intergenic
904695747 1:32330261-32330283 AGGTCAGGAAGGCTTCCTGGAGG + Intronic
904809477 1:33153988-33154010 AATCCAGGAAGGCTTCTCAGAGG + Intronic
905016718 1:34782872-34782894 TTTTCAGCAAGGCAGCTTGGAGG - Intronic
905458303 1:38103756-38103778 AATGAAGGTAGGCTTCTTGGAGG + Intergenic
905870118 1:41398746-41398768 AATTCAGAAAGGCAACTATGAGG - Intergenic
905953710 1:41974678-41974700 GGTTCAGGAAGGCTTCCTGGAGG - Intronic
906306896 1:44725171-44725193 CATTCAGGCGGACATCTTGGCGG + Exonic
906532983 1:46533923-46533945 AGTTCAGGTAGGCTTCCTGGAGG - Intergenic
906947362 1:50306380-50306402 AATTCAGGCAGGAACCTAGGGGG - Intergenic
907214641 1:52851895-52851917 AAATTAGGAAGGCATGGTGGCGG - Intronic
907476539 1:54709740-54709762 AGTCCAGGAAGGCTTCCTGGAGG + Intronic
907514793 1:54986707-54986729 AACCCAGGAAGGCTTCCTGGAGG + Intronic
907667978 1:56449977-56449999 GATTAAGGAAGACTTCTTGGAGG + Intergenic
907729592 1:57053176-57053198 AAGTGAGGAAAGAATCTTGGCGG + Intronic
907806558 1:57826412-57826434 CATTAGGGAAGGCTTCTTGGTGG + Intronic
907884424 1:58579778-58579800 TATTAGGGAAGGCATCTTGGAGG - Intergenic
907932703 1:59015380-59015402 AATTCAGGAAGGCTTCATAGAGG - Intergenic
907947531 1:59149027-59149049 AATCAAGGAAGGCTTCTTGAAGG - Intergenic
908137325 1:61146577-61146599 AATTCAGGAAGGCTCCTTGGAGG - Intronic
909752370 1:79178778-79178800 AATTCTGGAAGGATTCTTGAGGG + Intergenic
910455908 1:87397081-87397103 CATTTAGGAAGGCTTCCTGGAGG + Intergenic
910461705 1:87454499-87454521 AAATGAGTAAGGCATTTTGGAGG - Intergenic
912866425 1:113261743-113261765 AATTAGGGAAGGCTTCATGGAGG + Intergenic
913432397 1:118809444-118809466 AATTCAGGAAAGCAACTTACTGG - Intergenic
913616658 1:120566700-120566722 TACTCAGAAAGGCAGCTTGGAGG - Intergenic
914055357 1:144163744-144163766 AAACCAGGAAGGCATCCTTGTGG + Intergenic
914318925 1:146540794-146540816 AAATGAGTAAGGCATTTTGGAGG - Intergenic
914495432 1:148192563-148192585 AAATGAGTAAGGCATTTTGGAGG + Intergenic
914573617 1:148944211-148944233 TACTCAGAAAGGCAGCTTGGAGG + Intronic
915064526 1:153213691-153213713 AATCAAGGAAGGCTTCATGGAGG + Intergenic
915515637 1:156410915-156410937 AGCTCAGGAAGGCTTCCTGGAGG - Intronic
915632557 1:157163521-157163543 AAAGCAGGAAGGCATCTTGGAGG - Intergenic
916267538 1:162905647-162905669 TGTTTAGGAATGCATCTTGGAGG + Intergenic
916338093 1:163695694-163695716 TATTCAGGAAAGCATTGTGGAGG - Intergenic
916563929 1:165956856-165956878 CATTCAGGAAGGCCTCTTGGAGG + Intergenic
919221851 1:194639879-194639901 AGCTCATGAAGGCAGCTTGGAGG + Intergenic
919392495 1:197004828-197004850 AACTCACCTAGGCATCTTGGTGG - Exonic
919784661 1:201251611-201251633 AATCAAGGAAGGCTTCATGGTGG + Intergenic
920382244 1:205541945-205541967 GATTAAGGAAGGCTTCCTGGAGG - Intergenic
921998399 1:221447177-221447199 AATTGAGGAAGACTTCGTGGAGG + Intergenic
922594169 1:226800963-226800985 AATCAAGGAAGGCTTCCTGGAGG - Intergenic
922767326 1:228162855-228162877 AGTCCAGGAAGGCTTCTTGGAGG + Intergenic
922899141 1:229122895-229122917 AAGGCAGGAATGCATCGTGGAGG - Intergenic
923120060 1:230981564-230981586 AGTTCAGGTAGACATCATGGTGG - Intronic
923517300 1:234708577-234708599 AATTCAGGAAGAGATTTGGGTGG + Intergenic
924142934 1:241045228-241045250 AATTCAGGAACACATTTTGGAGG - Intronic
924435515 1:244036968-244036990 AATTCAGGACAGCATGTGGGAGG - Intergenic
1063472666 10:6300783-6300805 AACCCAGGAAGGAATCTAGGAGG - Intergenic
1064107594 10:12513182-12513204 CATTCAGGAAGGCCTCTTGTTGG - Intronic
1064279240 10:13936174-13936196 AATCCAGGAAAGCTTCCTGGAGG + Intronic
1064330923 10:14393176-14393198 AAGTCAGGAAGGCTTCCTTGTGG - Intronic
1064833002 10:19492412-19492434 AATTCAGGAAGGGCTCTTCTGGG + Intronic
1065753119 10:28906747-28906769 AATCCAGGATGGTTTCTTGGAGG - Intergenic
1066003154 10:31123374-31123396 AATTCAGTAAGGCATCTCAGGGG + Intergenic
1066208115 10:33209624-33209646 AAATCAGCCAGGCATGTTGGTGG - Intronic
1066578769 10:36856873-36856895 AATTCAAGATGACATTTTGGTGG + Intergenic
1067778327 10:49178690-49178712 TATCCAGGAAGGCTTCCTGGAGG - Intronic
1067975124 10:51016016-51016038 AAGTCAGGAAAGTTTCTTGGAGG + Intronic
1068990635 10:63146921-63146943 AATTCAGAAATAGATCTTGGGGG + Intronic
1069099572 10:64302642-64302664 AATGAATGAAGGCAGCTTGGAGG + Intergenic
1069660801 10:70122253-70122275 ATTCCATGAGGGCATCTTGGAGG - Intronic
1070811782 10:79301742-79301764 AGTTCTGGAAGGCTTCCTGGAGG + Intronic
1071749658 10:88460428-88460450 AATCTGGGAAGGCCTCTTGGAGG - Intronic
1071940917 10:90590623-90590645 TGTTCAGGTAGGCATATTGGTGG - Intergenic
1072417122 10:95258218-95258240 AATTCAAGATGGGATCTCGGCGG + Intronic
1072514354 10:96164578-96164600 ATTTCATGAAGTCATCTTTGAGG + Intronic
1072833087 10:98680028-98680050 AATTTAGAAAAGCATCTTAGAGG + Intronic
1073010751 10:100357539-100357561 GATTCCTGAAGGCATGTTGGGGG - Intronic
1073318694 10:102600615-102600637 AGTTAGGGAGGGCATCTTGGAGG + Intronic
1073340058 10:102737569-102737591 AAATCAGGAGGGCTTCTTGGAGG + Intronic
