ID: 928225754

View in Genome Browser
Species Human (GRCh38)
Location 2:29446606-29446628
Sequence CAGCTTGGAGATCTTGGCAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 225
Summary {0: 1, 1: 0, 2: 2, 3: 13, 4: 209}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
928225754_928225757 -7 Left 928225754 2:29446606-29446628 CCACTGCCAAGATCTCCAAGCTG 0: 1
1: 0
2: 2
3: 13
4: 209
Right 928225757 2:29446622-29446644 CAAGCTGAGCTGCTATACAATGG 0: 1
1: 0
2: 0
3: 11
4: 124

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
928225754 Original CRISPR CAGCTTGGAGATCTTGGCAG TGG (reversed) Intronic
901782928 1:11606409-11606431 CAGCTTCAGGACCTTGGCAGTGG - Intergenic
901878141 1:12178795-12178817 CAGGTGGGAGATGCTGGCAGGGG + Intronic
903178899 1:21595633-21595655 CAGCTGTGAGATCCTGGTAGAGG + Intergenic
903578000 1:24351092-24351114 CAGATTGGAGCTGTGGGCAGAGG - Intronic
904217321 1:28931890-28931912 TAGCTTGGTGGCCTTGGCAGGGG + Intronic
904773889 1:32895239-32895261 CAGCTTGGGCACCCTGGCAGGGG + Intronic
906164769 1:43678068-43678090 CAGCTTTGAGTTCTTGGGATAGG + Intronic
906264897 1:44421197-44421219 CGGGTTGGATATCTAGGCAGTGG + Intronic
911141353 1:94505858-94505880 AAACATGGAGATCTTGTCAGGGG + Intronic
912219863 1:107661200-107661222 CAGCTAGCAGATCCTGGCATGGG - Intronic
912488846 1:110050107-110050129 CAGCTTGTTGATCTTGTAAGGGG - Intronic
914326238 1:146619500-146619522 CAGTTTGGAGAGCTGTGCAGTGG + Intergenic
916884485 1:169053753-169053775 GAGGTTGGAGAGGTTGGCAGGGG - Intergenic
916981169 1:170138818-170138840 CAGCTTTCAGATTATGGCAGAGG + Intergenic
919885612 1:201931973-201931995 CAGCTTTGAGGGCTTGGCTGAGG + Intronic
919943331 1:202303333-202303355 CAGCCTGGAGATCCTGTGAGTGG + Exonic
920423039 1:205848900-205848922 CAGCTTGGAACTCTGAGCAGGGG - Intronic
920891015 1:209985737-209985759 CATCTTTGAAATCTAGGCAGAGG + Intronic
922131105 1:222779618-222779640 CAGATTGTAAATTTTGGCAGAGG + Intergenic
922719298 1:227892192-227892214 CAGCTTGGGGGTCATGGCGGAGG + Intergenic
922878906 1:228964405-228964427 GAGCTTGAAGATCTTTCCAGGGG - Intergenic
923270206 1:232348406-232348428 CAGCTGGGACGTCTTGGCAATGG + Intergenic
923641615 1:235767396-235767418 CAGCTATGAGAACTTGGCAAAGG - Intronic
1063447602 10:6129256-6129278 CAGCTTAGTGATCTTCCCAGGGG + Intergenic
1068136386 10:52954094-52954116 AAGCTTTGAGATCTAGGGAGAGG + Intergenic
1068872419 10:61959568-61959590 CTGCATGCAGATTTTGGCAGGGG - Intronic
1069643566 10:69973568-69973590 CAGTTTGGGGATCTTGGCTGTGG + Intergenic
1069831822 10:71286496-71286518 CAGCTGGGTGGTCTTGGGAGGGG - Intronic
1070574129 10:77664623-77664645 CAGCTGGGAAATCTGGGGAGAGG - Intergenic
1070979485 10:80632901-80632923 CTGCTTGTAGAGCTTGGCTGGGG + Intronic
