ID: 928229594

View in Genome Browser
Species Human (GRCh38)
Location 2:29485912-29485934
Sequence CTGGCTGCAAGCACTGATTC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 214
Summary {0: 1, 1: 0, 2: 1, 3: 20, 4: 192}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
928229590_928229594 14 Left 928229590 2:29485875-29485897 CCTTTTTGTGGTTGTGGGAGCTG 0: 1
1: 0
2: 2
3: 25
4: 350
Right 928229594 2:29485912-29485934 CTGGCTGCAAGCACTGATTCTGG 0: 1
1: 0
2: 1
3: 20
4: 192

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
928229594 Original CRISPR CTGGCTGCAAGCACTGATTC TGG Intronic
900782244 1:4625802-4625824 CAGGCTGCAAACACGGCTTCAGG - Intergenic
900792075 1:4687399-4687421 CAGCCTCAAAGCACTGATTCAGG + Intronic
902649152 1:17825486-17825508 GTGGCTGCAAGAAATGGTTCTGG - Intronic
904087499 1:27919935-27919957 CTGGATGCAAGCAATTATCCTGG + Intergenic
904718744 1:32490057-32490079 AGGGCTGCATGCACTGATTCTGG + Exonic
905916887 1:41690615-41690637 TTGGCTGAAAGCATGGATTCTGG + Intronic
909852978 1:80492850-80492872 CTGGCTGCAACCCCTGCCTCCGG + Intergenic
912592902 1:110844819-110844841 CTGGCTCTAAGCAAAGATTCAGG + Intergenic
913299880 1:117359421-117359443 CTGGCTTCAAGCACTAAGTCTGG + Intergenic
915219236 1:154360847-154360869 CTGACTGCAATCTCTGCTTCTGG + Intergenic
915867181 1:159515191-159515213 CTGGGTATAAGCACTGATGCAGG + Intergenic
916227003 1:162498156-162498178 CTGGCGGCAAGAACTGCTTGAGG - Exonic
920115661 1:203619290-203619312 CTGGTTTCATGCTCTGATTCTGG - Intergenic
922731122 1:227949179-227949201 GTGCCTGCAGGGACTGATTCTGG + Intergenic
924166184 1:241285674-241285696 CTGTTTGAAAGCACTGACTCTGG - Intronic
924250186 1:242125046-242125068 CTGGCTGGAATCATGGATTCTGG + Intronic
1063905765 10:10778661-10778683 CTGGCTAATAGCATTGATTCTGG + Intergenic
1064330418 10:14388688-14388710 CTGGATGGAAACACAGATTCTGG + Intronic
1065779162 10:29150820-29150842 CTGGAGGCAAGAACTGATCCAGG + Intergenic
1067713266 10:48667269-48667291 CTGGCTGCAGGCACCGGCTCTGG - Intergenic
1069102761 10:64343755-64343777 CTGGCAGGAAGCATTAATTCAGG - Intergenic
1069242903 10:66164434-66164456 CTGGCCACAATCATTGATTCAGG + Intronic
1069830542 10:71279811-71279833 CACTCTGCAGGCACTGATTCTGG + Exonic
1070462127 10:76680828-76680850 CTGTCTGCAAGCACGCATTGAGG + Intergenic
1071307010 10:84308334-84308356 CTTGCTTCAACCACTGATTCTGG + Intergenic
1071322432 10:84476516-84476538 CTCACTGCAAGCTCTGCTTCCGG + Intronic
1071683134 10:87727819-87727841 AGGGCTGCAAGCTCTGATTATGG - Intronic
1073065818 10:100758669-100758691 CTGCCTGCAGGCAGTGATGCAGG + Intronic