1073562940 10:104512317-104512339 CAGTCAGGAAGGCTTCTTGGAGG - Intergenic
1075077167 10:119359210-119359232 AATCCAGGAAGGCTTCCTGGAGG + Intronic
1075155553 10:119973673-119973695 AATTCAGGAAGACAGCTTTGAGG - Intergenic
1075244663 10:120810540-120810562 AAGTCAGGGAGGCTTCCTGGAGG - Intergenic
1075846702 10:125550868-125550890 CATCCAGGAAGGCTTCCTGGAGG - Intergenic
1076314002 10:129527996-129528018 AGTCCAGGAAGGCTTCCTGGAGG - Intronic
1076820918 10:132939157-132939179 AATCAAGGAAGGCTTCCTGGAGG + Intronic
1078054843 11:8000052-8000074 AAATTAGCCAGGCATCTTGGAGG + Exonic
1079673533 11:23198251-23198273 AATTCAAGAAGGGATTTGGGTGG + Intergenic
1079786931 11:24684897-24684919 AATCCAGGAAGGCTGCATGGAGG - Intronic
1080276729 11:30511464-30511486 AATCCAGGAAGGTGTCTTTGAGG + Intronic
1081747484 11:45483209-45483231 AGTTAAGGGAGGCTTCTTGGAGG + Intergenic
1081759567 11:45567837-45567859 AATCCTGGAGGGCATCCTGGAGG - Intergenic
1081765719 11:45608657-45608679 AATTGGGGAAGGCTTCATGGGGG - Intergenic
1081881688 11:46458342-46458364 AATTCAGGAAAGCTTCTGGGAGG - Intronic
1082138502 11:48578578-48578600 AATTCAGGAAAACGTTTTGGAGG - Intergenic
1082590641 11:55004703-55004725 AATTCACGAAGGGATATTTGGGG - Intergenic
1082612377 11:55316784-55316806 AATTCAGGAAAACCTTTTGGGGG - Intergenic
1082833024 11:57633590-57633612 AATCCACGAAGGCTTCCTGGAGG - Intergenic
1082833181 11:57634498-57634520 AATCCAAGAAGGCTTCCTGGAGG - Intergenic
1083380090 11:62260204-62260226 CAGTAAGGAAGGCTTCTTGGAGG + Intergenic
1084204227 11:67582459-67582481 AATTCAGCAAGGGATTTTTGTGG - Intergenic
1084266606 11:68008386-68008408 AAATCAGGGACCCATCTTGGCGG - Intergenic
1084955398 11:72688662-72688684 TTATCAGGAAGGCTTCTTGGAGG - Intronic
1084962728 11:72725834-72725856 AATCTTGGAAGGCTTCTTGGAGG - Intronic
1085313191 11:75528191-75528213 AGTTCAGGAAGGCTTCTCGGAGG - Intergenic
1085451988 11:76639678-76639700 AATTCTGGAAGGCATTCTGTAGG - Intergenic
1086009642 11:82085080-82085102 AATTAATGAAGGCATGTTGTTGG + Intergenic
1086090985 11:83004563-83004585 ACTTCAAGAAGGCATCATAGGGG + Intronic
1086218554 11:84412861-84412883 ATTCCAGGAAGTTATCTTGGAGG - Intronic
1086856076 11:91867769-91867791 AATCCTGGAGGGCATCTGGGTGG - Intergenic
1088896930 11:114085609-114085631 GATTCAGGAGGGCTTCATGGAGG + Intronic
1089220913 11:116870785-116870807 AATTAAGGAAGGCATCCTGGAGG + Intronic
1089364155 11:117910798-117910820 CAATCAGGAAGGCTTCCTGGAGG - Intronic
1089391772 11:118107122-118107144 AATCAAGGAAGGCTTCCTGGAGG + Intronic
1089634221 11:119802035-119802057 AGTTCAGGAGGGCTTCCTGGAGG + Intergenic
1089690422 11:120183700-120183722 AATCCAGGAGGGCCTCTTGGAGG - Intronic
1089955597 11:122568225-122568247 AAATTAGCCAGGCATCTTGGTGG + Intergenic
1090189146 11:124757092-124757114 CAATGGGGAAGGCATCTTGGAGG + Intronic
1090216820 11:124974533-124974555 AATTTAGGAAGGCTTCTTGGAGG + Intronic
1091302219 11:134514946-134514968 AATCAAGGAAGGCTTCCTGGGGG - Intergenic
1091394564 12:145928-145950 AATGCAGGAAGGCAGCTTCTGGG + Intronic
1091654199 12:2333385-2333407 AAGTCAGGATGGCAGCGTGGGGG - Intronic
1092030959 12:5284691-5284713 AATTCCGAAAGTCATCTAGGAGG - Intergenic
1092099184 12:5869234-5869256 AGTCCAGAAAGGCTTCTTGGAGG - Intronic
1092496993 12:9006298-9006320 AGTTAAGGAAGGCCTCTTTGGGG + Intronic
1092726746 12:11494013-11494035 AGTTAAGGAAGGCATCTTATGGG - Intronic
1093214710 12:16349054-16349076 ATTTCCTGAAGGCATCGTGGTGG - Intronic
1093956244 12:25221997-25222019 AATTTAGCAAGGCATGGTGGCGG + Intronic
1095079129 12:37975661-37975683 AATCCAGGAAGGGATATTTGGGG + Intergenic
1095247306 12:39937949-39937971 AATTCAGGAAAGAATCATGATGG - Intronic
1096390351 12:51223952-51223974 TATACAGGAAGCCTTCTTGGAGG - Intergenic
1096462331 12:51828966-51828988 AGATCCGGAAGGAATCTTGGGGG - Intergenic
1096464751 12:51842145-51842167 AAATGAGGAAGGCAGCTGGGAGG - Intergenic
1096467173 12:51853039-51853061 AGTTAGGGAAGGCATCCTGGAGG - Intergenic
1096599003 12:52716109-52716131 AATTCATGAAGACTTCCTGGAGG - Intergenic
1096850865 12:54435525-54435547 AATTAATGAATGCTTCTTGGAGG - Intergenic
1098137933 12:67422296-67422318 GATTAAGGAAGGCTTCCTGGAGG + Intergenic
1098292818 12:68974025-68974047 AATTCAGGGCGGCATCTAGAGGG + Intergenic
1098327221 12:69315665-69315687 AATTCAAGATGGCATTTGGGTGG + Intergenic
1099166974 12:79318713-79318735 AATTCAGGGAAGCACCTTGTCGG - Intronic
1099287820 12:80736988-80737010 AATTTAGGAAAGCATCTATGTGG - Intergenic
1099769040 12:87029194-87029216 AATTCAAGATGAGATCTTGGTGG + Intergenic
1099788865 12:87304234-87304256 AATCTAGGAAGGCATCTAGGTGG - Intergenic
1100121632 12:91375350-91375372 AATTCAGGAAGGGTTCAGGGAGG + Intergenic
1101207929 12:102507461-102507483 AATTCAAGATGAGATCTTGGTGG - Intergenic
1101876798 12:108601380-108601402 AATGCAGGAAGCCCACTTGGTGG + Intergenic
1102042768 12:109811144-109811166 AATCCAGGAGGGCTTCTTGGAGG - Intronic
1102392875 12:112563640-112563662 AATCCAGCAAGGAGTCTTGGGGG - Intergenic
