ID: 928223436

View in Genome Browser
Species Human (GRCh38)
Location 2:29424965-29424987
Sequence CAGTGAATGCCTTTAGAATA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 229
Summary {0: 1, 1: 0, 2: 2, 3: 24, 4: 202}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
928223436_928223439 15 Left 928223436 2:29424965-29424987 CCCTATTCTAAAGGCATTCACTG 0: 1
1: 0
2: 2
3: 24
4: 202
Right 928223439 2:29425003-29425025 AGAAAAATAAAGAATTGCAGAGG 0: 1
1: 0
2: 11
3: 162
4: 1498
928223436_928223440 16 Left 928223436 2:29424965-29424987 CCCTATTCTAAAGGCATTCACTG 0: 1
1: 0
2: 2
3: 24
4: 202
Right 928223440 2:29425004-29425026 GAAAAATAAAGAATTGCAGAGGG 0: 1
1: 0
2: 9
3: 114
4: 1109

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
928223436 Original CRISPR CAGTGAATGCCTTTAGAATA GGG (reversed) Intronic
903628866 1:24750913-24750935 CAGTAAATTCCTTGAGGATAGGG + Intronic
904289155 1:29472452-29472474 CAGTGATTGCCTGGAGAAAAAGG - Intergenic
905493662 1:38365586-38365608 TTGTGAATGCCTTGAGGATAAGG - Intergenic
906098160 1:43238241-43238263 GAGTCGATGCCTTTAGAATATGG - Intronic
906926878 1:50127284-50127306 CAGGGAATGCCTTGAAAATAAGG - Intronic
908677845 1:66625862-66625884 CAAGGAAGGCCTTTGGAATACGG + Exonic
909711679 1:78657872-78657894 CAGTGAAAGCCTCTACAATTTGG + Intronic
910521320 1:88125032-88125054 CAGTAAATGACTTGACAATAAGG - Intergenic
911574648 1:99560985-99561007 CACTGTAGGCCTTTAGAAAAAGG - Intergenic
912310939 1:108620841-108620863 CAGTGAATCCCTTCAGAGCAGGG - Intronic
912486997 1:110036613-110036635 CAGTGAATGCCTGGAGGACAGGG + Intronic
912590311 1:110812230-110812252 CAGTGGTTGCCTTTAGGAGAAGG + Intergenic
913102967 1:115586353-115586375 CAGTGCCTGCCTTGAGAAAAAGG + Intergenic
914242906 1:145864067-145864089 CAGTGAATTCCTCTAAAATCTGG - Intergenic
917180216 1:172288119-172288141 CTGTGAATTCCATGAGAATAGGG - Intronic
919888445 1:201952304-201952326 CAGTAAACTCCTTTAGGATAGGG + Intergenic
920134251 1:203756759-203756781 CAGTGACTGCATCTTGAATAGGG - Intergenic
921578237 1:216863536-216863558 CAGTGAATAAGTTAAGAATAGGG + Intronic
921619948 1:217314359-217314381 CAGTGAATGCCATGAGCATGAGG - Intergenic
923285295 1:232488677-232488699 CAATGAATGTATTTAGAAAATGG - Intronic
924064073 1:240206401-240206423 CAGTGACTACCTTTAAAATTCGG + Intronic
1068856809 10:61806215-61806237 CAGTGAATTCCATGAGCATAGGG - Intergenic
1068970942 10:62957426-62957448 CAGTGAATACCTTTATATCATGG + Intergenic
1071224822 10:83516590-83516612 TTGTGAATGCTTTTAGAATAAGG + Intergenic
1071551227 10:86567737-86567759 CAGTTAATGTCTTTAGAATTAGG + Intergenic
1072452738 10:95551726-95551748 CAGTAAATTCCTTTATATTAAGG - Intronic
1073533808 10:104256030-104256052 CAGAAAATTCCTTAAGAATAGGG - Intronic
1074848071 10:117416453-117416475 CATTGATTGCCTTTGGAAAAGGG - Intergenic