1075219153 10:120569303-120569325 CTGGCTGGAGGCACTGATCCTGG - Intronic
1076711311 10:132336386-132336408 CTGCCAGCAAGCAGTGACTCGGG + Intronic
1077367692 11:2167743-2167765 CTGGCAGGAGGCACTGATGCTGG + Intronic
1078230871 11:9441593-9441615 ATGGCAGCAAGAACTGATTGAGG + Intronic
1078530050 11:12130336-12130358 CAGGCTCCAGGCAGTGATTCTGG - Intronic
1079203136 11:18392404-18392426 CTTGCTCCAAGCACAGCTTCAGG - Intergenic
1079514308 11:21248794-21248816 CTGGCCACAAGGACTGGTTCAGG + Intronic
1081658612 11:44874250-44874272 CTGGCTGCCATCTCTGAATCAGG - Intronic
1081895409 11:46581530-46581552 CTTGCTGCAAGCTCTGCCTCCGG - Intronic
1082075766 11:47975096-47975118 CTGGATGCCAGCACTCATCCAGG - Intergenic
1082792630 11:57357453-57357475 GTGGTTGCAAGCACAGGTTCTGG - Intronic
1084705490 11:70813940-70813962 CTGGCTGCAATGACTGCTTCAGG + Intronic
1085940255 11:81199435-81199457 CTGGTGGAAAGCATTGATTCAGG + Intergenic
1099086292 12:78250572-78250594 CTGCCTGGAAGCAGTGGTTCAGG + Intergenic
1100232083 12:92618815-92618837 CTGGCTGCAACCACTGCTGAGGG + Intergenic
1100239608 12:92698185-92698207 CAGGCTGCAAGGACTGGTTTAGG - Intergenic
1102287430 12:111670059-111670081 CTTGCTCCAAGCACTTTTTCAGG - Intronic
1102771521 12:115481385-115481407 CTGGGTGGAAGCACTGATTCAGG - Intergenic
1103596979 12:122030096-122030118 CTGGCTGCACCCACACATTCAGG + Intronic
1105563878 13:21523713-21523735 CTGGCTCCAGGGACTGGTTCAGG + Intronic
1106493123 13:30247146-30247168 GTGGTTGAAAGCACTGATTCTGG - Intronic
1110399532 13:75073591-75073613 CTGGCTGGAACTATTGATTCTGG + Intergenic
1115181214 14:30627881-30627903 CTGGCTGAAAGCATAGATTAAGG - Intronic
1117470741 14:56041859-56041881 GTGGCTGAAAGCACAGATTCTGG + Intergenic
1118262175 14:64257896-64257918 CTGGGTAGAAGCACTGTTTCTGG + Intronic
1119556870 14:75560077-75560099 CTGGCTGCATGCCCAGTTTCTGG - Intergenic
1123627318 15:22236694-22236716 CTGGCTACAGTCACTGATTTAGG + Intergenic
1125349037 15:38748384-38748406 CAGGCTGCAAATACAGATTCTGG - Intergenic
1127707242 15:61559445-61559467 CTGGCTGGGAGCACTTATCCAGG - Intergenic
1130990245 15:88871717-88871739 CTGGCTGCAGCCACAGCTTCTGG - Intronic
1132512356 16:350358-350380 ATGCCTGCAAGCACTGAATCTGG + Intronic
1133301975 16:4787982-4788004 CTGGCTGCAAACACCCATCCTGG - Intronic
1135353560 16:21750717-21750739 CTAGCTGCAGTCACTGGTTCTGG - Intronic
1135452048 16:22566844-22566866 CTAGCTGCAGTCACTGGTTCTGG - Intergenic
1138416928 16:56876895-56876917 CGGGCTCCAAGGACTGATCCTGG - Intronic
1139465954 16:67154369-67154391 CTGGCTGTAAGCCCCGCTTCTGG + Exonic
1141813149 16:86390029-86390051 CTGGGTGCAGGCACTGGTCCGGG - Intergenic