1102895007 12:116591973-116591995 AGTTCAGACAGGCTTCTTGGAGG - Intergenic
1103265330 12:119625015-119625037 AATTCAGGAACTCACCTTGCTGG + Intronic
1103559936 12:121788396-121788418 AAGCCAGGAAGGCAACCTGGAGG - Intronic
1103710078 12:122906001-122906023 AATTGAGGCAGGCATGTTAGAGG - Intergenic
1104421541 12:128640044-128640066 AAATCAGCAAGGCCTATTGGAGG + Intronic
1105047507 12:133017440-133017462 ATTCCAGGACTGCATCTTGGAGG - Exonic
1105831498 13:24166345-24166367 GATCCAGGAAGGCTTCCTGGAGG + Intronic
1107016962 13:35715109-35715131 AATGCAGGTAGGAATTTTGGAGG - Intergenic
1107367146 13:39693379-39693401 AATTCTGGAAGGCAGCTGGCCGG + Intronic
1108041021 13:46339394-46339416 AGTTCAGGAAGGCTTCCTGCAGG + Intergenic
1109435229 13:62290992-62291014 AGTTCAGGATGACATCTGGGTGG - Intergenic
1109681153 13:65755285-65755307 AATTCAGGATGGGATTTGGGTGG - Intergenic
1109702892 13:66049232-66049254 AATTCAAGATGAGATCTTGGTGG + Intergenic
1111969036 13:94891385-94891407 AATTAAGAAAGGAATTTTGGGGG + Intergenic
1112114538 13:96337806-96337828 AATTCAGGAATCAATCTAGGTGG - Intronic
1112775199 13:102836249-102836271 AAAACAGGAAAGCATCTTTGAGG - Intronic
1112786763 13:102960001-102960023 AATTCAGAAAGGAATTGTGGTGG + Intergenic
1112851294 13:103709452-103709474 AATGCAGAAAGGCATTTTGGGGG - Intergenic
1113181681 13:107635490-107635512 AATTCAGGATGAGATTTTGGTGG + Intronic
1113399928 13:109981987-109982009 GAGTCAGGAAAGCATCTAGGTGG - Intergenic
1115541832 14:34428075-34428097 AATTCAAGATGACATTTTGGTGG - Intronic
1118128090 14:62931770-62931792 AATTAGGGAAGGCATCTGGAGGG - Intronic
1118213867 14:63789887-63789909 AATTCAGGAGTGGATCCTGGAGG + Intergenic
1118581682 14:67306491-67306513 AATTCAGCCAGGCATGGTGGCGG - Intronic
1118752208 14:68815768-68815790 AATCCAGGAAGGCTTCCTGGTGG + Intergenic
1119784146 14:77299972-77299994 AATCCAGGAAGGCCTCTGGAAGG - Intronic
1121383249 14:93493113-93493135 AAGTCAGGAGGGCTTCTTTGAGG + Intronic
1121568859 14:94931317-94931339 CATTCAGGAAGGCTTCCTGGAGG - Intergenic
1121634801 14:95446644-95446666 AATTCAGGAAGGCTTCCCAGAGG + Intronic
1121638862 14:95472085-95472107 AATCCAGGAAGGCTTTGTGGAGG + Intronic
1122114492 14:99520880-99520902 TGTTCAGGAAGGCTTCCTGGAGG - Intronic
1122122984 14:99564465-99564487 AAATCAGGAAGGCTCCATGGAGG - Intronic
1122407209 14:101507693-101507715 GATCCAGGAAGGCTTCCTGGAGG + Intergenic
1122523791 14:102365348-102365370 AATTTATGAAGGCTTCCTGGTGG + Intronic
1122848818 14:104515615-104515637 CATCCAGGAAGGCTTCCTGGAGG + Intronic
1127575061 15:60283731-60283753 AATTGAGGAAGGAAGCTTGAAGG + Intergenic
1127645785 15:60957664-60957686 AGGTCAGGAAGGCTTCCTGGAGG + Intronic
1127731744 15:61808315-61808337 AATTAAGGAAGGGTTCTTGGAGG - Intergenic
1128094497 15:64943725-64943747 AGGTCAGGAAGGCTTCCTGGAGG - Intronic
1128155576 15:65389628-65389650 AATCCAGGAAGGTTTCCTGGAGG - Intronic
1128301092 15:66566656-66566678 AATCCAGAAAGGCTTCCTGGAGG - Intergenic
1128347467 15:66863586-66863608 AATTCAGGGAGTCTTCCTGGAGG - Intergenic
1128551401 15:68600288-68600310 CATTGAGGAAGGCTTCCTGGAGG - Intronic
1128673205 15:69590043-69590065 AACACAGGAAGACAGCTTGGAGG - Intergenic
1128683313 15:69666789-69666811 AATCCAGGAGGGCATTTTGGAGG + Intergenic
1129178614 15:73857464-73857486 AGCTCAGGAGGGCACCTTGGAGG - Intergenic
1129272661 15:74427710-74427732 AATCAAGGAAGGCTTCCTGGGGG - Intronic
1129313976 15:74729988-74730010 AATCCAGGAAGGCATCCCAGAGG - Intergenic
1129698271 15:77752951-77752973 CAGTCAGGAAGGCTGCTTGGAGG - Intronic
1131175910 15:90209717-90209739 GATCCAGGAAGGCCTCCTGGAGG + Intronic
1131391142 15:92049776-92049798 CATTCAGGAAGACATCTGGGAGG + Intronic
1131395236 15:92080491-92080513 AATCTAGGAAGGCCCCTTGGAGG + Intronic
1131670215 15:94611802-94611824 AATCCAGGAAGGCTTCCTAGAGG + Intergenic
1132094096 15:98969334-98969356 GATACAGGATGGCTTCTTGGAGG + Intronic
1132466971 16:81940-81962 CATTCAGGAGGGCTTCCTGGAGG - Intronic
1132732554 16:1370054-1370076 CAGTCAGGACGGCATCTGGGAGG + Intronic
1132836997 16:1959114-1959136 AATCCAGGAAAGCTTCCTGGAGG + Intergenic
1134177987 16:12024092-12024114 CATTCAGGAAGGCTTCCTGGAGG + Intronic
1135489767 16:22899233-22899255 AATTCAGGCAGGAAACTGGGAGG + Intronic
1135553449 16:23416177-23416199 AAATCAGGTAGGCATGATGGTGG - Intronic
1136987749 16:35126770-35126792 ATTTCAGGAAGGCAATTTGCAGG - Intergenic
1137397434 16:48126036-48126058 AGTTCACGGAGGCCTCTTGGAGG - Intronic
1137397564 16:48126937-48126959 AGTTCACGGAGGCCTCTTGGAGG + Intronic
1138233597 16:55360165-55360187 AAGTCGGGAAGGCTTCCTGGAGG - Intergenic
1138526862 16:57613740-57613762 AATTAGGGAAGGCTCCTTGGAGG - Intronic
1138551287 16:57750068-57750090 AATCCAGGAAGGCTTTATGGAGG - Intronic
1140327089 16:74015003-74015025 AATTCAGGATGACATTTGGGTGG - Intergenic
1140841211 16:78840955-78840977 AATTTGGAAAGGCATTTTGGTGG + Intronic
1140906104 16:79410681-79410703 AATGCAGGAAGGCTGCATGGAGG + Intergenic