1074957238 10:118404116-118404138 CAGTTAATGCTGTTAGAAAATGG + Intergenic
1075393507 10:122110653-122110675 CAGTGAATGACCTTAGACTCTGG + Intronic
1075711166 10:124531143-124531165 CAGGGAAGGCCTTGAGGATATGG - Intronic
1075978466 10:126717395-126717417 CACTGAAGGCTTTTAAAATATGG - Intergenic
1076166049 10:128283733-128283755 CAGAGAATGCCTGCAGAATGGGG - Intergenic
1077395773 11:2320438-2320460 CAGTGAAGTCCTATAGGATATGG - Intergenic
1077475420 11:2788056-2788078 CAGTGAGTGCCCATAGAATGTGG + Intronic
1078028098 11:7719113-7719135 CAGTGACTCAGTTTAGAATATGG - Intergenic
1078820141 11:14871098-14871120 AAGGTAATTCCTTTAGAATATGG + Exonic
1080556693 11:33423707-33423729 CAAAGAATGACTTTAGAATCTGG - Intergenic
1081034827 11:38130881-38130903 CAGTGTATGCTTTTAAAACAAGG + Intergenic
1081365229 11:42226810-42226832 GAGAGGATGCTTTTAGAATATGG + Intergenic
1093169781 12:15847019-15847041 CATTGGATGCCTTTAGACTCAGG + Intronic
1093898293 12:24601202-24601224 CAGGGAATGCCATTAAAATCTGG - Intergenic
1094294743 12:28892121-28892143 ATGTGAATGCCTTGAGATTAAGG + Intergenic
1094434805 12:30409697-30409719 CAGGGAATGCCTCAAAAATAAGG + Intergenic
1095478161 12:42607352-42607374 CACTGAAAGCCTTAAGAGTAAGG + Intergenic
1095681180 12:44977877-44977899 AAGTGAATTCCCTAAGAATAAGG + Intergenic
1097337683 12:58402263-58402285 CAGTGAAAGCCCAAAGAATAGGG - Intergenic
1097653715 12:62335851-62335873 CAGAGAATTTCTTTAGAAGATGG - Intronic
1098291313 12:68959142-68959164 ATGTGAATGCCATGAGAATAGGG + Intronic
1098859832 12:75695839-75695861 CAGTGAATACATTTAGGAAAAGG + Intergenic
1100213846 12:92427311-92427333 CAGTTTAAGCCTTTAGGATAAGG - Intronic
1100767317 12:97881572-97881594 CAGGGAATGCTTTTAGAAACAGG + Intergenic
1100849066 12:98690474-98690496 CAGTGAAAGACTTCAGAAGAAGG + Intronic
1101492189 12:105219967-105219989 CACAGAATGCATTTAGCATAGGG - Intronic
1101891391 12:108718870-108718892 CATTCAATACCTTTAGAAGAAGG + Intronic
1103421573 12:120789071-120789093 CAGTGGATGCCAATAGGATAAGG - Intronic
1104189003 12:126459751-126459773 CAGTGAATGCCTGGGGAATAAGG - Intergenic
1104509984 12:129368484-129368506 GAGTGAATGCTTTGAGGATAGGG + Intronic
1107419046 13:40229174-40229196 CTGTGAATTCCTTTAGAGGAGGG - Intergenic
1108317698 13:49253877-49253899 CAGTGAGGGCCTTTAGCATAAGG - Intronic
1108344712 13:49534157-49534179 CAATGAATTCCTTTAGCAGAGGG + Exonic
1110013364 13:70367111-70367133 CAGTGAGTGCCTTCAGAGGATGG - Intergenic
1110962027 13:81638745-81638767 TAATGAATGCCTGTAGATTAAGG - Intergenic
1111120429 13:83841852-83841874 CAGGGAGTGACTTTGGAATAGGG - Intergenic
1111666942 13:91281701-91281723 AAGTAAATGTCTTTACAATATGG - Intergenic
1112963290 13:105155413-105155435 AAGTGAATGCCTATGGAAAAGGG - Intergenic
1115745562 14:36433534-36433556 AAGTGAATGCCATGAGAGTAAGG - Intergenic
1116186869 14:41608766-41608788 TAGTGAAAGCTTTGAGAATATGG + Intronic
