ID: 928229228

View in Genome Browser
Species Human (GRCh38)
Location 2:29482046-29482068
Sequence CTTTTCCCATTTGAGATCTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 367
Summary {0: 1, 1: 0, 2: 2, 3: 25, 4: 339}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
928229228 Original CRISPR CTTTTCCCATTTGAGATCTG TGG (reversed) Intronic
900393332 1:2443295-2443317 CCTTCCCCATTTGAGGACTGGGG - Intronic
902083737 1:13840220-13840242 CTATTCCCATTTTAGAGATGAGG + Intergenic
903134688 1:21301929-21301951 CTGTTCCCATTTGACAGATGAGG + Intronic
904505967 1:30954354-30954376 GTTTTCCATTCTGAGATCTGCGG + Intronic
904535937 1:31199425-31199447 CTTTTCCCAATGGATTTCTGAGG + Intronic
905338357 1:37260730-37260752 CTGTTCCCATTTGGGAGATGAGG - Intergenic
905787152 1:40767421-40767443 ATTTTCCCAAATGAGATCTTTGG - Intronic
906105223 1:43287500-43287522 CTTTTGCCATTTTAGATATGGGG - Intergenic
906290854 1:44618450-44618472 ACTTTTCCATTTGAGATCAGAGG + Intronic
906873719 1:49513017-49513039 CTTTTCCCATTTGTAACATGGGG - Intronic
907240869 1:53080335-53080357 CTCTGCCCATTTGAGATCTTTGG + Intronic
908139966 1:61174117-61174139 CTTTTCCCCCTTCAGATGTGAGG + Intronic
908569337 1:65392425-65392447 CTTCTCCGATTTCTGATCTGAGG - Exonic
909939520 1:81594585-81594607 CTTTTCCTATTTAAAATCAGTGG + Intronic
910094127 1:83500443-83500465 CTTTTATCATTTGAAATCTTTGG + Intergenic
910601559 1:89038160-89038182 ATGTTCCAATTTGTGATCTGAGG - Intergenic
911052874 1:93686542-93686564 CTTTTCTCATTTGTGAAATGGGG - Intronic
911243713 1:95493627-95493649 CTATTCCCATTTTAAATATGGGG + Intergenic
911550992 1:99280289-99280311 GTTTTCTCATTTGTAATCTGGGG + Intronic
912159481 1:106964195-106964217 CTTTTCCCATGTGCTTTCTGAGG - Intergenic
912252441 1:108025597-108025619 CTTTTCCCATCTGAAAAATGGGG + Intergenic
912565565 1:110585003-110585025 ATGGTCCCATTTTAGATCTGGGG + Intergenic
912800465 1:112716663-112716685 TTGTCCCCATTTGAGATGTGTGG - Intergenic
914726162 1:150329662-150329684 CTTTTACCATTTAATATTTGAGG + Intronic
914755806 1:150561094-150561116 GTTCTCCCATTTGAGGTGTGGGG + Intergenic
914852074 1:151322209-151322231 CTTTGCCCAGTTGGGAGCTGTGG - Intronic
914879184 1:151534752-151534774 CTTTTCCCATTAGAGAAATAAGG + Intronic
915637512 1:157196813-157196835 TTTTTCCCATTTTACATATGAGG + Intergenic
916722429 1:167494475-167494497 GTTTTCCCATCTGTGATATGGGG + Intronic
916799142 1:168198393-168198415 TTTTTCCCATTTAAGATTTTTGG - Intronic
918283823 1:183032258-183032280 CTTCTCCCACAAGAGATCTGAGG - Intronic
920929877 1:210377355-210377377 TTTTTCCAATTTGAGAGATGTGG + Intronic
921994637 1:221404901-221404923 CTTTTACCATTTTTCATCTGAGG + Intergenic
922919152 1:229286306-229286328 CTTTTCACATTTAAGATATTTGG - Intronic
923436848 1:233975513-233975535 CTTTCCCCATTTGACAAATGAGG + Intronic
923496794 1:234532763-234532785 CTGTTCCCATTTTAGAAGTGAGG + Intergenic
1066092165 10:32033753-32033775 CTTTTCTCATTTCAGTGCTGTGG - Intronic
1066182010 10:32971747-32971769 CTTTTGCCCTTTGATCTCTGTGG - Intronic
1066235617 10:33481486-33481508 CTTATCCTAATTGAGCTCTGGGG + Intergenic
1066326883 10:34369192-34369214 CTTGTCCAACCTGAGATCTGTGG + Intronic
1068036295 10:51764154-51764176 CTTTTCCTGTTTGTGTTCTGAGG - Intronic
1068437164 10:57007519-57007541 ATTTTCCAATCTGAGATATGAGG + Intergenic