1141666033 16:85465636-85465658 GAGTCTGGAAGGCTTCTTGGAGG - Intergenic
1141684813 16:85564173-85564195 AATCCAGGAAGGCTTCCTGGAGG + Intergenic
1142142846 16:88480207-88480229 CATCCAGGAAGGCTTCCTGGAGG - Intronic
1144126554 17:12207888-12207910 CTTCCAGGAAGACATCTTGGAGG - Intergenic
1144619349 17:16807055-16807077 GATTAAGGAAGGCTTCCTGGAGG - Intergenic
1144893344 17:18508650-18508672 GATTAAGGAAGGCTTCCTGGAGG + Intergenic
1145138882 17:20435642-20435664 GATTAAGGAAGGCTTCCTGGAGG - Intergenic
1146173754 17:30651744-30651766 ACTTCAGGGAGGCTTCCTGGAGG - Intergenic
1146347210 17:32067765-32067787 ACTTCAGGGAGGCTTCCTGGAGG - Intergenic
1147947612 17:44088812-44088834 AATCCAGGAAGGCTTGCTGGAGG - Intronic
1148098602 17:45072707-45072729 AAATTAGGCAGGCATCGTGGCGG - Intronic
1148240994 17:45999183-45999205 AATCCAGGAAGACTTCCTGGAGG - Intronic
1148335070 17:46835571-46835593 AAGTCAGGGAGGCTTCCTGGAGG - Intronic
1148628094 17:49085765-49085787 AATGCAGGTAGGCTTCCTGGAGG - Intergenic
1148746520 17:49921203-49921225 AATTCAGGAGGGCTTCTTGGAGG + Intergenic
1148788444 17:50158585-50158607 AATTCTGGAAGGTCTCCTGGTGG - Intergenic
1149123874 17:53204118-53204140 AATTCAGTATGACATTTTGGTGG + Intergenic
1150276833 17:63903847-63903869 AATCAAGGAAGGCTTCCTGGAGG + Intergenic
1151183330 17:72345472-72345494 AGTCCAGGAAGGCTTCATGGAGG + Intergenic
1151295708 17:73184791-73184813 GGTTCAGGCAGGCTTCTTGGAGG + Intergenic
1151398543 17:73840997-73841019 AACCCAGGAAGGCTTCCTGGAGG + Intergenic
1152405418 17:80095510-80095532 ACTCCAGGAAGGCGTCTTGCTGG + Intronic
1154302090 18:13203215-13203237 AAGTCAGGGAGGCATCTTGGAGG - Intergenic
1155022788 18:21911816-21911838 CATTCAGGAAGACATCTTAGGGG + Intergenic
1155156552 18:23162663-23162685 AGTCAAGGAAGGCTTCTTGGAGG + Intronic
1155285512 18:24284887-24284909 ATTTAAGGAAGGCTTCCTGGGGG - Intronic
1155335694 18:24763381-24763403 AATGCAGGCTGGCATCTTAGTGG - Intergenic
1157187217 18:45550969-45550991 TAATCAGGAAGGCTTCATGGAGG + Intronic
1157212330 18:45754284-45754306 AATTCAGCAAGCCAACTGGGAGG + Intergenic
1157274250 18:46298946-46298968 AATTCAGGAAGGCTTCATGGAGG - Intergenic
1157481941 18:48060682-48060704 AATTCAGGAAGGTTTCCTGGAGG - Intronic
1158882297 18:61792126-61792148 AATTAAGGGAGGCTTCTTGGAGG - Intergenic
1159286952 18:66366413-66366435 AATTCAGGATGAGATTTTGGTGG - Intergenic
1159287176 18:66369428-66369450 AATTCAGGACGAGATTTTGGTGG + Intergenic
1159693316 18:71520314-71520336 AATTCAGGAAAGCAGATAGGTGG + Intergenic
1159697250 18:71575407-71575429 AATTCAAGATGGGATTTTGGTGG + Intergenic
1161390179 19:4016634-4016656 CAGTCAGGAAGGCCTCCTGGAGG + Intronic
1161489844 19:4555869-4555891 TATCCAGGAAGGCTTCCTGGAGG + Intronic
1161532976 19:4801282-4801304 AATCCAGGAAGACTTCATGGAGG - Intergenic
1161636607 19:5393251-5393273 AAATCAGGCGGGCTTCTTGGAGG - Intergenic
1161653104 19:5497337-5497359 AAATCAGGAGGGCTTCCTGGAGG + Intergenic
1161935934 19:7372240-7372262 GAGTCAGGAAGGCAACCTGGAGG + Intronic
1162180242 19:8863806-8863828 AATTAAGGAGGGCTTCCTGGAGG - Intronic
1162279301 19:9682313-9682335 AATTCAGCCAGGCATGGTGGTGG - Intergenic
1162988663 19:14288296-14288318 ACTTCAGGGAGGCTTCCTGGAGG + Intergenic
1163163361 19:15479087-15479109 AAGTAGGGAAGGCTTCTTGGAGG - Intronic
1163241385 19:16065959-16065981 AATCCAGGAAGGCTTCCTAGAGG + Intergenic
1163241512 19:16066809-16066831 AATCCAGGAAGGCTCCCTGGGGG + Intergenic
1163738969 19:18999072-18999094 CTTTCAGGAAGGCTGCTTGGAGG + Intronic
1164414216 19:28032799-28032821 AATTCAAGATGAGATCTTGGTGG + Intergenic
1164669253 19:30063472-30063494 AATCCAGGAAGGCTGCCTGGAGG - Intergenic
1164681324 19:30135584-30135606 AAGTCAGGGAGGCTTCTTGGAGG - Intergenic
1164921758 19:32093638-32093660 AAGTGAGGAAGGCTTCCTGGAGG + Intergenic
1165037442 19:33043991-33044013 AATTCAGTCAGCCATCTTGATGG - Intronic
1165461818 19:35948433-35948455 GATTGAGGAAGGCTTCCTGGAGG + Intergenic
1165896803 19:39146332-39146354 AATCAAGGAAGGCCTCCTGGAGG + Intronic
1166619108 19:44279901-44279923 AATTCAAGATGACATCTGGGTGG - Intronic
1167052298 19:47086667-47086689 CATCTAGGAAGGCTTCTTGGAGG - Intronic
1167095693 19:47373879-47373901 AATCCAGGAGGGCTTCCTGGAGG + Intronic
1167237505 19:48323795-48323817 AATCAGGGAAGGCCTCTTGGAGG - Intronic
1167324043 19:48813172-48813194 AAATCAGGAAGGGATATCGGGGG + Exonic
1167660097 19:50791346-50791368 AGTTTAGGAGGGCAGCTTGGAGG - Intronic
1167695410 19:51012844-51012866 AATTCAGGAAGGCCTCCCGGAGG + Exonic
1168233099 19:55045517-55045539 AAGCCAGGAAGGCTCCTTGGGGG - Intronic
1168693774 19:58393603-58393625 AATCCAGGAAGGCTTCCTAGAGG - Intronic
1202694840 1_KI270712v1_random:116421-116443 AAACCAGGAAGGCATCCTTGTGG + Intergenic
925881561 2:8357207-8357229 AGGGCAGGAAGGCTTCTTGGAGG - Intergenic
926492338 2:13539915-13539937 AATTAAGGAAAGCTTCTTGACGG + Intergenic
926834666 2:17005094-17005116 AGTCCAGGAAGGTATGTTGGAGG - Intergenic
