ID: 928223631

View in Genome Browser
Species Human (GRCh38)
Location 2:29426747-29426769
Sequence AAGCAGTTATAGGCCGGGCA CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 2313
Summary {0: 1, 1: 2, 2: 30, 3: 313, 4: 1967}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
928223627_928223631 2 Left 928223627 2:29426722-29426744 CCTTCTTTCTCTTAATGGATTTA 0: 1
1: 0
2: 3
3: 59
4: 469
Right 928223631 2:29426747-29426769 AAGCAGTTATAGGCCGGGCACGG 0: 1
1: 2
2: 30
3: 313
4: 1967

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
928223631 Original CRISPR AAGCAGTTATAGGCCGGGCA CGG Intronic
Too many off-targets to display for this crispr