1068999890 10:63251211-63251233 CTTTTCCCATTTGCCATTTATGG - Intronic
1069713340 10:70504797-70504819 CTTTTCACATTACATATCTGTGG - Intronic
1069843978 10:71358059-71358081 ATTTTCTCACTTGAGAGCTGGGG + Intronic
1071094268 10:81955292-81955314 TATTTCCCAGTTGAAATCTGAGG + Intronic
1071194942 10:83147715-83147737 AGTTTCACATTTGACATCTGGGG - Intergenic
1071264425 10:83952016-83952038 CTATTCCCATTTTACAGCTGAGG + Intergenic
1071268579 10:83986110-83986132 CTTATCCCATTTGGGAACTTGGG - Intergenic
1071480889 10:86064210-86064232 TTTTTCCCATTTTATAGCTGAGG + Intronic
1071689642 10:87803372-87803394 CTTTTCCCTTTAGTGATTTGGGG - Intronic
1072289693 10:93952626-93952648 CTTTTCACTTGTGGGATCTGAGG - Intronic
1072901475 10:99411323-99411345 CTTTTCCACTTTCAGATCTTAGG - Intronic
1073348129 10:102799927-102799949 CTTTTCCCTTTTGAGGACTGAGG + Intronic
1073810190 10:107144044-107144066 CTGTTCCCTTTTGTGCTCTGAGG + Intronic
1074897459 10:117789839-117789861 GTTTTCCCATCTGTAATCTGGGG - Intergenic
1075372775 10:121951807-121951829 CTTTTTCCACTTGAGATTTTAGG - Intergenic
1075493016 10:122890379-122890401 CTTTCCCCATTTCAGCTTTGGGG - Intergenic
1076056309 10:127376163-127376185 CTTTTCCCATTAGAGCCCTTAGG - Intronic
1078266752 11:9760560-9760582 CTGGTTCCACTTGAGATCTGGGG + Intergenic
1078847120 11:15128457-15128479 CTTTTCTCATTTGCAAACTGGGG - Intronic
1079018936 11:16893393-16893415 CTTTTCCCATTTTATAGATGAGG - Intronic
1079216688 11:18519429-18519451 TTTTTTCCATTTGAGGTTTGTGG - Intronic
1079383307 11:19957853-19957875 CATTTGCCATTAGACATCTGTGG - Intronic
1079603892 11:22342498-22342520 CTTTTCCCGCCTGAGAACTGGGG - Intronic
1079653147 11:22956222-22956244 CTTTTCCCATTTAACAGCTCTGG - Intergenic
1080208723 11:29760162-29760184 CTTCTCTCAGTTCAGATCTGTGG - Intergenic
1081273712 11:41120667-41120689 CCTTTCCCCTTTCAGATCTAAGG + Intronic
1081491459 11:43572593-43572615 TTTTTCCCATTTGAAAGCTAGGG - Intronic
1081563941 11:44244658-44244680 GTTAGCCCATTTGAGGTCTGGGG + Exonic
1081744407 11:45462904-45462926 CTTTTCCCAGGTGAGGGCTGTGG - Intergenic
1081795651 11:45817507-45817529 CTTTTCCTACCTGAGATATGGGG + Intergenic
1081902978 11:46645690-46645712 CTTTTTCAACTTGAGATTTGGGG + Intronic
1082769949 11:57200114-57200136 CTTCTACCATTTGTGATATGTGG + Intergenic
1083277062 11:61602889-61602911 TTTTTCCCATCTGAGGCCTGGGG - Intergenic
1083446979 11:62714703-62714725 CCTTTCCCTTTTGGGATATGTGG - Exonic
1083481098 11:62947595-62947617 CTTCTCCCATTTAATCTCTGAGG - Intronic
1084149975 11:67283566-67283588 GTTCTCCCATTTGAGAGATGAGG + Intronic
1084413102 11:69015192-69015214 CTTTTCCCATCTGACAGCTGAGG - Intergenic
1086267468 11:85018550-85018572 ACTTTCCCATGTGAGATCCGTGG - Intronic
1086447890 11:86887338-86887360 CATTTCCCATTTCACATCTTGGG - Intronic
1086602483 11:88651493-88651515 CTTTTCTCTCTTGAGATTTGGGG - Intronic
1087050209 11:93879189-93879211 CTTTTCCCTTTAGTGATTTGGGG + Intergenic
1087073600 11:94106663-94106685 GTTTTCTCATTAGTGATCTGGGG + Intronic
1087305433 11:96484294-96484316 CTTTTCAACTTTGACATCTGCGG + Intronic
1089138424 11:116267708-116267730 CTATTCCCATTTGACAGATGAGG + Intergenic
1089607641 11:119650965-119650987 ATTTCCCCATTTGAGAGTTGGGG + Intronic
1090105140 11:123845683-123845705 CTTTTGCCATTTTAGAGATGAGG - Intergenic
