ID: 928224738

View in Genome Browser
Species Human (GRCh38)
Location 2:29438906-29438928
Sequence CTGGAGCCCTAGGGAAGAAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 375
Summary {0: 1, 1: 0, 2: 5, 3: 39, 4: 330}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
928224738_928224750 30 Left 928224738 2:29438906-29438928 CCAGTTCTTCCCTAGGGCTCCAG 0: 1
1: 0
2: 5
3: 39
4: 330
Right 928224750 2:29438959-29438981 CTCCAGACCAGCCCTGCCTGTGG 0: 1
1: 0
2: 3
3: 41
4: 412
928224738_928224745 -4 Left 928224738 2:29438906-29438928 CCAGTTCTTCCCTAGGGCTCCAG 0: 1
1: 0
2: 5
3: 39
4: 330
Right 928224745 2:29438925-29438947 CCAGGGGCCACCCATCTTTCTGG 0: 1
1: 0
2: 0
3: 13
4: 147
928224738_928224747 3 Left 928224738 2:29438906-29438928 CCAGTTCTTCCCTAGGGCTCCAG 0: 1
1: 0
2: 5
3: 39
4: 330
Right 928224747 2:29438932-29438954 CCACCCATCTTTCTGGAGCTTGG 0: 1
1: 0
2: 1
3: 24
4: 157

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
928224738 Original CRISPR CTGGAGCCCTAGGGAAGAAC TGG (reversed) Intronic
900097332 1:945272-945294 GAGGAGCCCTGGGGAGGAACTGG + Intronic
900148335 1:1167802-1167824 GTGGAAGCCCAGGGAAGAACCGG - Intergenic
900682926 1:3927614-3927636 CTGGAGACCCAGGGAAGCCCGGG + Intergenic
900879903 1:5373321-5373343 CTGGAGCCCCAGGGACCAGCTGG + Intergenic
902044636 1:13515116-13515138 CAGGAGCCCTGGGGAAGAGGCGG + Intergenic
903161303 1:21491059-21491081 CTGGAGCCCTGGGCCAGAGCAGG + Intergenic
905391894 1:37641336-37641358 TTGGAGACCCAGGGAAGAGCTGG - Intergenic
906576831 1:46898763-46898785 CTGTGGCACTAGGGAAGGACAGG - Intergenic
906595087 1:47068821-47068843 CTGTGGCACTAGGGAAGGACAGG + Intronic
907212102 1:52832703-52832725 CTGGACTCCTTGGGAAAAACAGG - Intergenic
911208473 1:95116887-95116909 CTGCAGCCCCAAAGAAGAACTGG + Intergenic
912865296 1:113251020-113251042 CTGGGGCCCTAGGGGAGAGGGGG + Intergenic
916012509 1:160718870-160718892 CTGGAGCCCCAAGAATGAACAGG + Intergenic
916051447 1:161039357-161039379 CTGGAGCCAGAGAGAACAACAGG - Exonic
916561837 1:165940421-165940443 CTGGAGCAGTAGGGAAGACAGGG + Intergenic
916660879 1:166921410-166921432 CTGGAGCTCCAGGGAGGGACCGG - Intronic
917203302 1:172541444-172541466 CTGGATCCCAAGGGATGACCGGG + Intronic
919606756 1:199692825-199692847 CTGGAGAGCTGTGGAAGAACGGG + Intergenic
919726747 1:200889479-200889501 CTGGAGATCCAGGGAAGAGCTGG - Intergenic
919920566 1:202164375-202164397 CGGGAGCCCCTGGGAAGAAAAGG - Intergenic
919927547 1:202200127-202200149 CAGGAGCCCAAGAGCAGAACTGG - Intronic
920075540 1:203333817-203333839 CGGCAGCCCTAGGGAACAAATGG + Intergenic
920378518 1:205522371-205522393 GTCGAGCCCTAGGGAAGATGAGG - Intronic
920493715 1:206439125-206439147 GTGTATCTCTAGGGAAGAACTGG - Intronic
921077158 1:211709077-211709099 CTGGACCCCTTGGGAAAAGCAGG + Intergenic
921745454 1:218735463-218735485 CTGCATCCCTAGGGAATAGCTGG - Intergenic
922222406 1:223618642-223618664 CAAAAGCCCAAGGGAAGAACAGG + Intronic
922891166 1:229062783-229062805 CTGCAGCCCATGGGAAGCACAGG - Intergenic
1063102828 10:2965327-2965349 CTGGAGACCCAGGGAAGAACTGG + Intergenic
1064156834 10:12909533-12909555 CTGTTGCCCAAGGGAAGAACAGG + Intronic
1065711419 10:28521925-28521947 CTGAAGCCCAGGGGAAGAAATGG + Intergenic
1067519484 10:46986076-46986098 CTGAAGACCCAGGGAAGAATTGG + Intronic
1067642764 10:48065763-48065785 CTGAAGACCCAGGGAAGAATTGG - Intergenic
1067664145 10:48259100-48259122 CTGAAGCCTTAGAGAAGGACAGG - Intronic