1074637084 10:115331985-115332007 CAGCACAGAGAACTTGGCAGTGG - Intronic
1074762125 10:116675021-116675043 CAGCTGGGAGGGCTTGGCCGGGG + Exonic
1075089952 10:119438395-119438417 CAGTTTGAAGACCTTTGCAGTGG + Intronic
1075332290 10:121582425-121582447 CAACTTTCAGAGCTTGGCAGAGG - Intronic
1077050563 11:564542-564564 CAGCTTTGAAATCAGGGCAGGGG + Intergenic
1077232375 11:1463583-1463605 CAGCTTGAAGTTCAGGGCAGTGG - Intergenic
1078011719 11:7577473-7577495 CAGCTTGGAGTTCTTGAGGGGGG + Intronic
1080794367 11:35549862-35549884 GAGCCTGGAGATCCTGCCAGTGG - Intergenic
1081291344 11:41329289-41329311 CAGGAGGGAGATCTTAGCAGAGG - Intronic
1082562553 11:54635719-54635741 CAGCTTAGAGACATTGACAGAGG + Intergenic
1083471498 11:62887331-62887353 CATCTGGGAGCTCTTGGCTGAGG + Intronic
1084026329 11:66452362-66452384 CAGGCTGGAAATGTTGGCAGGGG + Intronic
1084308259 11:68300500-68300522 AAGCTTGGAGTCCTGGGCAGGGG - Intergenic
1086120732 11:83302324-83302346 CAGCTTCCTGATTTTGGCAGAGG - Intergenic
1086449533 11:86902312-86902334 CAGCTGGGAGATATTGCCAAAGG - Intronic
1087432728 11:98074240-98074262 CAGCGTTGACATATTGGCAGTGG + Intergenic
1088674515 11:112179504-112179526 CAACTTGGATTTCTTGGCATGGG + Intronic
1089165949 11:116476767-116476789 CAATTTGGAGCTCTTGGCAATGG + Intergenic
1089532263 11:119138047-119138069 TAGCTTGGATTTCTTGGCTGGGG + Intergenic
1090262687 11:125332836-125332858 CTGCTTGGAGAGCTGGGCAAAGG - Intronic
1091281398 11:134383679-134383701 CAGCCTGGAGCTCTTCGAAGAGG - Exonic
1091991493 12:4959693-4959715 GAGCTTGGACATCTGGGCAGTGG - Intergenic
1093790602 12:23245295-23245317 CAGTTTGGGGGTCTTGGAAGAGG - Intergenic
1094088680 12:26623300-26623322 CAGCGTGGAGATGCTGGCAAAGG - Intronic
1095773714 12:45990420-45990442 CATGTTGGGGAACTTGGCAGCGG - Exonic
1096205618 12:49719216-49719238 AAGGTGGGAGATATTGGCAGGGG + Intronic
1096685582 12:53286327-53286349 AAGCTTGGAGAGCTTGGGTGAGG - Exonic
1097029746 12:56081938-56081960 CAGCTTGGGGAGCAGGGCAGGGG - Intronic
1097501852 12:60412837-60412859 CATGTTGGAGCTATTGGCAGTGG + Intergenic
1097681871 12:62656804-62656826 CAGCTTTGGAATGTTGGCAGGGG + Intronic
1097688839 12:62715274-62715296 CAGCTTGGGGATTCTGGCACCGG + Intronic
1100224644 12:92543909-92543931 AAGTTTGGAGATTGTGGCAGTGG - Intergenic
1100616998 12:96238502-96238524 CAGCCGGGGGAGCTTGGCAGTGG + Intronic
1101609482 12:106277648-106277670 CATCTTGAAGATCTTGAAAGTGG - Intronic
1101900504 12:108788342-108788364 CAGGTTGGAGCTCATGGAAGAGG + Exonic
1102310438 12:111840898-111840920 GAGGTTGGAGATGTGGGCAGGGG - Intergenic
1102556665 12:113731227-113731249 CAGCCTTGAGATCTTGGCAGAGG - Intergenic
1103932546 12:124458262-124458284 CTGCGAGGAGATCTTGGCAAAGG - Intronic
1105627686 13:22129062-22129084 AACCTTGGAGATGCTGGCAGGGG + Intergenic