1090629863 11:128636714-128636736 ATTCTCCTCTTTGAGATCTGGGG - Intergenic
1090668099 11:128928297-128928319 CTTTTGCAATATGAGATCTCAGG + Intergenic
1091725972 12:2846548-2846570 CTTTGCCCATCTGAAGTCTGAGG + Intronic
1091908976 12:4213399-4213421 CTTATCCCATTTTATATATGGGG - Intergenic
1092044710 12:5422759-5422781 GTTTTCCAACTTGAGATATGGGG + Intergenic
1092286857 12:7133563-7133585 CCTTTGCCAGGTGAGATCTGCGG + Exonic
1092319030 12:7451793-7451815 TTTTACCCATTTTAGATTTGGGG - Intronic
1093334459 12:17885460-17885482 CACTTTCCATTTGAGATCCGTGG - Intergenic
1094038015 12:26091185-26091207 CTTTTCCCATTTGGGGAATGAGG + Intergenic
1094214328 12:27924383-27924405 ATTATGCCATTTGAGAACTGAGG + Intergenic
1095137554 12:38624111-38624133 TTTTTCCCATTTTATATGTGAGG - Intergenic
1095785315 12:46102611-46102633 CCTTTCCCGTTTGAGAGCCGGGG + Intergenic
1096310266 12:50514542-50514564 CTCTTCTCTTTTGAGATCTTGGG + Intronic
1098305611 12:69099606-69099628 CTTCTCTCCTTTCAGATCTGTGG - Intergenic
1099510854 12:83535215-83535237 CTTTCCTCATTTGAGAGATGGGG + Intergenic
1099703246 12:86116516-86116538 GTTTTCCAATTTAAGAACTGAGG - Intronic
1099807765 12:87542155-87542177 CTTTTGCCATGTGACATGTGTGG + Intergenic
1100207747 12:92369501-92369523 CTTTTCCCATTTGGGAAATGGGG - Intergenic
1100435223 12:94565052-94565074 CTTTTGTCATTTGATGTCTGAGG - Intergenic
1100514724 12:95316267-95316289 CTTTTACCACTTGATCTCTGTGG + Intergenic
1101415680 12:104506359-104506381 TTGTTCCCATTTTAGATATGAGG - Intronic
1101442194 12:104712199-104712221 CTATTCCCATTTGACACCTGAGG + Intronic
1101842490 12:108338254-108338276 CTTTTTCCAATTGATATCTAAGG - Intronic
1102563949 12:113782592-113782614 GTTTCCCCATTTGTAATCTGGGG - Intergenic
1103525016 12:121561791-121561813 TTTTTCCCATTTGTGAAATGGGG + Intronic
1103859893 12:124003866-124003888 CAGTGCCCATTTGAGATGTGTGG + Intronic
1103935650 12:124475114-124475136 CTGTTACCATGTGAGATGTGGGG + Intronic
1104021602 12:124995710-124995732 CTGTTCCCATTTGACAGATGAGG + Intronic
1104116831 12:125757730-125757752 TTTTTCCCCTTTGTGACCTGAGG + Intergenic
1104260504 12:127177781-127177803 ATTTTCCCATCTGAGCTGTGAGG + Intergenic
1106132354 13:26950954-26950976 CTTTTCACATTTGAGACTTAGGG + Intergenic
1106563255 13:30864421-30864443 CTTTTCCCGTTTGGGAGGTGAGG + Intergenic
1107839533 13:44441561-44441583 CTTTTTCCATTTTAGATGTTAGG - Intronic
1108350514 13:49586429-49586451 CCTTTCCCATTTGAGCTCCTAGG + Intergenic
1109890582 13:68607288-68607310 CTTTTACCCTTTCAGATCTCAGG + Intergenic
1110467828 13:75823124-75823146 GTTTTACCATGTAAGATCTGGGG - Intronic
1112155524 13:96812732-96812754 CTTTTCCTGTTTTAGATATGAGG + Intronic
1112787775 13:102970265-102970287 CTTTTATCTTTTGAGATCTTTGG + Intergenic
1113059455 13:106306562-106306584 CTTTTACCATTTAAGATCAGGGG - Intergenic
1113893325 13:113748059-113748081 CTTATCCCATTACAGCTCTGGGG + Intergenic
1114398493 14:22388135-22388157 CCTTTCCCATTTGGGATTTGTGG - Intergenic
1117061604 14:51969652-51969674 TTTTTCCTATATAAGATCTGTGG + Exonic
1117786556 14:59291901-59291923 CACTTCCCATTTAAGATCTAGGG + Intronic
1118436351 14:65774206-65774228 CTTTTTCCAATAGGGATCTGTGG - Intergenic
1118536142 14:66767227-66767249 CTCTTCCCATTAGAAGTCTGAGG - Intronic
1119903865 14:78284125-78284147 CTTTTCCCTTTAGTGATTTGGGG - Intronic