1068942549 10:62693787-62693809 CTCGAACCCAAGGGAAGACCTGG - Intergenic
1069867152 10:71511052-71511074 CTGGACCCCTAGGGTGGAAGAGG + Intronic
1071344566 10:84680282-84680304 CTGGAGGCCAAGGGAGAAACTGG + Intergenic
1072152078 10:92691320-92691342 CTGGAGCCCTAGGGTAAATAAGG + Intronic
1072265478 10:93722791-93722813 CTGGAGCCTTGGAGAAGAACAGG + Intergenic
1075021561 10:118956268-118956290 CTGAAGCAGGAGGGAAGAACAGG + Intergenic
1076044408 10:127279777-127279799 CTGGTGCCCTCGGCAAGAATGGG + Intronic
1076195289 10:128513280-128513302 CTGGGGCCCTCAGGAGGAACTGG - Intergenic
1080590798 11:33721707-33721729 CTGGAGCAGGAGGGAAGAGCAGG + Intronic
1080719839 11:34838124-34838146 CTGGATCCCCAGGGCAGAGCAGG + Intergenic
1081383522 11:42444696-42444718 CTGGAGCCTTAGGGAGGCAAGGG - Intergenic
1081673200 11:44953174-44953196 CTGGGGCCCCAGGGGTGAACAGG + Intergenic
1083277544 11:61605720-61605742 AGGGAGCCCTAGGGCAGCACCGG - Intergenic
1083540893 11:63510886-63510908 CTGGAATAATAGGGAAGAACGGG - Intronic
1084153602 11:67302422-67302444 CTGGAGCCCCAGGAATGAGCAGG + Exonic
1084562930 11:69914327-69914349 CAGGAGCCCTTGGGCAGCACTGG + Intergenic
1084617194 11:70244412-70244434 CTTGAGCCCTTGGGAAAAGCAGG - Intergenic
1088458136 11:110053994-110054016 CAGGAGCCCTATGGAAGACCGGG + Intergenic
1089692900 11:120197817-120197839 CTGGAGCCCTAGTTCAGAGCCGG - Intergenic
1090074943 11:123574492-123574514 CTGGGGCCCTGGGGAAGGAAGGG + Intronic
1091114786 11:133003287-133003309 CTGGAGCCTTAGGAAGGAGCAGG - Intronic
1091948729 12:4573315-4573337 GTGGGGCCCTAGGAAAGAATGGG - Intronic
1092206108 12:6614970-6614992 CTGGAGTCCCATGGAAGAAACGG - Intergenic
1092209605 12:6637848-6637870 CTGGGGCCCTAGGGATGATGTGG - Intergenic
1092254518 12:6919011-6919033 CTGGAGCCCTTGGGAATACTGGG + Intronic
1092749991 12:11709817-11709839 CTGGAGACCCAGAGAAGAGCCGG - Intronic
1092759783 12:11799307-11799329 TAGGAGCCCTAGGAAAGCACCGG - Intronic
1093051191 12:14506872-14506894 CTGTATCCATAGGGAAGAAAAGG + Intronic
1093691754 12:22116471-22116493 CTGCAGCCCTAAGTGAGAACAGG - Intronic
1094912268 12:35298577-35298599 TTTGAGGCCTACGGAAGAACAGG + Intergenic
1094993414 12:36611974-36611996 TTTGAGGCCTACGGAAGAACAGG + Intergenic
1095010626 12:36890923-36890945 TTTGAGGCCTACGGAAGAACAGG + Intergenic
1096811768 12:54175104-54175126 CTGGGGCACCAGGGAAGAAGAGG + Intronic
1097254313 12:57660820-57660842 CTGGACTCCTTGGGAAAAACAGG + Intergenic
1099083965 12:78221999-78222021 CTAGGGCCCTAGAGAAAAACTGG - Intergenic
1100792552 12:98146608-98146630 CTGCAGGCCTATGGTAGAACGGG + Intergenic
1100840707 12:98609321-98609343 CTGGATCCTCAGGGAAGAGCTGG - Intergenic
1101188549 12:102307063-102307085 CTGGATTCCTTGGGAAAAACAGG + Intergenic
1102796823 12:115696124-115696146 CTGGAGCCCTAGGGAAACCAGGG + Intergenic
1102957150 12:117066144-117066166 CTGGAACCCTAGGGAGGAGAGGG - Intronic
1108691981 13:52867441-52867463 CTGGAGGCAAAGGGCAGAACTGG - Intergenic
1109321741 13:60818623-60818645 TTGGAGACCTAGTGAAGAGCTGG - Intergenic
1112407091 13:99130703-99130725 CTGGAGACCCAGGGAAGACCTGG + Intergenic
1113654041 13:112057162-112057184 TTGGGGCCCCAGGAAAGAACAGG + Intergenic
1113881388 13:113628707-113628729 CTGGGCCCCTAGGGAAAAAAAGG - Intronic
1114396605 14:22368837-22368859 CTGGAGACTCAGGGGAGAACGGG + Intergenic
1114564892 14:23623457-23623479 CTGGAACCCCAAGGATGAACAGG + Intergenic
1116013426 14:39378000-39378022 CTGGAGCCCCTTGGAAAAACTGG - Intronic