1116374739 14:44184314-44184336 CAATATGTGCCTTTAGAATAGGG + Intergenic
1118421361 14:65608531-65608553 CATTGAATTCCTTTAGAGTGGGG + Intronic
1120281703 14:82447035-82447057 CAGTAAATACCTGTAGAATCAGG - Intergenic
1120317663 14:82916809-82916831 CATTTAAGGCATTTAGAATATGG - Intergenic
1120631617 14:86898747-86898769 CAGTGAATGCATATTGAAAATGG - Intergenic
1121244488 14:92452081-92452103 GAGTGAATGCATTTAGATAAGGG + Intronic
1121937755 14:98036143-98036165 AACTAAGTGCCTTTAGAATAAGG - Intergenic
1122260118 14:100513293-100513315 TAGTTAATGCCTTTATAAAAGGG + Intronic
1124105878 15:26737473-26737495 CAATGAATGTCTTTAGGACAGGG + Intronic
1127574829 15:60281136-60281158 CAGAGAATGCCAGCAGAATATGG + Intergenic
1129104986 15:73300898-73300920 CAGTGAATGGCTTTACAGTTTGG + Intronic
1129611057 15:77057749-77057771 CAGAGAATGACTAAAGAATAAGG - Intronic
1134158590 16:11865313-11865335 CAGTGAATGCCTTGGCAAGAGGG + Intergenic
1135606925 16:23833520-23833542 CAGGGAAATCCTTTATAATATGG - Intergenic
1137066572 16:35851947-35851969 CAGTGATTGCCGTTGGAACATGG - Intergenic
1139036680 16:62955848-62955870 AAGTGAAAGCCTTTACAAAAAGG + Intergenic
1141543130 16:84742343-84742365 CTGTGAATAGCTTTAGAAAAAGG - Intronic
1141598792 16:85112953-85112975 CAGATAATGCTTTTATAATAAGG - Intergenic
1144285962 17:13775017-13775039 CAGCTGATGCCTTTAGAATAAGG + Intergenic
1144310176 17:14006557-14006579 ATGTGAATGCCTTTAAAATAGGG + Intergenic
1147025360 17:37578005-37578027 CAGGGCCTCCCTTTAGAATATGG - Intronic
1147747698 17:42705418-42705440 CAGTGAATTCCTATAGACTAAGG - Intronic
1148261073 17:46183975-46183997 CAGGGAATGGGTTTTGAATATGG - Intronic
1150912758 17:69405918-69405940 GAGAGAATTCCTTTAGAATGAGG - Intergenic
1151176639 17:72294225-72294247 CAGTGAATGCTTCTAGAACGTGG - Intergenic
1155163167 18:23211759-23211781 CAGTTAAAGCATTTAGAATTTGG + Intronic
1157299415 18:46468843-46468865 GAGTAAATGTCTTTGGAATATGG - Intergenic
1160101955 18:75929577-75929599 CGGTCAATGCCTTTAGAAGAAGG + Intergenic
1160160856 18:76469031-76469053 CATTAAATGCCTTTAAAATCGGG - Intronic
1167779912 19:51592580-51592602 AAGTGAATGCATTTAAAATAGGG - Intergenic
926843065 2:17104712-17104734 CAGTGAAGGCCTTCAGAGGAGGG + Intergenic
928223436 2:29424965-29424987 CAGTGAATGCCTTTAGAATAGGG - Intronic
928296971 2:30092072-30092094 CAGTTAATTTCTTTAGAATTGGG - Intergenic
928310587 2:30206383-30206405 CAGTGAATCATTTTAGAAAATGG - Intergenic
928399390 2:30966853-30966875 AAGTGAATGCCTTTTCAAGATGG - Intronic
929050503 2:37832693-37832715 CAGTCAATGCCTTTACAAAAAGG - Intergenic
930938937 2:56990240-56990262 CAAAGATTCCCTTTAGAATAGGG + Intergenic
933200907 2:79447454-79447476 CAGTGAATACCTAAAGAAAATGG + Intronic
933306081 2:80600191-80600213 CAGTTTATGCCTTTTGTATAGGG - Intronic
933388572 2:81642660-81642682 CAGTGAATGCATTTTCAACAAGG + Intergenic