1141976635 16:87520684-87520706 CTGGCTACAGTCACTGATTTAGG - Intergenic
1144022589 17:11250530-11250552 CTGCCTGCAGACACTGAGTCTGG - Intronic
1144431451 17:15195893-15195915 CTGGCTTCAAGCAATTATCCTGG - Intergenic
1145185183 17:20787755-20787777 CCAGCTGAGAGCACTGATTCAGG - Intergenic
1145193994 17:20870460-20870482 CTCACTGCAAGCTCTGACTCCGG + Intronic
1145312387 17:21707751-21707773 GGGGCTGCAAGGCCTGATTCTGG - Intergenic
1145898609 17:28475222-28475244 ATGGCTTCTAGCACTGACTCAGG - Intronic
1146515951 17:33489416-33489438 CTGGCTGCGAGCACTGGCTTTGG - Intronic
1149819748 17:59764550-59764572 CTGGCTTCAAGCAGTCATCCTGG + Intronic
1151542046 17:74769611-74769633 TGGGCTGCAAGCACCGATTGTGG + Intergenic
1151884937 17:76917984-76918006 CTGGCTGCCAGCACGGCTGCAGG - Intronic
1152117191 17:78395603-78395625 CTGGCTGTTAGGACTGATTTGGG + Intronic
1152711466 17:81872226-81872248 CTGGGTGCGAGCACTGCTGCTGG - Intergenic
1155155833 18:23156562-23156584 GTTGCTGCAAGCACTGAATTAGG + Intronic
1155344076 18:24841499-24841521 CTGGCTTCAGGGACTAATTCAGG - Intergenic
1156816273 18:41315365-41315387 CTATCTTCATGCACTGATTCAGG - Intergenic
1157328410 18:46685822-46685844 CTGGTTCCAACCACTGCTTCTGG + Intronic
1159735450 18:72091750-72091772 CTGCCTGCAAGCCCTGTCTCGGG + Intergenic
1159737469 18:72118079-72118101 CTGCCTGTAAGCACTGATAATGG + Intergenic
1160544107 18:79641597-79641619 CTGGCTGCAGGGACTGAGTGTGG + Intergenic
1161858457 19:6779577-6779599 CTGGCTGGATGCAGTGGTTCAGG + Intronic
1162789412 19:13055296-13055318 CTGGGTCCAGGCACAGATTCTGG - Intronic
1163975886 19:20851893-20851915 CTGACTGCAACCACTGCCTCTGG - Intronic
1164158828 19:22613286-22613308 CTCACTGCAACCTCTGATTCAGG + Intergenic
1166060150 19:40320909-40320931 CCTGCTGCAAGCCCTGAGTCAGG - Exonic
1166332136 19:42084738-42084760 CTCACTGCAAGCTCTGACTCTGG + Intergenic
1166773870 19:45300786-45300808 CTGGCTGCAGGCATTGGTTTAGG - Intronic
1167557622 19:50205773-50205795 GGGGCTGCAAGCCCGGATTCTGG + Intronic
926366908 2:12141574-12141596 CTGGCAGCAATCACAAATTCTGG - Intergenic
926584039 2:14665648-14665670 ATGGTTGAAAGCACAGATTCAGG - Intergenic
927306239 2:21576687-21576709 CTGGCAGCTGGCACTCATTCTGG - Intergenic
927662421 2:25004125-25004147 CTGGCTGCAATGATTGGTTCAGG - Intergenic
928229594 2:29485912-29485934 CTGGCTGCAAGCACTGATTCTGG + Intronic
928287995 2:30010072-30010094 CTGGCTTCAACCACTGCTGCAGG - Intergenic
928595458 2:32855472-32855494 CTGACTCCAAACACTGAGTCAGG - Intergenic
928914395 2:36456053-36456075 CTGGCTGCTAACACTCCTTCAGG - Intronic
931050443 2:58407695-58407717 CTGGCTGCCAGCAGTGACGCAGG + Intergenic