1116626592 14:47272591-47272613 CTGGAGTACTAGGGAAAAAGTGG - Intronic
1116763006 14:49038209-49038231 CTGGATCCCTAGGGAAAGACTGG + Intergenic
1118315989 14:64726499-64726521 CTGCAGCCTTTGGGAAGGACAGG - Intronic
1118900432 14:69981202-69981224 GTGGGGCCCCAGGGAAGAAGTGG + Intronic
1119186109 14:72643669-72643691 GGGGAGCCCTAGGGAGGACCTGG - Intronic
1119920604 14:78442555-78442577 CAGTAGCCCTAGGAAAGAAAGGG + Intronic
1120865763 14:89294081-89294103 CAGGAGCCCTTGGGAAGAACGGG - Intronic
1121429769 14:93878631-93878653 CTGGGTCCCTGGGGAAAAACAGG + Intergenic
1121433499 14:93903668-93903690 CTGGAGCCCCCGGGAGGAGCTGG - Intergenic
1121721953 14:96115544-96115566 CTGGAACCCTAAGGATGAATGGG - Intergenic
1122057665 14:99115712-99115734 TTGGATCCCCAGGGAAGTACAGG + Intergenic
1122098322 14:99387391-99387413 CTGGAGCCAGAGGGAAGAGGAGG + Intergenic
1122312233 14:100804499-100804521 GTGGAGCCCTAGGGATGAGGAGG + Intergenic
1122634051 14:103122109-103122131 CTGGAGTCCTAGGAGAGAAGGGG + Intergenic
1122857957 14:104568957-104568979 CAGGAGCCCTGGGGAAGGGCTGG - Intronic
1127027297 15:54821013-54821035 CTGAAGAACTAGGGAAGAGCTGG - Intergenic
1127209799 15:56761813-56761835 CTGGAGACCTAGGGAAGGGTTGG - Intronic
1132765289 16:1531424-1531446 CGGGAGCCCTAGCACAGAACAGG - Intronic
1132959522 16:2614163-2614185 CTGGGGCCCCAGGGAGGAGCAGG + Intergenic
1132972583 16:2696138-2696160 CTGGGGCCCCAGGGAGGAGCAGG + Intronic
1133277097 16:4645677-4645699 CTGGAGCTCCAGGGAAGAGCTGG + Intronic
1133337473 16:5015378-5015400 CTGGAGCCTTTGGGAGGAAGAGG - Exonic
1133715235 16:8441179-8441201 CTGCAGACCTAAGTAAGAACAGG + Intergenic
1135254509 16:20930262-20930284 CTGGAGTCCTGGGGAAGAGATGG - Intergenic
1135350839 16:21727761-21727783 CTGCATCCCTGGGGAAGATCAGG + Intronic
1137235800 16:46616550-46616572 CTGGAGCCAAAGGGAGGAAATGG + Intronic
1137791191 16:51176212-51176234 CCTGAGCCATAGGGAATAACAGG + Intergenic
1139706982 16:68747550-68747572 CCTGTGCCCCAGGGAAGAACTGG - Intronic
1140830665 16:78747711-78747733 CTGACGCTCTAGGGAAGAAGAGG - Intronic
1141504381 16:84464977-84464999 CTGGAGACCCAGGGAAGAGCTGG + Intergenic
1141754410 16:85981962-85981984 CTGGAGCCTCAGGGAAGTCCTGG - Intergenic
1142009541 16:87706841-87706863 CTGGAGCCGTAAGGATGAAGAGG + Intronic
1142742831 17:1940942-1940964 CTGCAGCCCAAGGGACGAAATGG - Intronic
1143540415 17:7565137-7565159 CTACAGCCCTATGGAAGAAAAGG - Intronic
1144728251 17:17512447-17512469 CTGGAGCCCCAGGGAGGTGCAGG - Intronic
1144787784 17:17841402-17841424 CTGCAACCCTAGGGAGGAATGGG + Intergenic
1146407489 17:32551960-32551982 GTGGAGGGATAGGGAAGAACAGG - Intronic
1146546878 17:33747782-33747804 CTGCAGACCTGGGGAAGAAGGGG - Intronic
1146915934 17:36678419-36678441 CTGGGTCCCCAGAGAAGAACAGG - Intergenic
1147896147 17:43752635-43752657 CTGGAGCCCCAGGAAGGGACCGG + Intergenic
1148072775 17:44917764-44917786 CTGGGGACCTGGGGAAGGACAGG + Intergenic
1148189379 17:45667955-45667977 CTGGAGCTCCAGGGATGAACAGG + Intergenic
1150203391 17:63379966-63379988 CTAAAGGCCTAGGGAGGAACAGG - Intronic
1150930462 17:69579194-69579216 CTAGAGCCCAAGAGTAGAACGGG - Intergenic
1151616436 17:75215739-75215761 ATGGAGACCTAAGGAAGAAATGG - Exonic
1151677208 17:75604684-75604706 CTGGAGCTCAGGGGGAGAACAGG - Intergenic
1151803300 17:76390429-76390451 CTGGAGGACTAGGGAGGACCTGG + Exonic
1152758430 17:82096823-82096845 CTGGTGCCCTAGGGATGGCCTGG - Intronic
1152790568 17:82276614-82276636 CTGGAGGAGTAGGGAAGTACAGG + Intergenic