936379966 2:111975635-111975657 CACTGAATGCTTTTACAGTATGG - Intronic
937576648 2:123430825-123430847 CAGTCCATGCACTTAGAATAGGG - Intergenic
939321765 2:140632305-140632327 CAGTGAATGATTATAGCATATGG + Intronic
942174074 2:173314228-173314250 TAGTGATTGCCTACAGAATATGG - Intergenic
942659017 2:178244527-178244549 CATTGAATGTCTTTATAAAAAGG + Intronic
942892467 2:181007964-181007986 CAGTGGATGCTTGAAGAATAAGG - Intronic
945018859 2:205550666-205550688 CAGAAAATCCCTTAAGAATAAGG + Intronic
947348777 2:229221206-229221228 CAGGGAATGCCCTTAGTATCAGG + Intronic
948083255 2:235225101-235225123 CAGTGAATGCCTTGAGTGCAGGG + Intergenic
948614675 2:239190941-239190963 CACTGCATGCTTTCAGAATAGGG - Intronic
1169105224 20:2988801-2988823 CAGTGAGTTCCTTGAGAATAGGG - Intronic
1169692855 20:8352351-8352373 CAGTGAATCTTTTTAGGATAGGG + Intronic
1170272461 20:14543110-14543132 GAATGTATGCCTTGAGAATAAGG - Intronic
1170541832 20:17396881-17396903 CAGTGAAGGCCTCTAGGAAATGG + Intronic
1173857397 20:46259059-46259081 CTGTGACTGCCTTAAGAACAGGG - Intronic
1174148276 20:48467823-48467845 CAGTGGCTGCCTTTAGAGGAAGG + Intergenic
1177918356 21:27119781-27119803 CTGTGAATTCCTTTAGCTTAAGG - Intergenic
1178548775 21:33517098-33517120 CAGTGAATGGCTGTAGATTCTGG + Exonic
1182264102 22:29099151-29099173 AAGGGAATACCTTTAGAATGAGG - Intronic
949379862 3:3432445-3432467 CTGTGACTTCCTTGAGAATAGGG - Intergenic
949957519 3:9281169-9281191 CAGTGATAGCATTAAGAATATGG + Intronic
950200442 3:11038687-11038709 GTGTGAATTCCTTTAGACTAAGG + Exonic
951244319 3:20323236-20323258 CAGTAAATGCCTCAAAAATAAGG - Intergenic
953738882 3:45519524-45519546 CAGTGACGGTTTTTAGAATATGG - Intronic
956414372 3:69012241-69012263 CAGTGGATGCCTGTAGAAAGTGG - Intronic
956543267 3:70368595-70368617 CAGTCAATGGCATTAGAAAATGG - Intergenic
957519029 3:81295083-81295105 CAGTAACAGCCTTTAAAATAAGG - Intergenic
957711810 3:83870379-83870401 CACTGTATGCCTCTAGAATTTGG + Intergenic
958618261 3:96524566-96524588 CAGAGAAAGCCTTCAGAAGATGG + Intergenic
961792710 3:129387776-129387798 CAGTGGGTGCCTTTTGGATAGGG + Intergenic
963663864 3:148157626-148157648 CAGTGACTGCCTTTGGTATATGG + Intergenic
966661204 3:182416978-182417000 CACTGAAAGTCTTTAGAAGAAGG - Intergenic
970702740 4:18762144-18762166 CAGAGAAAGCCTTTAGAATATGG - Intergenic
971546636 4:27894702-27894724 CAGTGAAAGCCATTCTAATAAGG - Intergenic
971593986 4:28504399-28504421 CCCTGAATGCATTTAAAATAAGG - Intergenic
971870417 4:32229156-32229178 CAATAAATGCTATTAGAATATGG - Intergenic
972737689 4:41860976-41860998 AAGTGAATGATTTTAAAATAGGG - Intergenic
974277061 4:59735619-59735641 TTGTGAATGCCTTTATAAAAAGG + Intergenic
976239925 4:82944222-82944244 AAGAGTATGCCTTTAGTATAAGG - Intronic
978647071 4:110947465-110947487 CAGTGAATTACTAAAGAATAAGG - Intergenic
979166428 4:117538119-117538141 CAAAGAATCCCTTTAGCATAAGG - Intergenic