932028703 2:68161205-68161227 CTACCTGCATGCACTGATTGGGG - Intronic
932543295 2:72679794-72679816 TTGGCTGGAAACAATGATTCTGG + Intronic
933717328 2:85370990-85371012 CTTTCTGCAAGCACTGCCTCTGG + Intronic
940859118 2:158754000-158754022 CTGGCTGCAAGCAGACATTCTGG - Intergenic
942209176 2:173653556-173653578 CTAACAGCAAGCACTGAATCAGG + Intergenic
945884071 2:215355979-215356001 CTGGCTGAAAGCACATATTCTGG + Intergenic
1169240741 20:3977788-3977810 CTCGCTGCAAGCTCTGCCTCTGG - Intronic
1170718583 20:18854613-18854635 CTGGCTGCAAGCAGTGACCCCGG + Intergenic
1170785746 20:19465890-19465912 CAGGCTGCATGCAGAGATTCTGG - Intronic
1171262396 20:23746218-23746240 GGGGCTGCACACACTGATTCAGG - Intergenic
1171880464 20:30614664-30614686 CTGGCTCCAAGCCCTGGTCCAGG - Intergenic
1173492110 20:43491487-43491509 CTTGCTGCAAGCTCTGCCTCCGG + Intergenic
1173898412 20:46568643-46568665 CTGGCTGCAAGGAGTGCTGCAGG + Intronic
1174380182 20:50151264-50151286 CTGTCTGCAGACTCTGATTCAGG + Intronic
1176074211 20:63241101-63241123 CGGGCTGCAAGCACTGCTGCTGG - Exonic
1176300884 21:5098420-5098442 CTGGCTCCAGGCACTGTTGCAGG - Intergenic
1178388892 21:32182332-32182354 CTGGCAGGAAATACTGATTCAGG + Intergenic
1178546143 21:33494418-33494440 CTCACTGCAAGCTCTGCTTCTGG - Intergenic
1178734018 21:35132351-35132373 CTGGCTTCAAGCAATTTTTCTGG - Intronic
1179010829 21:37554813-37554835 CTGGCTCCAAGCTCTGCCTCTGG - Intergenic
1179561061 21:42216526-42216548 CTGGCAGCAACCACTGCATCAGG - Intronic
1179856152 21:44163533-44163555 CTGGCTCCAGGCACTGTTGCAGG + Intergenic
1182956625 22:34432838-34432860 CTGGATGGAATTACTGATTCAGG + Intergenic
1183487428 22:38097145-38097167 CCGGCTGCACGCACAGATGCAGG - Exonic
1184132963 22:42528775-42528797 CTGGCTGCTGGCACTGTTTCTGG + Intergenic
1184983699 22:48114821-48114843 GTCGCTGCAAGCACTGATGAGGG - Intergenic
951477659 3:23125685-23125707 CTGGCTCCTAGCAGTGAGTCTGG - Intergenic
951478936 3:23139279-23139301 CTCACTGCAAGCACTGCCTCTGG - Intergenic
952010560 3:28896020-28896042 CTGCATGCAAGCCCTGACTCAGG - Intergenic
952703558 3:36352185-36352207 CTGGCTTCACGGAATGATTCAGG - Intergenic
954165697 3:48755850-48755872 CTGACTGCAAGCTCTGCCTCCGG + Intronic
954864844 3:53719488-53719510 CTGGCAGCAGGCAGTGATGCAGG - Intronic
958972676 3:100629965-100629987 CTGGCTGCAATGACTAATCCAGG + Intronic
962929548 3:140023848-140023870 CAGGCTGGAAGCACTGAGCCTGG + Intronic
966651719 3:182308540-182308562 GTGGCTGCCAGCAGTGACTCAGG + Intergenic
967263458 3:187669086-187669108 CTGGCTGCAAGAATTTCTTCTGG - Exonic
967917647 3:194590675-194590697 CTGGCTAAAAACACTGATGCTGG + Intronic