1153320145 18:3764927-3764949 CAGGGGCCACAGGGAAGAACAGG + Intronic
1154025423 18:10703212-10703234 CTTCAGCCCTAGGTAAGAAAGGG + Intronic
1155069293 18:22299286-22299308 CTGGAGCCAGAAGAAAGAACAGG + Intergenic
1157532056 18:48429504-48429526 CAGGAGGCTCAGGGAAGAACTGG - Intergenic
1158505731 18:58044577-58044599 CTGGAGGCAGAGGGGAGAACCGG + Exonic
1160731717 19:644262-644284 CTGGAGCCCCCGGGAGGGACCGG + Intergenic
1160782893 19:885628-885650 CTGGAGCCCCCGGGAGGGACCGG + Intronic
1161029083 19:2049762-2049784 CTGCTGCCCTAGGGGAAAACTGG + Intronic
1161119900 19:2519780-2519802 CTGGAGACCCAGGGAAGAGTTGG - Intronic
1161140007 19:2641577-2641599 CTGGAGCCCCAAGGAGGGACTGG + Intronic
1161714627 19:5868261-5868283 CTGGGGCCCCAGGGAGGAGCAGG + Intronic
1161748545 19:6077005-6077027 CTGGATTTCTAGGGAAGAAAAGG - Intronic
1162518549 19:11165385-11165407 CTGGAGTCCCGGGGAGGAACAGG + Intronic
1162520281 19:11175648-11175670 CTGAAGCCCCCAGGAAGAACAGG + Intronic
1163337227 19:16681039-16681061 CTAGAGCTCTAGAGAAGAAGGGG - Intronic
1163447099 19:17353164-17353186 CTCGGGCCCCAGGGAAGAGCCGG - Intronic
1164322079 19:24157931-24157953 CTGGAGTCCTATGGATTAACAGG + Intergenic
1164783057 19:30909096-30909118 CTGGAGGCCTAGAGAACAAGAGG + Intergenic
1165151916 19:33766035-33766057 CCGGAGACCCAGGGAAGACCTGG - Intronic
925060869 2:889044-889066 CTGGAGCCCCAGGGATGACCTGG + Intergenic
927258326 2:21060240-21060262 CTTCAGACCTAGGGAAGACCAGG + Intergenic
927351714 2:22124477-22124499 CTGGAACCCTAAGGACGAACAGG + Intergenic
927866530 2:26591491-26591513 CTGGGGCCCTAGGGCACAGCTGG - Intronic
928224738 2:29438906-29438928 CTGGAGCCCTAGGGAAGAACTGG - Intronic
929456835 2:42072291-42072313 CTGGACCTCTAGGGAAGGGCAGG - Intergenic
929618763 2:43334046-43334068 CAGACCCCCTAGGGAAGAACTGG + Intronic
930711515 2:54555161-54555183 ATGGAGCCCTGGGGAAGGCCTGG - Intronic
931666927 2:64616281-64616303 CTGGAGGGCAAGGGAAGAATAGG - Intergenic
932965895 2:76474217-76474239 CTGGATGCCTTGGGAAAAACAGG + Intergenic
933595902 2:84282940-84282962 CTGGAGGCCTGGGTTAGAACAGG - Intergenic
933709646 2:85315884-85315906 CATGAGCCCCAGGGAAGGACAGG + Intergenic
933713420 2:85343890-85343912 CATGAGCCCCAGGGAAGGACAGG - Intronic
935177870 2:100664981-100665003 CTGGAGACTCAGGGAAGAGCTGG - Intergenic
937207031 2:120243428-120243450 CTGGAGCCATGGGGAGGAGCAGG + Intronic
941871579 2:170391125-170391147 CTGGAGCCCTAGACAGGAAGTGG - Intronic
942149264 2:173058376-173058398 CTGGAGGCCCAGGTCAGAACTGG + Intergenic
943228468 2:185211977-185211999 CCGGAGACCTAGGGAAGAGCTGG + Intergenic
943436358 2:187869312-187869334 CTGGAGACCTGGGGAAGAGCGGG - Intergenic
943436373 2:187869430-187869452 CTGGAGACCTGGGGAGGAGCAGG - Intergenic
945912096 2:215661158-215661180 GTAGAGCCCTTGGGAAAAACAGG + Intergenic
947373078 2:229468252-229468274 CTGGTTCCCTAGGCAAGAAAGGG - Intronic
947752648 2:232540826-232540848 CTGTGGGGCTAGGGAAGAACTGG + Intronic
948996760 2:241584572-241584594 CTGGAGCCCTCGGGAGGGCCTGG - Exonic
949071088 2:242024703-242024725 CTGGAGACCAGGGGAGGAACTGG + Intergenic
949071103 2:242024800-242024822 CTGGAGACCCAGGGAGGAGCTGG + Intergenic
949071114 2:242024849-242024871 CTGGAGACCTGGGGAGGAGCTGG + Intergenic
1168845480 20:941504-941526 CTGGATCCCTAGGGAGGATGAGG + Intergenic
1169700449 20:8440528-8440550 CTGGATCCATAGACAAGAACTGG - Intronic
1170455673 20:16530599-16530621 CTGCAGCGCTAGGGGAGAGCCGG + Intronic