979740976 4:124150764-124150786 CAGTGACTAACTTTAGATTATGG - Intergenic
979836450 4:125374510-125374532 CAATTAATGTCTGTAGAATAAGG - Intronic
980419220 4:132539426-132539448 CAGTGAAGGCCTTCAGAATTTGG + Intergenic
980495732 4:133586201-133586223 CAGGGAAGGCCTAGAGAATAGGG - Intergenic
980941160 4:139276281-139276303 CTGTGAATGGCTTGAGACTAGGG - Intronic
981802085 4:148669736-148669758 CAGTAAATACCTTTAGAAAGTGG - Intergenic
982380889 4:154745663-154745685 AAGTGTGTGCCTTTAAAATAAGG + Intronic
982623348 4:157732962-157732984 CAGTGGAGGCCTTTAGGATTTGG - Intergenic
983951217 4:173644104-173644126 CAGTGAATCCCTTTATAATCTGG - Intergenic
986377536 5:7147953-7147975 CAGTGCTTCCCTTTAGAATGTGG - Intergenic
988095753 5:26607528-26607550 CATAGAAAGACTTTAGAATAAGG + Intergenic
988149039 5:27351967-27351989 CTGTGAAGTCCATTAGAATAGGG - Intergenic
989685937 5:44087372-44087394 GACTGAATTCCTTTACAATATGG - Intergenic
989986981 5:50712637-50712659 CTGTGAATGCCTTCAGGACAGGG - Intronic
990140286 5:52695342-52695364 AAGAGAAAGCATTTAGAATAGGG - Intergenic
991171869 5:63636911-63636933 CATTGACTGCATTCAGAATATGG - Intergenic
992654437 5:78894521-78894543 CAGTGAGATCCTTTAGAATCTGG - Intronic
993227451 5:85184967-85184989 GAGTGAATGCATTTTGTATATGG + Intergenic
993916738 5:93753213-93753235 CAGTAATTGCCTCTAGAATGTGG - Intronic
994738944 5:103594388-103594410 CAGTGAAAGAGTTTGGAATATGG - Intergenic
995302838 5:110604475-110604497 CAGTAAATGCCTAGAGAAAATGG + Intronic
995904049 5:117101945-117101967 CAATGAATGTCTTTAGTATAGGG + Intergenic
997517678 5:134502483-134502505 CTTTGCATGCCTCTAGAATAGGG + Intergenic
999480210 5:151941173-151941195 CAGCAAATGCCTTCGGAATATGG - Intergenic
1003610635 6:7611743-7611765 CAGAAAATGCCCTTAGAAGACGG - Exonic
1004565008 6:16788107-16788129 CACTGACTGCCTTTAGAAGGAGG + Intergenic
1005247136 6:23900001-23900023 CAGACAAAGCCTTTAGAATTTGG - Intergenic
1005593831 6:27358199-27358221 CTCTGAATGCCTTAAGAATTTGG - Intergenic
1005852506 6:29832147-29832169 AAGATATTGCCTTTAGAATAGGG + Intergenic
1007921316 6:45612082-45612104 GAGTGAATCCATTTAGAATCTGG - Intronic
1008593918 6:53022052-53022074 CAGTAAAAGCTTATAGAATAGGG + Intronic
1011192657 6:84749056-84749078 CAGTGATTGCCTCTAGATGATGG + Intronic
1012526682 6:100186119-100186141 TAGAAAATGCCTTTAAAATAAGG + Intergenic
1014318782 6:119899347-119899369 CTGTGACTGCCTTGAGAATGTGG + Intergenic
1015658895 6:135550736-135550758 CAGAGAAGGGCTATAGAATAGGG + Intergenic
1016661594 6:146587422-146587444 CAGTGAGTGTTATTAGAATAAGG + Intergenic
1017025348 6:150176403-150176425 CAGTCAATGCCTTTAGGATTAGG + Intronic
1019231802 6:170572232-170572254 TCCTGAATCCCTTTAGAATAGGG - Exonic
1021262974 7:18481775-18481797 TAGTGTATACCTTTAGCATATGG + Intronic
1022757806 7:33312415-33312437 CAGTGAATGCTTATTGAATGAGG + Intronic