927295148 2:21445202-21445224 AACTCAGGCAGGTTTCTTGGTGG + Intergenic
927474914 2:23405835-23405857 AATCCAGGAAGGCTTCATGGGGG + Intronic
928222086 2:29412284-29412306 AATTCAGGAAGGCATCTTGGAGG + Intronic
928355545 2:30611021-30611043 AATTAAGGGAGGAATATTGGGGG - Intronic
928550725 2:32367869-32367891 AAATCAGGGATGCATCTTAGAGG + Intronic
929686407 2:44039079-44039101 AAGTTAGGAAGGCCTCTTGGAGG + Intergenic
930525098 2:52519196-52519218 AATTCAGGATGAGATCTGGGTGG - Intergenic
932354881 2:71060392-71060414 CAGTCAGGAAGGCTTCCTGGAGG - Intergenic
932410602 2:71545080-71545102 AATCAAGGAAGGCTTCTAGGAGG + Intronic
932417834 2:71584382-71584404 CCTTCAGGAAGGCTTCCTGGAGG - Intronic
932598935 2:73111290-73111312 AATCCAGGAAGGCTTGCTGGAGG - Intronic
932737531 2:74264867-74264889 ATTTCTGGATGGCATTTTGGAGG + Intronic
933045725 2:77534302-77534324 GATCCAGCAAGGCATCTTTGGGG - Intronic
933071195 2:77860051-77860073 AATTCAGGATGAGATTTTGGTGG - Intergenic
933680411 2:85094964-85094986 AAGTAAGGGAGCCATCTTGGAGG - Intergenic
934718709 2:96558236-96558258 AAGCCAGGAAGGCTTCCTGGAGG - Intergenic
935070667 2:99690988-99691010 AAGTAAGGAATGCATGTTGGAGG + Intronic
936520232 2:113207372-113207394 ACTTAGGGAAGGCCTCTTGGAGG - Intronic
937349406 2:121150903-121150925 AATCAAGGAAGGCTTCCTGGAGG - Intergenic
937435673 2:121879149-121879171 AAATCAGCCAGGCATGTTGGTGG - Intergenic
937558177 2:123185845-123185867 AATTGAGGAAGGGATGTTGAAGG - Intergenic
937635210 2:124147839-124147861 AATTCATCAATGCATCTAGGTGG + Intronic
938207870 2:129439257-129439279 AGTCCAGGAAGGCTTCTTGGAGG + Intergenic
938556351 2:132428185-132428207 AGTCCAGGCAGGCTTCTTGGAGG - Intronic
938641284 2:133283133-133283155 AATTTGGGAATGCATTTTGGTGG + Intronic
939676792 2:145082435-145082457 AAATCAGCCAGGCATGTTGGTGG + Intergenic
940673500 2:156699852-156699874 AATTCAGGCAGGCAACTCAGAGG - Intergenic
941564538 2:167090119-167090141 ACTTACTGAAGGCATCTTGGGGG + Intronic
944351868 2:198737464-198737486 AATTCTTCTAGGCATCTTGGTGG + Intergenic
945140413 2:206680370-206680392 AATTCAGGATGGGATTTGGGTGG + Intronic
945230775 2:207587241-207587263 AATTCAGCCAGGCATGGTGGCGG + Intronic
945612349 2:212019611-212019633 AATTCAGCCAGGCATGGTGGCGG + Intronic
946283977 2:218688696-218688718 GATCCTGAAAGGCATCTTGGAGG + Exonic
948441176 2:237990609-237990631 AAATCAGCCAGGCATCATGGTGG + Intronic
1169012409 20:2261409-2261431 ACTCCAGGAAGGCTTCCTGGGGG + Intergenic
1169195544 20:3680517-3680539 AATCAAGGAGGGCTTCTTGGAGG - Intronic
1169558098 20:6770002-6770024 AAGCCAGGAGGGCATCCTGGAGG + Intronic
1169682717 20:8233723-8233745 AATTCAGGAAGGGAGCAGGGTGG - Intronic
1171425731 20:25047380-25047402 TAGTCAGGAAGGCCTCTTGGAGG - Intronic
1172548056 20:35777125-35777147 AACTCAGGAAGACTTCTTTGAGG - Intronic
1172774930 20:37401768-37401790 AATCAAGGCAGGCTTCTTGGAGG - Intronic
1172785084 20:37463440-37463462 AAATTAGCCAGGCATCTTGGCGG - Intergenic
1172814815 20:37678082-37678104 AATCAGGGAAGGCTTCTTGGAGG - Intergenic
1172891626 20:38270009-38270031 AACTCCGTGAGGCATCTTGGGGG + Intronic
1173258823 20:41415182-41415204 ACTTCAGGCGGGAATCTTGGTGG - Exonic
1173981620 20:47228687-47228709 TCTTCAGGAAGGCAACCTGGTGG - Intronic
1174323828 20:49763251-49763273 AATCAAGGAAGGCCTCTTGGGGG - Intergenic
1174685036 20:52446482-52446504 GATTCAGGCAGACATCATGGTGG + Intergenic
1174751843 20:53118754-53118776 ACACCAGAAAGGCATCTTGGTGG + Intronic
1175053706 20:56178594-56178616 AGTCTAGGAAGGCTTCTTGGAGG - Intergenic
1177822442 21:26046139-26046161 AATTCAAGAAGAGATCTGGGTGG + Intronic
1178135356 21:29621103-29621125 AATTTAGGAAGGCACATTGTTGG - Intronic
1179171961 21:38980118-38980140 AATCTAGGAAGGCTTCTTGCAGG - Intergenic
1180028990 21:45189136-45189158 AATTCAAGATGGGATTTTGGTGG + Intronic
1180069287 21:45428071-45428093 CAGTCAGGAAGGCTTCATGGAGG - Intronic
1180600492 22:17012286-17012308 ACATCAGGAGGGCTTCTTGGAGG + Intergenic
1181047086 22:20220276-20220298 AAGCCAGGAAGGCTTCCTGGAGG - Intergenic
1181264269 22:21621236-21621258 AGGTCAGGAAGGCTTCCTGGAGG + Intronic
1181554308 22:23658984-23659006 AACTCAGGATGGCAGTTTGGTGG - Intergenic
1181640119 22:24191795-24191817 AAGTCAAGGAGGCATCGTGGAGG + Intergenic
1181728026 22:24825079-24825101 AGTCCAGGAAGGCTTCTAGGAGG + Intronic
1182088805 22:27580125-27580147 AGTCAAGGAAGGCTTCTTGGAGG - Intergenic
1182099088 22:27645370-27645392 AGTCCAGGAAGGCTTCCTGGTGG - Intergenic
1182115017 22:27751425-27751447 AAGTCAGGAATGCTTCCTGGAGG + Intronic
1183270821 22:36861618-36861640 CTGTCAGGAAGGCTTCTTGGAGG - Intronic
1184098202 22:42327995-42328017 AAGTCAGGGAGGCTTCCTGGAGG - Intronic
1184263062 22:43330373-43330395 AATTCAGGAGGGCTTCTTAGAGG - Intronic
1184493355 22:44823311-44823333 AATCCAGGAAGACTTCTAGGAGG + Intronic
1184518784 22:44979917-44979939 AATTTAGCCAGGCATCATGGCGG + Intronic
1184583354 22:45431318-45431340 GAGTCAGGAAGGCTTCCTGGAGG + Intronic