1171517267 20:25747459-25747481 CTGGACCCAGAGGGAAGGACAGG - Intergenic
1172596677 20:36154959-36154981 CTCCAGCCCTGGGGAGGAACGGG + Intronic
1174060956 20:47832801-47832823 CTGGAGACCTAGGGAGGAGCTGG - Intergenic
1174061042 20:47833332-47833354 CTGGAGACCCAGGGAGGAACCGG - Intergenic
1174061190 20:47834143-47834165 CTGGAGACCTAGGGAGGAGCTGG - Intergenic
1174061222 20:47834302-47834324 CTGGAGACCCAGGTAAGAGCTGG - Intergenic
1174061306 20:47834869-47834891 CTGGAGGCCTGGGGAGGAGCTGG - Intergenic
1174070221 20:47894454-47894476 CTGGAGGCCTGGGGAGGAGCTGG + Intergenic
1174070554 20:47896397-47896419 CTGGAGACCCAGGTAAGAGCTGG + Intergenic
1174070586 20:47896556-47896578 CTGGAGACCTAGGGAGGAGCTGG + Intergenic
1174070733 20:47897367-47897389 CTGGAGACCCAGGGAGGAACCGG + Intergenic
1174070801 20:47897734-47897756 CTGGAGACCTAGGGAGGAGCCGG + Intergenic
1174070855 20:47898035-47898057 CTGGAGACCCAGGGAGGAACTGG + Intergenic
1174070941 20:47898569-47898591 CTGGAGACCTAGGGAGGAGCTGG + Intergenic
1174100115 20:48120952-48120974 CTGGAGACCTGGGGCAGAGCTGG - Intergenic
1174100161 20:48121213-48121235 CTGGAGACCTAGGGAGGAGCTGG - Intergenic
1174100324 20:48122118-48122140 CTGGAGACCCAGGGAGGAGCCGG - Intergenic
1174100366 20:48122362-48122384 CTGGAGTTCCAGGGAGGAACCGG - Intergenic
1174100565 20:48123481-48123503 CTGGAGACCCAGGGAGGAGCTGG - Intergenic
1174100637 20:48123900-48123922 CTGGAGACCCAGGGAGGAGCCGG - Intergenic
1174100702 20:48124251-48124273 CTGGAGCCCTAGGCATTAGCTGG - Intergenic
1174148864 20:48472040-48472062 CTGGAGACCCAGGGAGGAGCTGG - Intergenic
1174149227 20:48474430-48474452 CTGGAGACCTAGAGAGGAGCTGG - Intergenic
1174149379 20:48475423-48475445 CTGGAGACCCGGGGAGGAACGGG - Intergenic
1174149549 20:48476467-48476489 CTGGAGACCCAGGGAGGAGCCGG - Intergenic
1174149616 20:48476865-48476887 CTGGAGACCAGGGGAAGAGCCGG - Intergenic
1174153119 20:48500089-48500111 CTGGAGACCTAGGGAGGAGCTGG - Intergenic
1174153191 20:48500515-48500537 CTGGAGACCCAGGGAGGAGCCGG - Intergenic
1174153200 20:48500568-48500590 CTGGAGACCCAGGGAGGAGCCGG - Intergenic
1174153264 20:48500922-48500944 CTGGAGACCTGGGGAGGAGCCGG - Intergenic
1174153330 20:48501289-48501311 CTGGAGACCCAGGGAGGAACCGG - Intergenic
1174153439 20:48501907-48501929 CTGGAGACCCAGGGAGGAGCTGG - Intergenic
1174153463 20:48502040-48502062 CTGGAGACCTGGGGAGGAGCTGG - Intergenic
1174153585 20:48502764-48502786 CTGGAGCCCTAGGCAGGAGCTGG - Intergenic
1174153617 20:48502976-48502998 CTGGAGATCCAGGGAGGAACCGG - Intergenic
1174156173 20:48516772-48516794 CTGGAGGCCTGGGGAGGAGCTGG - Intergenic
1175478134 20:59291495-59291517 CTGGAGAACTAGGGCAGAAGAGG + Intergenic
1176064948 20:63189419-63189441 TGGGAGCCCTGGGCAAGAACAGG - Intergenic
1176270127 20:64231998-64232020 CTGGAGCCTCAGGGAAGAACTGG - Intronic
1176430090 21:6570069-6570091 CTGGAGGCCAAGGGCAGAGCGGG - Intergenic
1179705484 21:43177531-43177553 CTGGAGGCCAAGGGCAGAGCGGG - Intergenic
1179915705 21:44476816-44476838 CTGGAACCCTAAGGATGAATGGG + Intergenic
1180154728 21:45972425-45972447 CTGGGGCAGTAGGGAAGAAAGGG - Intergenic
1182020140 22:27074871-27074893 CTGGAGTCATAGGGAGAAACTGG + Intergenic
1183471103 22:38007227-38007249 CAGGAGACCTAGTGAAGAAGGGG - Intronic
1183471205 22:38007651-38007673 CTGGGGGACTCGGGAAGAACTGG - Intronic
1183477442 22:38043264-38043286 CTGGGGGCCTGGGGAAGCACCGG - Intergenic
1184598444 22:45528162-45528184 CTGGAGCCCCAGGGAAGGAGGGG + Intronic