1110654346 13:77979082-77979104 CATCTTTGAGATTTTGACAGGGG + Intergenic
1113636554 13:111922987-111923009 TAGCTTAGAGATCTCGGCTGTGG + Intergenic
1114083399 14:19220120-19220142 CAGCTGGAAGAGCTGGGCAGTGG + Intergenic
1115516731 14:34192623-34192645 AAGCCTAGAGATCTGGGCAGTGG - Intronic
1119121662 14:72084969-72084991 CAGCTTGGATTTATTTGCAGGGG + Intronic
1121873617 14:97431283-97431305 CAACGTGGAGAGCTTGGAAGAGG + Intergenic
1122261526 14:100526009-100526031 CTGGTTGGAGATTTTGGCAGAGG - Exonic
1122483668 14:102063959-102063981 CAGCCTGGAGGTCAAGGCAGAGG - Intergenic
1202895013 14_GL000194v1_random:1889-1911 CAGCTGGAAGAGCTGGGCAGTGG + Intergenic
1123874087 15:24606373-24606395 CAGCCTGGAGATCGTGGGTGGGG + Intergenic
1124014811 15:25865321-25865343 CAGCTTGGAGACCTTTCCAGAGG - Intergenic
1125749132 15:42016927-42016949 CACCTTGGAGGTCTGGCCAGAGG - Intronic
1127690803 15:61395039-61395061 CAGCTTGGAGACCTTTGCTAGGG - Intergenic
1127955166 15:63847057-63847079 CAGCATGGAGATCTTGGGGCTGG - Intergenic
1128386945 15:67156420-67156442 CAGCTTCAAGATCTGGGCATAGG + Intronic
1128835533 15:70806376-70806398 CAGCTTGGAGGTGTTGGCTAAGG + Intergenic
1129597927 15:76979384-76979406 CAGCTCGGACAACTTGGCATTGG + Intergenic
1131149336 15:90037091-90037113 CAGCTTGGAGGACCTGGCAGGGG + Intronic
1134016364 16:10891255-10891277 CAGCCTGGGAGTCTTGGCAGGGG + Intronic
1134513244 16:14865715-14865737 CAGCTTGGGGCTGCTGGCAGTGG + Intronic
1134700881 16:16264204-16264226 CAGCTTGGGGCTGCTGGCAGTGG + Intronic
1134970943 16:18530455-18530477 CAGCTTGGGGCTGCTGGCAGTGG - Intronic
1135065564 16:19306789-19306811 CAGGTTGCAGAGCTAGGCAGTGG + Intronic
1140007329 16:71091446-71091468 CAGTTTGGAGAGCTGTGCAGTGG - Intronic
1140753718 16:78048831-78048853 CAGCTTGGACAGCTTGGCGTTGG + Intronic
1141813846 16:86395780-86395802 CAGCTGGGAGATCTTGGTGCTGG + Intergenic
1144235153 17:13253573-13253595 CAGAGGGGAGATGTTGGCAGAGG + Intergenic
1147862171 17:43530067-43530089 CAACATGGAGGGCTTGGCAGGGG + Intronic
1150069544 17:62139544-62139566 CAGCTTGGAGGTGTTGACCGGGG + Intergenic
1151260977 17:72915668-72915690 CACCTTGGGAATCCTGGCAGTGG + Intronic
1151453177 17:74211738-74211760 CAGCTTGGAGACTGCGGCAGGGG - Intergenic
1151548648 17:74808609-74808631 AAGCTTGGAGAGCTTGGGAAGGG + Intronic
1152282077 17:79390774-79390796 CAGGGTGGGGATCCTGGCAGTGG + Intronic
1153815753 18:8788655-8788677 CAGATTGCAAATCTGGGCAGTGG + Intronic
1154500082 18:14991783-14991805 CAGCTGGAAGAGCTGGGCAGTGG + Intergenic
1156263548 18:35466721-35466743 CAGCAGGGAGAGCCTGGCAGGGG + Intronic
1160151334 18:76396711-76396733 CAGCTTGAATATCTTTCCAGGGG - Intronic
1160727667 19:624740-624762 CAGCTTGGAGGTGTTGACCGGGG + Exonic
1161513462 19:4684036-4684058 CAGCATTGAAATCGTGGCAGTGG - Intronic