1184753853 22:46505110-46505132 AAATCAGCAAGGCATGGTGGCGG + Intronic
1185070886 22:48655026-48655048 AATCCAGGAAGGCTTCCTGGAGG + Intronic
1185316287 22:50180620-50180642 GATCCAGGAAGGCTTCCTGGAGG + Intergenic
949791340 3:7795977-7795999 ATAGAAGGAAGGCATCTTGGGGG + Intergenic
950126203 3:10511235-10511257 AATCAAGGAAGGCTTCATGGAGG - Intronic
950663679 3:14482274-14482296 AATAAAAGAAGGCATCTGGGTGG - Intronic
952638914 3:35567822-35567844 ATCTGGGGAAGGCATCTTGGAGG - Intergenic
952921264 3:38285429-38285451 AATTCAGGAAACCATCTCTGAGG - Intronic
953125974 3:40092277-40092299 CAGCCAGGAAGACATCTTGGGGG - Intronic
953747408 3:45585647-45585669 AAGTAAGGAAGGCATCTGAGAGG - Intronic
954200191 3:49019450-49019472 AATTCTGGAAGCCATCATGATGG - Intronic
954283772 3:49603189-49603211 AAAGCAGGAAGGCATCAGGGTGG - Intronic
954734715 3:52696812-52696834 AATTCAGGGAGGGACTTTGGTGG - Intronic
955120022 3:56048930-56048952 TATTCACGAAGACCTCTTGGAGG + Intronic
956128823 3:66036520-66036542 GATTCTGGAGGGCTTCTTGGAGG + Intronic
956542502 3:70357295-70357317 AACTCAGGAAAGCATCTTTTTGG + Intergenic
957956805 3:87197623-87197645 AACCCAGGAAGGCATCTAGCAGG + Intergenic
958045818 3:88282455-88282477 AATTCTGGAAGGAAGGTTGGTGG + Intergenic
959207761 3:103334195-103334217 AATTCAGGATGAGATTTTGGTGG - Intergenic
960942761 3:122945438-122945460 AATCCAGGAACGCTTCCTGGAGG - Intronic
961043986 3:123696310-123696332 ACAACAGGAAGGCATCCTGGAGG + Intronic
962052276 3:131829232-131829254 AATTCAGGATGACATTTGGGTGG + Intronic
965781112 3:172287094-172287116 CAATCAGGAAGGCATCTTAGAGG - Intronic
965915567 3:173842274-173842296 AATTCAAGATGACATTTTGGTGG + Intronic
967086697 3:186101592-186101614 TGTTCAGGAAAGCATCTGGGAGG - Intronic
967888664 3:194349748-194349770 TAGTCAGGAAGGCTTCATGGGGG - Intronic
968235772 3:197029448-197029470 AAGTCTGGAAGGCTTCTTGGAGG - Intronic
968244933 3:197135256-197135278 AATTCAGGATGACATTTGGGTGG - Intronic
968267754 3:197375830-197375852 AACTCAGGAAGGCATCATGTAGG - Intergenic
968280931 3:197476212-197476234 AACCCAGGAAGGCTTCCTGGAGG - Intergenic
968854576 4:3109953-3109975 TCCTTAGGAAGGCATCTTGGAGG + Intronic
969307252 4:6332889-6332911 AGATCAGGGAGGCTTCTTGGAGG - Intronic
969316638 4:6385490-6385512 TATCCAGGAAGGCTTCCTGGAGG - Intronic
969453743 4:7289314-7289336 AATCCAGGAAGGCTTCCTGGAGG - Intronic
969636908 4:8374600-8374622 AATACTGGAAGGCTTCCTGGAGG - Intronic
970026321 4:11627684-11627706 AATTCAAGATGGGATTTTGGTGG + Intergenic
970946413 4:21698055-21698077 GATTCAGGAAGGCTACATGGGGG + Intronic
971342325 4:25781978-25782000 CAGCCAGGAAGGCTTCTTGGAGG - Intronic
974985293 4:69016764-69016786 AACTCAGTAAGGCTTCCTGGGGG - Intronic
977501617 4:97846645-97846667 AACACAGGAAGGCAACATGGAGG + Intronic
978756800 4:112311631-112311653 AAGTCAGGAAGGCACCTTGAAGG - Intronic
978916855 4:114136954-114136976 GATTCAGGAATGCAACTAGGAGG - Intergenic
979532610 4:121785146-121785168 ATATCAGGAAGGCATGTTTGTGG - Intergenic
979707620 4:123739356-123739378 AATTCAGGATGGCAGCGGGGTGG + Intergenic
980657134 4:135803828-135803850 AATGAAGGAAAGAATCTTGGTGG - Intergenic
980924053 4:139116485-139116507 AATTCAGCAAACTATCTTGGAGG + Intronic
980953794 4:139408064-139408086 AAGTGAGGAACGCTTCTTGGAGG + Intronic
982387411 4:154825413-154825435 TATTCAGGAAGACATCTAGCTGG - Intronic
982397412 4:154927120-154927142 ACCTCAGAAAGGCATCTTTGGGG + Intergenic
982612995 4:157601029-157601051 AACTCAAGAAGGCATATTAGAGG + Intergenic
982855056 4:160371246-160371268 AATTCAAGATGGGATTTTGGTGG + Intergenic
983006226 4:162489210-162489232 AATTCAAGAAGAGATTTTGGTGG - Intergenic
984033246 4:174631817-174631839 ATTTCACTAAGGCTTCTTGGTGG - Intergenic
984363923 4:178773889-178773911 AATTTAGGAATACATGTTGGTGG - Intergenic
984922122 4:184774474-184774496 CATTCAGGAAGGAGTCTTAGAGG - Intronic
985071730 4:186172176-186172198 CTTTCAGCAAGGCAGCTTGGTGG - Exonic
986008321 5:3686667-3686689 AATTCAAGAAGAAATTTTGGTGG + Intergenic
988164036 5:27560388-27560410 AGGTCAGATAGGCATCTTGGTGG + Intergenic
989181096 5:38577956-38577978 AATTTAAGAAGGCACCATGGAGG - Intronic
989334739 5:40302424-40302446 ATTTCAGAAAGTCATCTTGTGGG - Intergenic
989523543 5:42427517-42427539 AATTCAAGATGGCATTTGGGTGG + Intronic
989547263 5:42689023-42689045 AAATCAGAAAGGCATGATGGTGG - Intronic
989654090 5:43725749-43725771 AAGTGAGGAAGGCATCTTGAAGG - Intergenic
990056525 5:51587492-51587514 AATTGAGCAAGACGTCTTGGAGG + Intergenic
992273309 5:75088316-75088338 AATTCAGGGAGGCATCCGGATGG + Intronic
992748497 5:79841376-79841398 TAATCAGGAAGGCTTCATGGAGG - Intergenic
993362162 5:86991040-86991062 AATTCAAGATGACATCTGGGTGG - Intergenic
994609172 5:102014454-102014476 TCTTCTGGAAGGCATGTTGGGGG - Intergenic
994805383 5:104440669-104440691 AATTCAGGATGTAGTCTTGGTGG - Intergenic
996852510 5:127968196-127968218 CATTCAGATAGGCAGCTTGGAGG + Intergenic
997196619 5:131984706-131984728 AATCAAGGAAGGCTTCCTGGGGG - Intronic