1184916892 22:47575435-47575457 CTGAAGGCCAAGGGAAGGACAGG - Intergenic
1184926306 22:47642226-47642248 TGGGAGCCCTAGTGAAGAGCAGG + Intergenic
1185122181 22:48977938-48977960 CCAGAGCCCAGGGGAAGAACGGG + Intergenic
949158915 3:858038-858060 CTGGAGACCCAGGGAGGAGCTGG - Intergenic
949962827 3:9328420-9328442 CTGGACTCCTTGGGAAAAACAGG - Intronic
950605716 3:14078215-14078237 CTGGACTCCTTGGGAAAAACAGG - Intronic
950799135 3:15535208-15535230 ATGGAGCCCTGGGGAAGAGAGGG + Intergenic
952042117 3:29273534-29273556 CTGGAGACCTGGGGAAGAGTTGG + Intergenic
953174025 3:40532869-40532891 CAGGATCCCTGGAGAAGAACAGG - Exonic
953798104 3:46000972-46000994 CTGGAGCCCCAAGGATGAATGGG + Intergenic
955260708 3:57387578-57387600 TTGGAGTCCTAAGGAAGAAGGGG - Intronic
955928446 3:64030951-64030973 GTGCAGCCCTAGCGAAGGACAGG + Intergenic
955979133 3:64507195-64507217 CTGGCACCCCAGGGAAGAAATGG + Intergenic
957121101 3:76094065-76094087 ATGGAGCCCTGAGGAAGAATAGG + Intronic
957211632 3:77266525-77266547 ATGGAACCCTAGGGGAGAAAAGG - Intronic
958207769 3:90426563-90426585 TTGGAGGCCTAGGGTAGAAAAGG - Intergenic
958273262 3:91536528-91536550 TTTGAGCCCTAAGGAAGAAAAGG - Intergenic
958798845 3:98733272-98733294 CTGGAGCCCCAGTGAAGGGCGGG + Intronic
960993028 3:123324045-123324067 TTGGAGCCCTGGGGAAGGCCAGG + Intronic
962834857 3:139181135-139181157 CTGGAGTCCTTGGGAAGTATGGG + Intronic
963990706 3:151650196-151650218 CCGGAGACCCAGGGAAGAGCTGG - Intergenic
964452943 3:156829620-156829642 GTGGAGCCCTAGTGAAAAGCAGG + Intronic
965588456 3:170340511-170340533 CTGGACTCCTTGGGAAAAACAGG - Intergenic
967543560 3:190696960-190696982 CTGGGTCACTAGGGAAAAACCGG - Intergenic
967761192 3:193228135-193228157 CTGGAGCCCTAAATAAGAACAGG + Intergenic
969709985 4:8837209-8837231 CTGGAGCCCAAGTGAAGCTCTGG + Intergenic
970238413 4:13982147-13982169 AGGGAGCCCTGGGGAGGAACAGG - Intergenic
970412163 4:15818759-15818781 CAGCAGCCCTATGGAAGAAAGGG + Intronic
970993124 4:22236007-22236029 CAGAAGCCCTGGGGGAGAACTGG - Intergenic
973633276 4:52839083-52839105 CTGGAGCCCAAGGGAGGATAAGG + Intergenic
975855838 4:78623222-78623244 CTGGAGCCCCAGGGAAGAGTTGG - Intergenic
976600742 4:86935394-86935416 TGGGAGCCCTCGGGGAGAACGGG + Intronic
979487258 4:121283524-121283546 CTGGGGCCCTGGGGCAGACCTGG - Intergenic
980419514 4:132541968-132541990 CTGGAACCCTAAGGATGAATGGG + Intergenic
981526147 4:145708515-145708537 CTGGAACCCTAAGGATGAATAGG - Intronic
983586980 4:169366063-169366085 CTAGAGCCCTAGGCAAAGACTGG + Intergenic
985133754 4:186765204-186765226 CTAAAGCCCTAGGCAACAACAGG - Intergenic
985506110 5:281405-281427 CTGGAGGTCCAGGGAAGAGCTGG + Intronic
985506968 5:286992-287014 CTGGAGACCCAGGGAGGAGCTGG + Intronic
985506987 5:287089-287111 CTGGAGATCTGGGGAAGAGCTGG + Intronic
985742078 5:1624056-1624078 CTGGAGACTCAGGGAAGAGCTGG - Intergenic
986242166 5:5970918-5970940 CTGCAGCCAGAGGGGAGAACAGG - Intergenic
987119037 5:14749079-14749101 CTTGAGCTCTCGAGAAGAACTGG + Intronic
987218994 5:15770228-15770250 CTGGGGCCCTACGGAAAATCAGG - Intronic
988065283 5:26224250-26224272 CTGGAGACCTGGGGAGGAGCTGG - Intergenic
988065325 5:26224557-26224579 CTGGAGATCTGGGGAAGAGCTGG - Intergenic
988065606 5:26226634-26226656 CTGGAGACCCAGAGAAGAGCTGG - Intergenic
988065711 5:26227567-26227589 CTGGAGACCTGGGGAGGAGCGGG - Intergenic
989246382 5:39259438-39259460 CTGGAGGCCTCAGGAAGAAGTGG + Intronic
989336996 5:40329861-40329883 CTGGACGCCTTGGGAAAAACAGG - Intergenic