1120330723 14:83090197-83090219 CTTTACCCATTTAAGATCATAGG - Intergenic
1121444487 14:93969965-93969987 CTTTTCCCATTTCACAGATGTGG - Intronic
1122186254 14:99999382-99999404 TTTTTCCCATTTGATAAATGAGG - Intronic
1123706035 15:22951683-22951705 CTGTTGCCATGTGGGATCTGTGG - Intronic
1125888805 15:43250353-43250375 CTTTCCCCATTGTACATCTGAGG + Intronic
1126810927 15:52403070-52403092 GTTTTCCTATTTGAGATGTCTGG - Intronic
1127344958 15:58085249-58085271 CTTTCCCCATTTTATATATGAGG - Intronic
1128630015 15:69255359-69255381 CGTTTCAGATTTTAGATCTGGGG + Intronic
1129518234 15:76169979-76170001 CTTCTCCCACTTGACCTCTGTGG + Intronic
1129607512 15:77032036-77032058 CTTTTCCCATTGGATAGATGAGG - Intronic
1131235419 15:90692700-90692722 CCTTTCCCATTTGACCTATGAGG + Intergenic
1135488832 16:22889656-22889678 CTTTCTCCATTTTAGATGTGTGG + Intronic
1135693919 16:24570034-24570056 CTTTTCTGATTTGACATCTTTGG - Exonic
1135876985 16:26211386-26211408 TTCTTTCCATTTGAAATCTGGGG - Intergenic
1136046866 16:27622119-27622141 CTGTACCCAGTGGAGATCTGAGG + Intronic
1137530167 16:49274548-49274570 TTGTTCCCATTTGAAATGTGAGG + Intergenic
1138079046 16:54071506-54071528 CTTGTATCATTTGAGCTCTGTGG + Intronic
1138491086 16:57377119-57377141 CTTTTCCCATCTTGGATTTGGGG + Intronic
1141230654 16:82164226-82164248 CTTTTCCCATTTTAGAACTGAGG + Intronic
1142350529 16:89577310-89577332 CTTTCCCCATCTGTGATCTGAGG + Intronic
1143290620 17:5825258-5825280 CCTTTCCCACTTTAGATTTGGGG - Intronic
1143723751 17:8831527-8831549 CTTTTTCCATGTGGGATCAGAGG + Intronic
1144271499 17:13621736-13621758 CTTGTCCCATTTTACATGTGAGG + Intergenic
1148730383 17:49831624-49831646 ATTTTCCCATTTCTTATCTGGGG + Exonic
1149617077 17:58009664-58009686 CTTTTTCCTTTTGGGATCTATGG - Intergenic
1151352593 17:73540677-73540699 CTCTTCCCATTTGATAAATGAGG + Intronic
1156222235 18:35064248-35064270 CTGGTCCCATTTGAGGTGTGTGG - Intronic
1156878803 18:42050286-42050308 CTTTTCCCCTTGGAGTTCTATGG + Intronic
1156892804 18:42209330-42209352 CTATTCCCATTTTAGAGATGAGG + Intergenic
1157146474 18:45167866-45167888 CATTTCCCAGTTAAGTTCTGTGG + Intergenic
1158405758 18:57157789-57157811 GTTTTCCCATTTGTGAAGTGAGG + Intergenic
1159102510 18:63971427-63971449 CTTGTTCCATTTGAGATGCGTGG - Intronic
1159619578 18:70621828-70621850 CTTTTCCTCCCTGAGATCTGTGG - Intergenic
1160606404 18:80053231-80053253 CTTTTCCCATTTGGATTTTGTGG - Intronic
1160965440 19:1745216-1745238 CTATTCCCCTCTGAGAGCTGGGG + Intergenic
1161160708 19:2760591-2760613 CTTTTCCCTTCAGACATCTGGGG - Intronic
1161566850 19:5007142-5007164 CATCTCCCATTTGAGAGTTGGGG + Intronic
1164981833 19:32619934-32619956 CTGTTCCTACTTGAGACCTGTGG - Intronic
1167991060 19:53361015-53361037 CTGTTTCCATGTGACATCTGTGG - Intergenic
925692818 2:6542212-6542234 CTTTTCCCATTAGATATGTCAGG - Intergenic
926299902 2:11595134-11595156 CATTTCCCATCTGGAATCTGTGG - Intronic
926743732 2:16133627-16133649 ATTTTACCATTTTACATCTGAGG - Intergenic
926782257 2:16484241-16484263 GTTTTACCATTAAAGATCTGTGG + Intergenic
928229228 2:29482046-29482068 CTTTTCCCATTTGAGATCTGTGG - Intronic
928688777 2:33777188-33777210 CATTTCCCACTTTAGGTCTGTGG + Intergenic
929859997 2:45668724-45668746 CTATTCCCATTTTACAGCTGAGG - Intronic
930270957 2:49256237-49256259 TTTTTCCCATTTTAGAGATGAGG + Intergenic