1023521707 7:41056185-41056207 TAGTGAATGCCTTGAGCATCTGG + Intergenic
1026403392 7:70039258-70039280 CAGTATTTGCTTTTAGAATATGG - Intronic
1027195946 7:76030306-76030328 CAGTGAATGACTTTAGAACAGGG - Intronic
1027525978 7:79269225-79269247 CATTAAATGCCTTTAAAATGTGG - Intronic
1027903131 7:84144016-84144038 CAGTGATATCCTTTAGAAGAAGG - Intronic
1029785603 7:102787146-102787168 CTGTGAATGCCTTGAGAGTAAGG + Intronic
1030127134 7:106164973-106164995 GTGTGAATGCCTTTAAAACAGGG - Intergenic
1031963899 7:128013436-128013458 CAGGGAATGCCTTTACACTAAGG + Intronic
1033086333 7:138345348-138345370 CAGTGACTCCATTTTGAATAAGG + Intergenic
1033622399 7:143073645-143073667 TAGTGAATGACTGTATAATAGGG - Intergenic
1040711017 8:50188829-50188851 CAGTGCAGGCCTTTAGGATTTGG - Intronic
1040920708 8:52613407-52613429 CAGTAATTTCCTTTAGAATCGGG + Intergenic
1041455850 8:58058512-58058534 CAGTGATTAACTTTAAAATAAGG + Intronic
1041757229 8:61327932-61327954 CAATGCATGTCTTTAGAGTAGGG - Intronic
1042413195 8:68488250-68488272 GAGTCAAGGCCTTTAGAATTTGG + Intronic
1043393704 8:79816095-79816117 AAGTGAATGAATTGAGAATAAGG - Intergenic
1043542217 8:81276919-81276941 AAGTGAATGGCTTCAAAATAAGG - Intergenic
1044073338 8:87789149-87789171 CAGTGAACGCCTTCATGATATGG - Intergenic
1047600705 8:126423321-126423343 CTGTGAATTCCTTAAGGATAAGG - Intergenic
1048851436 8:138649139-138649161 CCATGAACTCCTTTAGAATAGGG + Intronic
1052232578 9:26172117-26172139 TAGTGAAGTCCTTTAGGATATGG - Intergenic
1058611627 9:106783019-106783041 AAGAGAATGCTTATAGAATAAGG + Intergenic
1059590078 9:115649572-115649594 CAGTAAATGGCTTTAGCTTATGG + Intergenic
1059598497 9:115749146-115749168 CAGTGAATTCCTTGAAAACATGG + Intergenic
1186598696 X:11012303-11012325 CAGTAAGTGCCTTTAGGATAGGG - Intergenic
1187590441 X:20711808-20711830 CAGTGAAAGCATTTTGAATATGG + Intergenic
1187682665 X:21783331-21783353 CATTGAATGCTTTTATAATCAGG + Intergenic
1190367536 X:49710698-49710720 CAATGAATGTCTATAGAAAAGGG - Intergenic
1191183082 X:57582676-57582698 GAGTGCATGCCTCTGGAATAAGG - Intergenic
1191214292 X:57919699-57919721 GAGTGCATGCCTCTGGAATAAGG + Intergenic
1193041274 X:77006371-77006393 CAGTGATTGCCTCTAGAAAAGGG - Intergenic
1196050381 X:111297998-111298020 CAATGATTTCTTTTAGAATATGG - Exonic
1196416007 X:115471890-115471912 CAGAGAATGCCTTCAGGATGGGG - Intergenic
1196805696 X:119583678-119583700 AAGTGAATGTGTTTGGAATATGG + Exonic
1197149039 X:123199632-123199654 CAGTGAAAGCCAAGAGAATAAGG - Intronic
1197386781 X:125812307-125812329 CAGTGAAGGCCTCTAGGATTTGG - Intergenic
1198417508 X:136435471-136435493 CAGTGACTTCCTTGAGAACAGGG + Intergenic
1198785069 X:140278231-140278253 CAGTGAATGCATTTTGACAAAGG - Intergenic
1201891768 Y:18950190-18950212 CAGTTAATCTCTTTAGGATAGGG + Intergenic
1202067756 Y:20958625-20958647 CATAGAATGCCTTTATAATATGG + Intergenic