1163170076 19:15525181-15525203 CTGGTTGGAGATCATGGCTGGGG + Intronic
1164738511 19:30559832-30559854 CAGCTTGGAGATCCCGTTAGGGG - Intronic
1167218621 19:48182628-48182650 CTGCTTGGAGATCTTGTTGGTGG - Exonic
1167258596 19:48444788-48444810 CCGGCTGGAGATCTGGGCAGAGG - Exonic
1167509497 19:49888576-49888598 CAGCCTGGAGATCCTGCCCGAGG + Exonic
1167528552 19:50000687-50000709 CAGCTGGGAGAGCTCGGCCGGGG - Intronic
1168405493 19:56108284-56108306 GAGCTGGGAGTTCTGGGCAGGGG - Intronic
927498592 2:23566624-23566646 AAGCTTGAAGCTCTTAGCAGTGG - Intronic
928225754 2:29446606-29446628 CAGCTTGGAGATCTTGGCAGTGG - Intronic
928557459 2:32442703-32442725 CAGTTTGGAGAATTTGGCAAGGG + Intronic
929763185 2:44822896-44822918 CAATTTGGATCTCTTGGCAGAGG - Intergenic
929780678 2:44955052-44955074 CAGCTTGGCGATCTTGTTATTGG + Intergenic
934573466 2:95385801-95385823 CAGCTGGGAGGGCTGGGCAGCGG - Exonic
935324898 2:101927257-101927279 CATTTTGGAGATCTTCACAGCGG + Intergenic
935838481 2:107080965-107080987 CAGCCTGGAGATCAGAGCAGAGG + Intergenic
937148063 2:119664316-119664338 CAGCTTGGAGCTTCAGGCAGTGG - Intergenic
941693067 2:168521741-168521763 GACCTTGGAAATCTTTGCAGGGG - Intronic
942849064 2:180461407-180461429 CAGCTTGGACATTCAGGCAGGGG + Intergenic
944763445 2:202840715-202840737 CAGCTCGGAGAGCTTGGCATTGG + Intronic
948892652 2:240914913-240914935 CACCTTGGAGATGCTGTCAGGGG - Intergenic
1168837934 20:890231-890253 CAGCTTGCGGATCTGGGCAGTGG + Exonic
1169132277 20:3172580-3172602 CATCTTGGAGCACTTGGCTGAGG + Intronic
1169355166 20:4899332-4899354 CAGCTTGGACAACTGGGTAGGGG + Intronic
1170297450 20:14843972-14843994 CAGCTTGGTGATGGTGGAAGTGG - Intronic
1170872344 20:20218041-20218063 CAGCTTGGAGAAAGTGACAGTGG - Intronic
1171225927 20:23442179-23442201 TAGCTGGGTGATCTTGGCATGGG + Intronic
1171947938 20:31395242-31395264 CAGCTAGGAGATCTGGGCCAAGG + Intergenic
1172112847 20:32557531-32557553 GAGGTTGCAGAGCTTGGCAGTGG - Intronic
1172814532 20:37675885-37675907 CAGCTTGGGGATTTTGGTAATGG + Intergenic
1176035358 20:63033767-63033789 CATCTTGGAGAACAGGGCAGGGG - Intergenic
1176217344 20:63954484-63954506 CAGCTTGGAGGTCTGTGCACGGG - Intronic
1176614716 21:9017876-9017898 CAGCTGGAAGAGCTGGGCAGTGG + Intergenic
1176710495 21:10145995-10146017 CAGCTGGAAGAGCTGGGCAGTGG - Intergenic
1177955847 21:27598113-27598135 CAGCTTGGAGAACTAGACACTGG - Intergenic
1178240570 21:30894895-30894917 CAGCTTGGACAACTTCACAGTGG - Intergenic
1179433636 21:41344489-41344511 CAGCTGGGAAATGTTGCCAGAGG + Exonic
1180294576 22:10873147-10873169 CAGCTGGAAGAGCTGGGCAGTGG - Intergenic
1180497382 22:15902561-15902583 CAGCTGGAAGAGCTGGGCAGTGG - Intergenic
1184556340 22:45235272-45235294 CTGCATGGACATCTTTGCAGCGG - Intronic
