ID: 928223631 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 2:29426747-29426769 |
| Sequence | AAGCAGTTATAGGCCGGGCA CGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 2313 | |||
| Summary | {0: 1, 1: 2, 2: 30, 3: 313, 4: 1967} |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 928223627_928223631 | 2 | Left | 928223627 | 2:29426722-29426744 | CCTTCTTTCTCTTAATGGATTTA | 0: 1 1: 0 2: 3 3: 59 4: 469 |
||
| Right | 928223631 | 2:29426747-29426769 | AAGCAGTTATAGGCCGGGCACGG | 0: 1 1: 2 2: 30 3: 313 4: 1967 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 928223631 | Original CRISPR | AAGCAGTTATAGGCCGGGCA CGG | Intronic | ||
| Too many off-targets to display for this crispr | |||||