991291130 5:65034984-65035006 CGGCAGCCCTGGGGCAGAACAGG - Intergenic
992128119 5:73663905-73663927 CAGGAGCCCTAGGGTAGAGGTGG + Intronic
992878451 5:81081269-81081291 CTGGAGCCCTGGAGAACAAAAGG + Intronic
993189272 5:84660532-84660554 CTGGAGCCCTAGAGAAAGCCAGG - Intergenic
994297599 5:98109737-98109759 CTGGAGCACTAGGGAAAAAGTGG - Intergenic
997975770 5:138440520-138440542 CTGGGGCCCTAGGGAACAGAGGG - Intronic
998809482 5:145951874-145951896 ATAGAGCACTAGGTAAGAACAGG + Intronic
999667007 5:153923024-153923046 CTGAAGCCAAAGAGAAGAACAGG + Intergenic
1001309751 5:170602384-170602406 CTGGAGCCCTCAGGAGGAAGAGG + Intronic
1002089634 5:176796884-176796906 CAGCAGCCGTAGGGAAGACCTGG - Intergenic
1005013585 6:21358008-21358030 TTTGAGCCATAGTGAAGAACTGG - Intergenic
1005020925 6:21418157-21418179 CTGGAGACCAAGGGAAGCAGTGG + Intergenic
1006149757 6:31980639-31980661 CTGGCGCCCTAGAGGAGAAGTGG - Exonic
1006156057 6:32013377-32013399 CTGGCGCCCTAGAGGAGAAGTGG - Intergenic
1006791079 6:36701728-36701750 GAGGACCCCTAGGGGAGAACAGG + Intronic
1007570716 6:42888632-42888654 CTGAAGCCCAGGGGAAGAAATGG - Exonic
1012386094 6:98685016-98685038 CTGAAGACCCAGGGAAGAGCTGG - Intergenic
1012763393 6:103332313-103332335 CTGCAGACCTAAGTAAGAACAGG + Intergenic
1012997408 6:105987015-105987037 CTGGAGCCCTGGATAAGAACTGG + Intergenic
1016225091 6:141725000-141725022 CTGGAGACCCAAGGAAGAGCTGG + Intergenic
1016854464 6:148652668-148652690 CTGGACTCCTTGGGAAAAACAGG + Intergenic
1017009306 6:150052589-150052611 CTGGAGACCTAGGGAGGAGCTGG - Intergenic
1017009330 6:150052745-150052767 CTGGAGCCTTGGGGAGGTACCGG - Intergenic
1017009361 6:150052911-150052933 CTGGAGCCCTGGGGAGGAGCCGG - Intergenic
1017009540 6:150053985-150054007 CTGGAGACCTAGGGAGGAGCTGG - Intergenic
1017009642 6:150054608-150054630 CTGGAGACCTGGGGAGGAGCTGG - Intergenic
1017009767 6:150055360-150055382 CTGGAGGCCTGGGGAGGAGCTGG - Intergenic
1017009786 6:150055466-150055488 CTGGAGACCCAGGGAGGAGCTGG - Intergenic
1017404752 6:154107209-154107231 CTGGACTCCTTGGGAAAAACAGG - Intronic
1018614882 6:165677295-165677317 CTGGAGGCCCAGGGAAGAGCTGG - Intronic
1018957444 6:168419664-168419686 CTGGAGCCCTAGGGTAGCACAGG - Intergenic
1019507412 7:1399273-1399295 CTGGAGACCTGGGGAAGCAGAGG - Intergenic
1021431314 7:20561298-20561320 ATGAAGTCCTAGGCAAGAACTGG + Intergenic
1021553007 7:21891961-21891983 ATGGTGCCCTGGGGAAGTACAGG + Intronic
1022144294 7:27521828-27521850 CTGCTGCCCTAGATAAGAACTGG + Intergenic
1023382306 7:39621956-39621978 CTAGAGCTCTAGGGAGGAGCTGG - Intergenic
1023601366 7:41884682-41884704 CTGGAGACCCAGGGAAGGGCTGG - Intergenic
1024385096 7:48741902-48741924 CAGATGCCCTAGGGAAGACCTGG + Intergenic
1025233117 7:57216199-57216221 CTGGAGGCCTGGGGAGGAGCTGG + Intergenic
1025233128 7:57216252-57216274 CTGGAGCCCAGGGGAGGAGCCGG + Intergenic
1025233345 7:57217598-57217620 CTGGAGACCCAAGGAAGAGCCGG + Intergenic
1025233373 7:57217757-57217779 CTGGAGCCCTAGGCAGGAGCTGG + Intergenic
1025233506 7:57218530-57218552 CTGGAGACCCAGGGAGGAGCTGG + Intergenic
1025233697 7:57219606-57219628 CTGGAGACCCAGGGAGGAACCGG + Intergenic
1025233788 7:57220113-57220135 CTGGAGACCCAGGGAGGAGCCGG + Intergenic
1025233840 7:57220383-57220405 CTGGAGACCTAGGGAGGAGCCGG + Intergenic
1025233977 7:57221215-57221237 CTGGAGACCTGGGGAGGAGCTGG + Intergenic
1025709108 7:63891221-63891243 CTGGAGCCAGAGGGAAGGACAGG + Intergenic
1025768865 7:64484654-64484676 CTGGACTCCTTGGGAAAAACAGG + Intergenic