1184967913 22:47995205-47995227 CAGCTGGAAGGTCTTGGCTGTGG - Intergenic
949127494 3:463958-463980 CAGCTTGGAGACCTGAGCGGGGG + Intergenic
949386482 3:3508033-3508055 CAGCCTGGAGATGCTGGTAGTGG + Intergenic
950720260 3:14877418-14877440 CAGCTTGGAGATTGTAACAGTGG + Intronic
953707765 3:45244099-45244121 CAACCTGGAGGTCTTGGCACTGG - Intergenic
954128664 3:48548344-48548366 CAGCTTGGGGTTGTTGGCTGAGG + Intronic
955789532 3:62574039-62574061 AAGCTTGAAGAACTTGGCAATGG - Intronic
960146757 3:114212071-114212093 CAGCTTCGAGACCTTGCCTGAGG + Intergenic
962413679 3:135163352-135163374 CAGGTTAGAGATATTGGAAGTGG - Intronic
964010005 3:151881236-151881258 CAACTTGGTCATCATGGCAGTGG + Exonic
964088836 3:152849572-152849594 CAGTTTGGAGATCTGGCAAGGGG + Intergenic
964802249 3:160568869-160568891 CAGCTTGGAGAGCTTGGCATTGG - Intergenic
965242823 3:166225860-166225882 CTGCTATGAGATCTTGGCAAGGG + Intergenic
965784709 3:172323613-172323635 CATCTTGGAGATGTTTTCAGGGG + Intronic
966985156 3:185173211-185173233 AAGCTTACAGCTCTTGGCAGGGG - Intergenic
967949657 3:194831036-194831058 CAGTTTGGAGCTCATTGCAGAGG + Intergenic
969174054 4:5385655-5385677 CGACCTGGAGATCTTTGCAGAGG - Intronic
973980421 4:56304110-56304132 CAGCTGGGGGATGTTGGCAGGGG - Intronic
974156770 4:58083569-58083591 CAGATGGGAGATGTTGGTAGAGG + Intergenic
977928671 4:102729106-102729128 CAGCTTGGACAGCTTGGCGTTGG + Intronic
985658157 5:1142714-1142736 CTGCCTGGAGTTCTGGGCAGTGG - Intergenic
988597310 5:32606896-32606918 CAATTTGGAGAGCTTGGCTGTGG - Intergenic
991468747 5:66944768-66944790 CAGCCAGGAGAGCTTGGAAGAGG - Intronic
996082498 5:119271291-119271313 CGGCTTGGAGAACTTCACAGAGG + Intronic
997588698 5:135059986-135060008 CAGTTTGGACATCATGGCATTGG + Intronic
998331178 5:141328568-141328590 CAGCATGGAGATCAAGGCAACGG - Intergenic
998413882 5:141931294-141931316 GAGCTTAGAGATCTTGGGAAGGG + Intronic
998979213 5:147682264-147682286 CAGCTTGGAGAGGTAAGCAGTGG + Intronic
999719234 5:154386385-154386407 AGGCTTGGAGATCTGGGGAGGGG + Exonic
1001604743 5:172951625-172951647 GTGGTGGGAGATCTTGGCAGTGG - Exonic
1003241321 6:4347993-4348015 CAGCATGGAGAAATGGGCAGAGG + Intergenic
1003924517 6:10864339-10864361 CAGCTGGAAGAGCTGGGCAGAGG - Intronic
1005315506 6:24599398-24599420 CAGCTTGGACAGCTTGGCATTGG - Intronic
1005952964 6:30644967-30644989 AAGCTTTGACATCTTGGCAAAGG - Intronic
1006247889 6:32756376-32756398 CAGCTAGGAATTCTGGGCAGGGG + Exonic
1007173505 6:39880762-39880784 CAGATTGGAGATGTTATCAGAGG - Intronic
1015496621 6:133889729-133889751 CAGCTTGGAGAGCTTGGTGTCGG - Exonic
1015769587 6:136754869-136754891 AAGCATCGAGATCTTGTCAGTGG - Intronic
1018064027 6:160113338-160113360 CAGCTTGGAGATGGCAGCAGAGG + Intronic