930301821 2:49625928-49625950 ATTTTCCCATTGTAGAGCTGAGG - Intergenic
932269571 2:70397910-70397932 CTTTACCCATTTGACAGATGGGG + Intergenic
932860365 2:75285333-75285355 TTTTCCCCATTTTAGAGCTGAGG + Intergenic
935329365 2:101965270-101965292 TTTTTCTCATGTGGGATCTGAGG + Intergenic
935358813 2:102230252-102230274 CTTTTCCCATTTTCTATCTATGG + Intronic
938164509 2:129015071-129015093 GTTTTCCCATTTAAGGTCAGTGG + Intergenic
939023988 2:136990101-136990123 ATTTTCTCATTTAAGAACTGAGG + Intronic
939531657 2:143370768-143370790 CTTTTCCCAGTGGTGATGTGTGG + Intronic
939776113 2:146390474-146390496 CTTTTAGCATTTGCCATCTGTGG + Intergenic
940641234 2:156346384-156346406 CTTCTCTCGTTTAAGATCTGAGG - Intergenic
940728116 2:157358952-157358974 CTTTTCCAAATTGTGTTCTGTGG - Intergenic
941032923 2:160533448-160533470 ATTTTACCAGTTGAGAGCTGTGG + Intergenic
942579520 2:177402570-177402592 CTTTTTACTTTTGAGAACTGGGG + Intronic
942604302 2:177674218-177674240 TTTTTCCCATTTGTGAAATGGGG + Intronic
943438744 2:187899987-187900009 CTTTTTCAATTTGAGTTCTTGGG - Intergenic
944359483 2:198836061-198836083 CTTTTCCCATTTTTAAACTGAGG - Intergenic
944416339 2:199483430-199483452 CTTTTCCCATTTTACAGATGAGG + Intergenic
945170501 2:206989939-206989961 TTTTTCCCAAATGAAATCTGGGG - Intergenic
945562516 2:211356105-211356127 CTTTTCCTTTTTGAGAGATGGGG - Intergenic
946736521 2:222759362-222759384 ATTTTCCCATTTATTATCTGGGG + Intergenic
947510650 2:230750837-230750859 CTTTTCCCATTTTAGAGATAAGG + Intronic
1169221139 20:3823759-3823781 GTTTTCTCACTTGAGATATGGGG + Intronic
1169365607 20:4989775-4989797 AGTTTCCCATTTTAGATTTGGGG + Intronic
1169679067 20:8189242-8189264 CTTTTGCCATTGGAGAGTTGGGG + Intronic
1170443742 20:16404003-16404025 CTATTCCCATTTTACATGTGGGG - Intronic
1172906157 20:38370965-38370987 CTTTAACAATTTGAGATTTGTGG - Intronic
1173329295 20:42061003-42061025 TTATCCCCATTTGAAATCTGGGG - Intergenic
1174977752 20:55353356-55353378 CTTTTCCCCATGGAAATCTGAGG - Intergenic
1177485846 21:21755177-21755199 CCTTTCCCATTTGTAATCAGAGG - Intergenic
1178013072 21:28308977-28308999 ATTTTTGCATTTGAAATCTGAGG + Intergenic
1178799757 21:35781752-35781774 CATTTCCCTTTTGAGTTCTTTGG + Intronic
1181519995 22:23441039-23441061 CTTGTCCTGTTTCAGATCTGAGG + Intergenic
1181930145 22:26394320-26394342 TTTTTCCCATTGGAAAACTGAGG + Intergenic
1182060608 22:27394577-27394599 CTCTTCCCATTTTATATATGAGG - Intergenic
1182746663 22:32611238-32611260 CTTTGGCCATTTGAGAGCAGAGG + Intronic
1183481811 22:38069340-38069362 ATTTTCCCATCTGTGACCTGAGG - Intronic
1183615491 22:38942717-38942739 CTTTACCTATTAGAGATCTTTGG - Intergenic
1183685039 22:39356833-39356855 CTTTTCCCATTTGATAGATGGGG - Intronic
1183815441 22:40296265-40296287 TCTTTCCCATTTCTGATCTGAGG - Intronic
1183816451 22:40305769-40305791 CTTTTCTCATTAGAGACTTGGGG - Intronic
1183818262 22:40322139-40322161 CTTTCCCCATGTGAGTTATGAGG - Intronic
1184490870 22:44808136-44808158 CATTTCCCAGATGACATCTGAGG - Intronic
949778975 3:7664425-7664447 CTTTTCTCACTGGAGATCTGGGG + Intronic
950740172 3:15044525-15044547 CTTTTCCTGTTTGAGAACAGTGG + Exonic
950818814 3:15736005-15736027 GTATCCCTATTTGAGATCTGCGG - Intronic
951141744 3:19170009-19170031 ATGTTCCCATTTGAGATCTGTGG + Intronic