1029126341 7:98297389-98297411 CTGCAGCCCAAGGGAAAAAGTGG - Intronic
1032476860 7:132217470-132217492 ACAGAGCTCTAGGGAAGAACAGG + Intronic
1032891883 7:136205492-136205514 CTGGATACCTAGGGAAAAGCTGG + Intergenic
1033828723 7:145225734-145225756 CTGGAAACCTAGAAAAGAACAGG - Intergenic
1033946849 7:146729175-146729197 GAGGAGCCCTAATGAAGAACAGG - Intronic
1035002946 7:155630220-155630242 CTGGAGCCGTAGGGAAGCATAGG - Intronic
1035029492 7:155848263-155848285 CTGAGGCCTCAGGGAAGAACAGG + Intergenic
1036969755 8:13341767-13341789 TTGGTGCCCCAGGGAAGGACAGG + Intronic
1038182211 8:25240004-25240026 CTGCAGGCCCAGGGAAGAGCTGG + Intronic
1038338114 8:26661735-26661757 GTGGACCCCTAAGGAAGAAGTGG + Intergenic
1038931917 8:32202915-32202937 CTGCAGCCCTAAGTGAGAACAGG - Intronic
1039434815 8:37552757-37552779 GTCTAGCCCCAGGGAAGAACTGG - Intergenic
1040273056 8:45979268-45979290 CTGGAGCCCTATGGTGGAAAAGG + Intergenic
1041375921 8:57209399-57209421 CTGGGACCCTGGGGATGAACGGG - Intergenic
1041376686 8:57213778-57213800 CTGGGACCCTGGGGATGAACGGG - Intergenic
1041377604 8:57219041-57219063 CCAGAGCCCTATGGATGAACGGG - Intergenic
1042482712 8:69322370-69322392 CTGGAGACCTAGAGAAAAGCTGG + Intergenic
1042482732 8:69322519-69322541 CTGAAGACCTGGGGAGGAACTGG + Intergenic
1042482840 8:69323397-69323419 CTGGAGACCTGGGGAGGAGCAGG + Intergenic
1042483218 8:69325901-69325923 CTGGAGACCTGGGGAGGAGCTGG + Intergenic
1043146007 8:76655209-76655231 CTAGAGCCCTATGGGAGAAAAGG + Intergenic
1044277027 8:90313141-90313163 CTGGAGACTTAGGGAGGAATTGG - Intergenic
1044340339 8:91040351-91040373 CTGTAGCCCTGGGTAAGAAGTGG + Intronic
1044815460 8:96108076-96108098 CTGGAGACCCAGGGAAGAGCTGG + Intergenic
1047343939 8:124009376-124009398 CTGGAGGCCTGGGGAGGAGCTGG + Intronic
1047343950 8:124009429-124009451 CTGGAGCCCAGGGGAGGAGCCGG + Intronic
1049169266 8:141148549-141148571 TTTGAGCCCCAGGAAAGAACAGG - Intronic
1050245117 9:3681232-3681254 TGGGAGCACTAGGGAAGAAAAGG + Intergenic
1051829203 9:21256909-21256931 CTGGAACCCCAAGGATGAACAGG + Intergenic
1051888965 9:21924155-21924177 CTGGAACCCTAAGGATGAATGGG + Intronic
1052173270 9:25427494-25427516 CTGGGGCCCCAGGGAAAGACAGG - Intergenic
1052476766 9:28970826-28970848 CAGGAGTCCTAGTGATGAACTGG + Intergenic
1052663631 9:31467972-31467994 CTGGACTCCTTGGGAAAAACAGG - Intergenic
1052967123 9:34348579-34348601 ATGGAGAACTTGGGAAGAACTGG - Intergenic
1055970845 9:81911319-81911341 CTGGACTCCTTGGGAAAAACAGG - Intergenic
1057174469 9:92985961-92985983 CTGGAACCCTAAGGATGAATGGG - Intronic
1058082739 9:100716706-100716728 CCAGAGCCCTAGGTAAAAACAGG - Intergenic
1060146777 9:121259871-121259893 CTTCAGCTCTAGGGAAAAACAGG + Intronic
1060804113 9:126564114-126564136 CTGGATGGGTAGGGAAGAACTGG + Intergenic
1061798700 9:133102901-133102923 CTGGGGCCAGAGGGAAGCACAGG + Intronic
1062654113 9:137593356-137593378 CAGGGGCCCTAGGGGAGACCCGG + Intergenic
1189713266 X:43837829-43837851 CAGGAGTCCCATGGAAGAACTGG - Intronic
1190408054 X:50107219-50107241 CTGAAGACCCAGAGAAGAACTGG + Intergenic
1192363995 X:70455772-70455794 CTGCAGCCCTAGGGGACAAAGGG - Intronic
1195220093 X:102738425-102738447 CTGGAACCCCAGGGATGGACAGG - Intronic
1197357697 X:125456847-125456869 CTGGAGACTCAGGGAAGAGCTGG + Intergenic
1198498308 X:137215995-137216017 CTGGACACCTTGGGAAAAACAGG + Intergenic
1198848153 X:140935960-140935982 CTGGAGACCCAGGGAAGAACTGG + Intergenic