997395218 5:133554172-133554194 CATTCAGGCAGGCTGCTTGGTGG + Intronic
997891404 5:137680171-137680193 GATTCAGGAAGGTATCTTCTGGG - Intronic
998320692 5:141226978-141227000 AATTTAGCTAGGCATCGTGGCGG - Intergenic
998946239 5:147342389-147342411 AAATCAGGAAGGCTTCCTGCAGG + Intronic
999324970 5:150638209-150638231 AATCCAGGAAGTCTTCCTGGAGG - Intronic
999648718 5:153744925-153744947 CAGTCAGGCAGGCTTCTTGGAGG + Intronic
1000015467 5:157271966-157271988 AAATCAGCAAGCCACCTTGGTGG + Intronic
1000079740 5:157833551-157833573 AGTTAAGGAAGGTTTCTTGGAGG - Intronic
1000829632 5:166086571-166086593 AATTCAGAAAAGCATATTGGAGG - Intergenic
1001476777 5:172056191-172056213 AATCGGGGAAGGCTTCTTGGAGG - Intronic
1002089978 5:176798656-176798678 ACTTCAGGGTGGGATCTTGGAGG - Intergenic
1002486337 5:179539854-179539876 AAATCAGCCAGGCATGTTGGCGG + Intergenic
1002966281 6:1969725-1969747 GGTCCAGGAAGGCCTCTTGGGGG - Intronic
1003175346 6:3749901-3749923 AAATCAGGAAAGCATCGTGAAGG - Intronic
1003732081 6:8836602-8836624 AATCCAAGAAGGCTTCCTGGAGG + Intergenic
1004468251 6:15905657-15905679 AATTAAGAAGGGCAGCTTGGAGG + Intergenic
1004922440 6:20388539-20388561 AGTCTAGGAAGGCTTCTTGGAGG - Intergenic
1006281401 6:33056738-33056760 AATTTAGAAAGGCTTCTAGGAGG + Intergenic
1006375982 6:33671862-33671884 AACCCAGGAAGGCTTCCTGGAGG - Intronic
1006501787 6:34464045-34464067 CATCCAGGAAGGCTTCCTGGAGG - Intergenic
1006643515 6:35500681-35500703 GGGTCAGGAAGGCTTCTTGGAGG - Intronic
1006795275 6:36728466-36728488 AACCCAGGAAGGCTTCCTGGGGG + Intronic
1006807911 6:36800414-36800436 GAATCAGGAAGGCTTCCTGGAGG - Intronic
1007102336 6:39257897-39257919 AATTTAGGAAGGCCTCTTGAAGG - Intergenic
1007102571 6:39259882-39259904 AGTCCAGGAAGGCTTCCTGGAGG - Intergenic
1007630213 6:43269349-43269371 AAGCCAGGAAGGCTTCTCGGAGG + Intronic
1008058205 6:46967198-46967220 ATTTCAGGGAGACATCTTAGAGG + Intergenic
1008110155 6:47483397-47483419 GATTCAGACTGGCATCTTGGGGG + Intronic
1008449531 6:51634681-51634703 GATTCGGGAAAGCATCCTGGAGG + Intronic
1009289383 6:61865571-61865593 AATTCAAGATGGCATCTGGGTGG + Intronic
1009596414 6:65743277-65743299 AATTCAGGAAAAAATTTTGGAGG - Intergenic
1012621277 6:101347284-101347306 TATTCAGGAAGGCTTCTGAGAGG + Intergenic
1012657129 6:101838379-101838401 AATTGATTAAGGAATCTTGGTGG - Intronic
1015596668 6:134873178-134873200 AAATTAGGAAGGCATGGTGGCGG + Intergenic
1016126595 6:140411543-140411565 AATTCAAGAAGAGATCTGGGTGG - Intergenic
1017186037 6:151601332-151601354 AATTCAAGATGGCATTTGGGTGG + Intronic
1017205384 6:151799739-151799761 AATCAAGGAAGGCTTCCTGGTGG + Intronic
1017913264 6:158813240-158813262 AGGTCAGGAAGGCATCCTTGAGG - Intronic
1021364513 7:19760278-19760300 AAATCAGGAAAGCATCTCTGAGG - Intronic
1021929054 7:25561610-25561632 AAATCAGGAAGGCCTCTGGGAGG + Intergenic
1022503516 7:30896874-30896896 AATCCAGGAGGGCTTCTTAGAGG - Intergenic
1024425051 7:49215824-49215846 AATTCAGGGGGGCAGCATGGGGG + Intergenic
1024455181 7:49597832-49597854 CATCCAGGAAGGCTCCTTGGAGG + Intergenic
1024718769 7:52110687-52110709 TCTTCAGGATGGCATGTTGGAGG - Intergenic
1026464775 7:70644706-70644728 GATTCTGGAAGGCTTCATGGAGG - Intronic
1026891430 7:73985086-73985108 GATCAAGGAAGGCTTCTTGGAGG + Intergenic
1026898008 7:74021746-74021768 CAATCAGGAAGGCTTCCTGGAGG - Intergenic
1027120472 7:75515242-75515264 AAATTAGGCAGGCATCATGGTGG + Intergenic
1027717137 7:81686592-81686614 AAATCAGCAAGGCATAGTGGCGG + Intergenic
1028191852 7:87862979-87863001 AATTCAAGATGAGATCTTGGTGG + Intronic
1028689373 7:93634448-93634470 AATTCTGGAGGTCACCTTGGGGG - Intronic
1029624633 7:101712847-101712869 AGTTCAGGAGGACATCCTGGAGG + Intergenic
1029717243 7:102336667-102336689 AAATTAGGCAGGCATCATGGTGG - Intergenic
1031097309 7:117435658-117435680 ACTCCAGGAAATCATCTTGGGGG - Intergenic
1031313303 7:120226968-120226990 AATTCAAGATGGCCTCTTGTAGG - Intergenic
1031379864 7:121072235-121072257 AAGTGAGGAAGGCATCCTAGGGG - Intronic
1031524628 7:122809429-122809451 AATTTAGGCAGGCATGGTGGTGG + Intronic
1031998372 7:128247664-128247686 GAATCAGGGAGGCATCATGGAGG - Intronic
1032145951 7:129380888-129380910 AATTTAGGCAGGCATGGTGGTGG - Intronic
1032472354 7:132187690-132187712 GATTCCAGAAGGCAGCTTGGGGG - Intronic
1032715767 7:134507943-134507965 ATTTCAGTATGGCATCTTGATGG - Intergenic
1034221235 7:149447747-149447769 AAGTCAGAAAGGCCTCTTGGAGG - Intronic
1034539602 7:151748353-151748375 AAGTCAGAAAGGCATTTTAGGGG + Intronic
1034550280 7:151816033-151816055 TATTCAGGAAGGCTTCCTAGAGG + Intronic
1034627027 7:152501563-152501585 AATCCAGGAAGCCTTCATGGAGG - Intergenic
1035413032 7:158660761-158660783 AATTCAGGAGGACATTTGGGTGG - Intronic
1036443211 8:8799604-8799626 AAATCAGCCAGGCATGTTGGCGG + Intronic
1037437706 8:18880763-18880785 AATTCAGGAAGGCTCGCTGGAGG - Intronic
1038220892 8:25606523-25606545 AATTCCAGAAGGCAGCCTGGCGG + Intergenic
1038631131 8:29245071-29245093 AATTGAAGAAGGCTTCTTGAAGG - Intronic