952682537 3:36111242-36111264 CTTGACCCATTGGAGAACTGAGG + Intergenic
953089458 3:39709313-39709335 CTTTTCCACTTTGATATCTAAGG + Intergenic
953146404 3:40279828-40279850 GACTTCCCATTTGAGATTTGTGG + Intergenic
953540257 3:43811752-43811774 ATTTTCTCATCTGAGAACTGGGG - Intergenic
953890108 3:46744903-46744925 CTCTTCCCATTTCAGAGATGGGG + Intronic
955211128 3:56942024-56942046 GTTTTCCCATTTGAAAACTGGGG + Intronic
956284272 3:67592139-67592161 ATTTTCCCACATGAGATCTTGGG - Intronic
956561415 3:70580362-70580384 CTTTTCCAATTTTAGAATTGTGG + Intergenic
956751658 3:72348320-72348342 CTATTCCCATTTGACAGATGCGG + Intergenic
956792530 3:72691157-72691179 CTTTTCCTATATGTGCTCTGTGG - Intergenic
957682079 3:83449891-83449913 CTTTTGGCATTTGAGATGAGGGG + Intergenic
960571877 3:119192460-119192482 GTGTGCCCATTTGAGCTCTGTGG - Intronic
960819878 3:121718129-121718151 CCTTTGCCATTTTAGATCTAGGG - Intronic
960878485 3:122320902-122320924 CTTTTCCTTTTTGAAAACTGAGG - Intergenic
961493018 3:127268434-127268456 CTTCTCTCCTTGGAGATCTGGGG + Intergenic
961831724 3:129626613-129626635 GACTTCACATTTGAGATCTGAGG + Intergenic
962175659 3:133151422-133151444 GTTTTCCCATTAAAGATCTCTGG - Intronic
963212425 3:142707996-142708018 ATTTCCCCATTTTAGATATGGGG - Intronic
964502251 3:157361396-157361418 CTTTTCCCACTTCAAATCAGAGG - Intronic
964911793 3:161791643-161791665 CTTTTGCCATATGATAACTGTGG + Intergenic
965983972 3:174728651-174728673 TTTTTCCCATTTCACATATGAGG + Intronic
967875094 3:194263186-194263208 GTTTGCCCATTTGAGATATGCGG - Intergenic
969513329 4:7632059-7632081 CTTTTCCCACCTGAGAAATGGGG + Intronic
970006050 4:11411929-11411951 ATTTTCCCATCTGAAATATGGGG + Intronic
970963031 4:21895777-21895799 CTTTTCCCATTCCCAATCTGAGG - Intronic
971025343 4:22584029-22584051 GTTTTCCCATTTTAAATCTGAGG - Intergenic
971159890 4:24122975-24122997 CCTTCCCCATTTGAGAACTGGGG - Intergenic
971395847 4:26226552-26226574 ATTTCCCCATTTTAGAACTGAGG - Intronic
971599977 4:28580510-28580532 CTTCTCCCAATTGCTATCTGTGG + Intergenic
973985301 4:56346377-56346399 CTTTACCCAGGTGAGTTCTGGGG - Intronic
977078628 4:92492600-92492622 CTATTTCCATATGATATCTGAGG + Intronic
977692878 4:99935706-99935728 CTTTTTCCTTTTGGCATCTGGGG + Intronic
978733446 4:112057985-112058007 CTTTGCCCTTTTGAATTCTGTGG - Intergenic
979761780 4:124414854-124414876 CTGTTCCCAGTTGGGTTCTGAGG - Intergenic
980476630 4:133326499-133326521 ATTTTACCATTTGAAATTTGAGG + Intergenic
983980844 4:173995151-173995173 CTTCTTCCATTTGAGATCTCTGG - Intergenic
984884073 4:184434583-184434605 CTTTACACCTTTGAGATTTGAGG + Intronic
985904892 5:2826188-2826210 CTTTACCTATTTGAGGTCTTTGG + Intergenic
988353906 5:30148022-30148044 CATTTCCCATTTGATATTGGTGG + Intergenic
989125387 5:38047662-38047684 CTGTTCTCATTTTAGAGCTGAGG - Intergenic
989265742 5:39471579-39471601 CTTTTCTCTTTTGACAACTGAGG - Intergenic
989695371 5:44194329-44194351 CTTTTTTCATTTCAAATCTGTGG + Intergenic
990544689 5:56811175-56811197 CTTTTTCCATTTGACCTTTGTGG - Intergenic
990975764 5:61560260-61560282 CTTTTGCCCTCTAAGATCTGAGG + Intergenic
991905617 5:71507252-71507274 CTTCTCAAATTTGTGATCTGAGG + Intronic
991913165 5:71581542-71581564 ATTTGCCGATGTGAGATCTGGGG + Intergenic
992484982 5:77185960-77185982 CTATTCCCATTTGACAGATGAGG - Intergenic