1019221087 6:170473358-170473380 CAGCTTGTACCTCCTGGCAGTGG - Intergenic
1022477031 7:30717899-30717921 CAGCTAGGAAATCTTGGAATAGG + Intronic
1025780715 7:64599544-64599566 CACCTTGGTGATGTTTGCAGAGG - Intergenic
1026205279 7:68251875-68251897 CAGCTTTGAGAGCTTCCCAGGGG - Intergenic
1026382954 7:69817679-69817701 AAGCGTGGAGAGCTGGGCAGAGG + Intronic
1029379300 7:100202319-100202341 CAGCCGGGAGACCTGGGCAGTGG + Exonic
1032073838 7:128826797-128826819 CAGCCTGGAGATCCAGGCAGTGG + Intergenic
1032362954 7:131273102-131273124 TAGCTGGGTGATCTTGGCAAAGG - Intronic
1032846601 7:135756779-135756801 CTGCTTGGTCATCATGGCAGAGG + Intergenic
1033042823 7:137933796-137933818 CAGCTGGGTGTCCTTGGCAGTGG + Intronic
1033266934 7:139894845-139894867 CAGCATGGAGCTCATGGCAGTGG + Intronic
1035136999 7:156713445-156713467 CTGGTGGGAGATGTTGGCAGTGG + Intronic
1038397986 8:27261243-27261265 CAGCTTGCAGGTCCTGGCAGTGG - Intergenic
1039089535 8:33813532-33813554 CAGCTTGAAGATTTTTGCAGAGG + Intergenic
1040586692 8:48750109-48750131 CAGTCTGGAGATCCAGGCAGAGG + Intergenic
1041472404 8:58225365-58225387 CAGCCCTGAGACCTTGGCAGTGG - Intergenic
1045830845 8:106458576-106458598 CAGTTCTGAGATCTTGGAAGTGG - Intronic
1045846278 8:106640002-106640024 CATCTTGGAATTCCTGGCAGTGG - Intronic
1048734990 8:137489055-137489077 CAGAGTGGAGATCTTGGCTTTGG - Intergenic
1049454273 8:142679055-142679077 CAGCTGGGAGGTGGTGGCAGTGG - Intronic
1052274028 9:26657982-26658004 CCTCTTGGAGCTCTTGGCACAGG + Intergenic
1052304313 9:26988289-26988311 CTCCTTGGGGATGTTGGCAGGGG + Intronic
1053647473 9:40131693-40131715 CAGCTGGAAGAGCTGGGCAGTGG - Intergenic
1053758255 9:41332150-41332172 CAGCTGGAAGAGCTGGGCAGTGG + Intergenic
1054328455 9:63729647-63729669 CAGCTGGAAGAGCTGGGCAGTGG - Intergenic
1054537106 9:66244477-66244499 CAGCTGGAAGAGCTGGGCAGTGG + Intergenic
1055922204 9:81472762-81472784 CAGCTTTGAGAACTAAGCAGAGG + Intergenic
1059694908 9:116721792-116721814 CTGCCTGGAGATCTTACCAGTGG + Intronic
1060811903 9:126614888-126614910 CACCTTGGCGAGCTTGGGAGAGG + Intronic
1202795258 9_KI270719v1_random:114990-115012 CAGCTGGAAGAGCTGGGCAGTGG - Intergenic
1186106581 X:6214020-6214042 CAGCTTGACGACCTTGTCAGTGG - Intronic
1189216283 X:39327588-39327610 TAGCTTGGAGATCTGCCCAGAGG + Intergenic
1189354814 X:40302476-40302498 TAGCAAGGAGATCTTGGCTGGGG + Intergenic
1190268261 X:48842660-48842682 CAGCTGGCAGATCTAGGCAAGGG - Intergenic
1190418392 X:50203592-50203614 CATTTTGAACATCTTGGCAGTGG + Intronic
1191220765 X:57985727-57985749 CAGCTGGGAAAGCTTGGCATTGG - Intergenic
1192436303 X:71145589-71145611 CAGGATGGAGATCTTGGCCTTGG + Intronic
1195616472 X:106916432-106916454 CAGTTTGGAGAGCTAGGTAGGGG + Intronic
1196574492 X:117302331-117302353 GAGCAGGGAGATCTTGCCAGTGG - Intergenic