1038982064 8:32770766-32770788 AAATCAGGAAGGAAACTTGGAGG - Intergenic
1044219969 8:89659023-89659045 AATTCAGAAAGGCCTTGTGGAGG - Intergenic
1044797623 8:95920383-95920405 AATTCCAGAAGGCTGCTTGGAGG + Intergenic
1045497369 8:102719764-102719786 GAGTCAGGATGGGATCTTGGCGG + Intergenic
1046570527 8:115959920-115959942 CATTTAGGAAGCCATTTTGGAGG + Intergenic
1047539152 8:125747344-125747366 AATTCAAGAGGCCTTCTTGGTGG - Intergenic
1047546924 8:125827076-125827098 AATTCAAGATGACATTTTGGTGG + Intergenic
1047925069 8:129674656-129674678 AATTTAAGAAGGCATCCTAGTGG - Intergenic
1047969338 8:130071339-130071361 AATTCCTGAGGGCATCATGGGGG + Intronic
1048017782 8:130512938-130512960 AATTCAGGAAGGCTTCCTGGAGG + Intergenic
1048163896 8:132045115-132045137 AATTAAAGAAGGCCTCCTGGTGG + Intronic
1048385902 8:133912346-133912368 AGTCCAGGAAGGCTTCCTGGGGG + Intergenic
1048414660 8:134212683-134212705 AATTCAAGATGGTATCTGGGTGG + Intergenic
1048851651 8:138651158-138651180 CAATCAGGAAGTCTTCTTGGAGG - Intronic
1049053129 8:140214801-140214823 AATGGAGGAAGGCATCTTTCTGG + Intronic
1049152453 8:141044034-141044056 AATCCAGGAAGGCTTACTGGGGG + Intergenic
1049153027 8:141047906-141047928 AATCCAGGAAGGCTTACTGGAGG - Intergenic
1049443832 8:142621096-142621118 AGGTCAGGAAGGCTTCCTGGAGG - Intergenic
1050462756 9:5891157-5891179 TATTCAGGATGGCATCTTGCTGG + Intronic
1051490535 9:17659174-17659196 AATACAGGAAGGGACCTTAGTGG - Intronic
1051539344 9:18196902-18196924 AGTTCTGGAAGGCTTCTTTGAGG - Intergenic
1051968999 9:22863931-22863953 AATACTGGGAGGCATTTTGGAGG - Intergenic
1051978640 9:22985784-22985806 ATTTCAGTACAGCATCTTGGTGG + Intergenic
1052050620 9:23844102-23844124 TATTCAGGAAGGCTTCTCAGTGG - Intergenic
1052363286 9:27583006-27583028 AATCCAGGAAGACTTCATGGAGG - Intergenic
1052917527 9:33935030-33935052 TATTCAGGAAGGCAAATGGGTGG - Intronic
1053303954 9:36970768-36970790 CATGAAGGAAGGCATCCTGGAGG - Intronic
1055552139 9:77441159-77441181 AATTCAGGATGACATTTGGGTGG - Intronic
1056455817 9:86758753-86758775 AATTCAAGAATGATTCTTGGTGG - Intergenic
1056462958 9:86825819-86825841 ATTTCAGGAAGGCAACATGTGGG + Intergenic
1058111911 9:101039873-101039895 AATTCAAGAAGGGATTTTTGTGG + Intronic
1058692230 9:107529472-107529494 AATTGGGGAAGACTTCTTGGAGG - Intergenic
1058697978 9:107575974-107575996 AATCAGGGAAGGCTTCTTGGAGG + Intergenic
1058708522 9:107658129-107658151 AATTCAAGATGGCATTTGGGTGG - Intergenic
1058940007 9:109804262-109804284 TAGTCAGCATGGCATCTTGGTGG + Intronic
1059466895 9:114474629-114474651 AATTGGGGAAGGCTTCCTGGAGG - Intronic
1059472477 9:114516461-114516483 AAGTCAGGAAAGCTTCCTGGAGG + Intergenic
1059521987 9:114951407-114951429 AGTCCAGGAAGGCATCTCAGAGG + Intergenic
1059570234 9:115426351-115426373 AATTCAGGATGACATTTGGGTGG + Intergenic
1059932376 9:119273617-119273639 AACTCTGGAAGGCTTCCTGGAGG - Intronic
1059979291 9:119752061-119752083 CATTAAGGAAGGCCCCTTGGAGG - Intergenic
1060026380 9:120175604-120175626 AATGAAGGAGGGCTTCTTGGAGG + Intergenic
1060117740 9:120957492-120957514 GATTGGGGAAGGCTTCTTGGAGG - Intronic
1060267730 9:122122027-122122049 AATTCAGGAAAGCATGTTATAGG - Intergenic
1060965488 9:127710338-127710360 TATCAAGGAAGGCTTCTTGGAGG + Intronic
1061265402 9:129501900-129501922 AATCCAAGAAGGCTTCCTGGAGG + Intergenic
1061303087 9:129717544-129717566 AAATTAGCAAGGCATGTTGGTGG + Intronic
1061398639 9:130356651-130356673 AATCAAGGAAGGCTTCCTGGAGG - Intronic
1061621715 9:131814891-131814913 AATCCAGGAAGGCTTCCTGGAGG - Intergenic
1061671876 9:132193406-132193428 AAGTCAGGAGGGCCTCCTGGAGG + Intronic
1062091597 9:134681271-134681293 AATACAGGAAGGGAACTAGGAGG + Intronic
1185843266 X:3413317-3413339 AATTCAAGATGACATCTGGGTGG - Intergenic
1186214658 X:7286609-7286631 ACTTCAGGAAAACATCTAGGAGG + Intronic
1189759511 X:44306693-44306715 ACTTGAGCAAGGCATTTTGGTGG + Intronic
1190036296 X:47028268-47028290 TAGTCAGCAAGTCATCTTGGGGG - Intronic
1190736406 X:53258191-53258213 GATTCAGGAGGGCTTCTTAGTGG - Intronic
1191007796 X:55728663-55728685 AATTGAGTAAGGCTTTTTGGTGG + Intronic
1192193113 X:69007507-69007529 ATTTCAGGAGGGCTTTTTGGAGG + Intergenic
1194209030 X:91046691-91046713 AATTCAGAAAAGCATATGGGTGG - Intergenic
1194696220 X:97054513-97054535 AGTTCAGGAAGGCATCTCAAAGG + Intronic
1195959357 X:110369645-110369667 CCTCCAGGAAGGGATCTTGGTGG - Intronic
1196044693 X:111245315-111245337 AATTAGGGAAGGCTTCATGGAGG + Exonic
1196354630 X:114776121-114776143 TATTCAGGATGGAATCTTTGAGG - Intronic
1196720241 X:118847074-118847096 AATCCAGGAAAACATCTTGGAGG - Intergenic
1197101376 X:122659848-122659870 CATTAAGGAAGGGATCATGGAGG - Intergenic
1197163137 X:123345827-123345849 AATCAGGGAAGGCTTCTTGGAGG + Intronic
1198975580 X:142332501-142332523 TTTTCAAGATGGCATCTTGGAGG + Intergenic
1199619200 X:149684605-149684627 AATTCAAGATGGCATTTGGGTGG - Intergenic
1201231926 Y:11873262-11873284 AATTCAAGATGACATCTGGGTGG + Intergenic