992573218 5:78081803-78081825 CTTTTCCCTTTTAAGTTCTGAGG + Intronic
993318494 5:86441976-86441998 CTTTTCCCATATTAGATATGTGG - Intergenic
994185391 5:96809453-96809475 CTTCTTCCCTTTGAGAACTGGGG + Intergenic
994338167 5:98593813-98593835 GTTTTCCCATTTGTGAATTGGGG - Intergenic
997238541 5:132290160-132290182 CTTTCCACATGAGAGATCTGTGG + Intronic
997465404 5:134084645-134084667 CCATTCCCATTTGAGAGATGGGG - Intergenic
998424110 5:142012703-142012725 CTTTTCCCTTTTGTGCTTTGGGG - Exonic
999648643 5:153744001-153744023 CTTCTCCTCTTTGAGAACTGGGG + Intronic
999798449 5:155009844-155009866 CTTTTCCCCTTTAAGAAATGTGG + Intergenic
1000505483 5:162111675-162111697 CTTTTTCCATTTGATAGATGAGG + Intronic
1000675589 5:164118894-164118916 CTTTACCTTTTTGAGCTCTGGGG + Intergenic
1000688028 5:164277388-164277410 CTTCTCCCATTTTATCTCTGAGG - Intergenic
1000755989 5:165160609-165160631 CTTTTGCCTTTTGAGAGCTCTGG + Intergenic
1000954145 5:167522502-167522524 TTTTTCCCATTTGTGAAATGAGG + Intronic
1001185666 5:169569278-169569300 CTTTTCCCCTTTTACATGTGTGG + Intergenic
1003282320 6:4704843-4704865 CTTTTCTCCCTTGACATCTGAGG + Intergenic
1004883501 6:20031298-20031320 CTTTTCCCATATTAGTTCAGAGG - Intergenic
1008756421 6:54799819-54799841 CTTTTCAGATTTTAGATCTATGG - Intergenic
1011090169 6:83588929-83588951 AAATTCCCATTTGAGATCTGTGG + Intronic
1012917853 6:105189898-105189920 CTTTTACCTTTTGAGAACTGAGG - Intergenic
1014256957 6:119170083-119170105 CTGACCCCATTTGAGATGTGGGG + Intergenic
1015120187 6:129692548-129692570 CTTTTCCCTGTAGAGTTCTGTGG - Intronic
1016473516 6:144400971-144400993 CTTTGCCCACTTTATATCTGGGG + Intronic
1017454903 6:154592856-154592878 CTTTTCCCATTCTAGCTCTTAGG + Intergenic
1017767963 6:157622511-157622533 CTTTGCCCACTTAGGATCTGAGG + Intronic
1018237154 6:161737619-161737641 TTATTCCCATTTGAAAACTGTGG + Intronic
1019075980 6:169388571-169388593 CATTTTCCATTTTAGCTCTGAGG + Intergenic
1019117363 6:169775802-169775824 CTTTTTCCATTTTATATTTGAGG + Intronic
1019591260 7:1835241-1835263 CTTGTCCTGTTTCAGATCTGAGG - Intronic
1019999435 7:4746929-4746951 CTTTTCCCAGCTGAGAACTCTGG + Intronic
1020785475 7:12568200-12568222 ATTTTCCCATTTTAGAGATGAGG + Intergenic
1020994791 7:15249813-15249835 CTTTCCCAATTTCACATCTGGGG - Intronic
1021274561 7:18633538-18633560 CTTTTCCCATTTCAAATATAAGG - Intronic
1022537793 7:31108612-31108634 GTTTTCCCATTTGTGAGATGAGG + Exonic
1023628154 7:42137072-42137094 ATTTTCCCCTTTGACATATGAGG - Intronic
1024943410 7:54785108-54785130 CTGTTCTCATTTTAGAGCTGTGG + Intergenic
1027555465 7:79659457-79659479 CTTTTGTCATTTAAGTTCTGGGG - Intergenic
1029321645 7:99766755-99766777 CTTTACCAATTTATGATCTGGGG + Intronic
1029662342 7:101971085-101971107 CTTTCCCCATTTTCCATCTGGGG + Intronic
1029890027 7:103918513-103918535 CTTTGCCACTTTGGGATCTGAGG - Intronic
1029976197 7:104836526-104836548 CTTTTACCATTTGTGCTCTTAGG + Intronic
1030503208 7:110386001-110386023 CCTTTCCCTTCTGAGATCTGTGG + Intergenic
1031939843 7:127776929-127776951 CCTTTTCCCTTTGGGATCTGTGG + Intronic
1032253081 7:130274273-130274295 CTTTTTACATTTGAGCTCTTTGG + Intronic
1032329475 7:130964301-130964323 CATTTCCCATTTTAGAGCTGAGG - Intergenic
1032988090 7:137361271-137361293 ATTTTTGCATTTGAGATCTTGGG + Intergenic
1033674481 7:143526343-143526365 TTTTTCTCATTTGAGGTCTATGG + Intergenic
1033697356 7:143803103-143803125 TTTTTCTCATTTGAGGTCTATGG - Intergenic
1036588139 8:10144030-10144052 CTTTTCCCATTTGTGAAGTCTGG + Intronic
1038375566 8:27036897-27036919 CTTTTCTCCTTTTATATCTGTGG - Intergenic
1038734980 8:30160611-30160633 TTTTTCCTATTTTCGATCTGAGG - Intronic
1038896825 8:31792865-31792887 CTTGTCACATTTGCTATCTGTGG - Intronic
1039180733 8:34863240-34863262 CTTCTGCCATTTGAAATCAGTGG + Intergenic
1039382457 8:37099082-37099104 CTTTCCCTATCTGAGATTTGGGG + Intergenic
1041824671 8:62080850-62080872 ATTTTCCCATTTGAAAACCGAGG + Intergenic
1042231920 8:66566073-66566095 CTTTTCCAATTTGACAACTTTGG + Exonic
1043381372 8:79705771-79705793 CTTTTTCCATTTCAGAACTTGGG - Intergenic
1044875662 8:96663472-96663494 CTTGTCCCTGTTGAGAACTGTGG + Intronic
1044931492 8:97256199-97256221 GTTTTCCCATTTGTGAACTGGGG + Intergenic
1047345161 8:124020724-124020746 TTTTTCCCATTTTACAGCTGAGG - Intronic
1047371258 8:124257916-124257938 CTTTTCTAAATTGAGATTTGGGG - Intergenic
1047626105 8:126657738-126657760 CTACTCCCATCTGAGATCTTTGG - Intergenic
1048866066 8:138762687-138762709 CTTTTCACTTTTCAAATCTGTGG + Intronic
1049233277 8:141495191-141495213 CTTGGCCCATTTGACATATGAGG + Intergenic
1050862144 9:10448653-10448675 TTTTTCCTATTTTACATCTGAGG + Intronic
1053460481 9:38266044-38266066 CTTTTCATATTTGGGATCTCTGG - Intergenic
1055407659 9:75991420-75991442 CTTTCCCCATCTGATAACTGGGG - Intronic
1056487178 9:87071195-87071217 ATTTTCCCATTTTACATATGAGG - Intergenic
1058388437 9:104465714-104465736 CTTTGCCCATTTTAGCTCTGAGG + Intergenic
1059616388 9:115956038-115956060 CTTTTCCCATTTAATATTTTAGG - Intergenic
1059770474 9:117419051-117419073 CTTTTCTCATTTGTGAAATGGGG + Intergenic
1060481729 9:124020161-124020183 CTATTCCCATTTTAGAGATGTGG - Intronic
1060582462 9:124762501-124762523 CTTTTCCGATTATAAATCTGTGG - Intronic
1061936782 9:133862230-133862252 CCTGTCCCTTTGGAGATCTGTGG - Intronic
1187181631 X:16947757-16947779 AATTTCCCATTTGAGATTAGAGG + Intronic
1187232607 X:17436850-17436872 GTTCTCCCATTTGACAGCTGGGG + Intronic
1188446633 X:30259531-30259553 CTTTTCGCATCTTGGATCTGTGG + Intergenic
1189402514 X:40684810-40684832 CTTTTCCCATTTATGCTCTTAGG + Intronic
1189415162 X:40806330-40806352 CATTTGCCATCTGATATCTGAGG - Intergenic
1190076609 X:47321756-47321778 ATGTTCCCATGGGAGATCTGAGG + Intergenic
1190576931 X:51849037-51849059 CTTTTCACAATTTAGCTCTGTGG + Intronic
1191031706 X:55980871-55980893 CTTTTACCGTTTGAAGTCTGAGG + Intergenic
1191611520 X:63119821-63119843 CTTTTCCCATTATATATTTGTGG - Intergenic
1192187362 X:68958872-68958894 CTTTGCCCATTTAAAACCTGTGG - Intergenic
1195011975 X:100741496-100741518 CTTTTCTCACTAGAGATCTGTGG + Intergenic
1195096613 X:101507317-101507339 CATTTCCCATTTTAAATATGGGG - Intronic
1196538226 X:116873046-116873068 CTCTTCTCATTGAAGATCTGAGG + Intergenic
1196542316 X:116924175-116924197 CTTTTCCCTTTAGCGATTTGAGG + Intergenic
1196972407 X:121124118-121124140 CTATTGCCATTTGAGGTATGAGG + Intergenic
1198032670 X:132768552-132768574 CTATTCCCATTTGACAGATGAGG + Intronic
1198121641 X:133598578-133598600 CTTTTCCCATGACATATCTGTGG - Intronic
1200338067 X:155373279-155373301 CTTTTCACATATGGCATCTGTGG - Intergenic
1200348402 X:155467415-155467437 CTTTTCACATATGGCATCTGTGG + Intergenic