968717764 4:2174343-2174365 CTTCCTGCAAGAACTGATGCAGG - Intronic
976226740 4:82800072-82800094 CTGGCTGCTAGGACTGGCTCAGG - Intergenic
977476195 4:97513012-97513034 CTGGTTGCAAGAACAGATTGTGG + Intronic
979114330 4:116802056-116802078 TTGGATGGAAGCACTGATTATGG - Intergenic
981783964 4:148456879-148456901 CTGGCTGTAAGCACAGAGTCTGG - Intergenic
982158548 4:152544371-152544393 CTGGGGTCAAGCACTGAGTCTGG - Intergenic
982256333 4:153454937-153454959 GTGGCTGAAAGCAAGGATTCCGG + Intergenic
985727188 5:1522760-1522782 CTAGAAGCAAGCACTGTTTCGGG - Intronic
985805846 5:2042636-2042658 CTGGCTGTGAGCACTGAATGAGG + Intergenic
987021666 5:13878772-13878794 CAGGCTGCATCCTCTGATTCTGG - Intronic
989335764 5:40315180-40315202 CTGGCTTCAAGCAGTGAGACTGG - Intergenic
990485494 5:56255255-56255277 ATGGCTACAAGCACAGGTTCAGG - Intergenic
992575977 5:78113069-78113091 GTGGCTGACAGCACTGATTGGGG - Intronic
994072810 5:95620779-95620801 CTGGCTGCTGGCACTGCTGCTGG + Exonic
996737087 5:126767861-126767883 CTCACTGCAAGCTCTGCTTCCGG - Intergenic
997147320 5:131450761-131450783 CTGGCTGACAAAACTGATTCAGG + Intronic
997609976 5:135209103-135209125 CTGGCTGCAAGCAGTCAATGTGG + Intronic
1000896466 5:166861170-166861192 CTGGCTGAACCCACTGCTTCTGG + Intergenic
1001452946 5:171840230-171840252 CTGGCTGCAGGGACTGGCTCAGG - Intergenic
1004074923 6:12336420-12336442 GTGGCTTCAAGGACTGTTTCTGG - Intergenic
1005341523 6:24847965-24847987 CTGGGTGCAAGCACTGGCTCAGG + Intronic
1005441718 6:25876475-25876497 CAGGATGCAGGCTCTGATTCTGG + Intronic
1005527011 6:26660856-26660878 GTGACTGCAAGCACAGAATCTGG - Intergenic
1006330674 6:33388264-33388286 CTTGCTGCAAGCTCTGCCTCCGG - Intergenic
1007379713 6:41480271-41480293 CTCACTGCAAGCTCTGCTTCCGG - Intergenic
1008403209 6:51088535-51088557 CTCACTGCAAGCTCTGCTTCCGG - Intergenic
1010436662 6:75839260-75839282 CTCGCTGCAAGCTCTGCCTCCGG + Intronic
1010568821 6:77452988-77453010 CTTGCTGCAAGAACTGTCTCAGG + Intergenic
1012003262 6:93681033-93681055 TTGGCTGCATTCACTCATTCAGG + Intergenic
1012741614 6:103022634-103022656 CTGTCTGCAACCACTAGTTCAGG - Intergenic
1013398430 6:109767796-109767818 CTCGCTGCAAGCTCTGCCTCCGG - Intronic
1015624730 6:135168587-135168609 CTGCCTGCTATCACTGACTCAGG + Intergenic
1016519915 6:144935617-144935639 CAGGCTGAAAGAACTGATACTGG + Intergenic
1018273451 6:162104955-162104977 CTGGCTACATGCTCTGATTTTGG + Intronic
1018416013 6:163602855-163602877 CTGGCAGCAAGCTGGGATTCCGG - Intergenic
1022131521 7:27409268-27409290 CTGGCTGCAAGCCCTGGCTAGGG + Intergenic
1022205209 7:28157259-28157281 CTGGCCTCAAGCACTGAGTCAGG + Intronic
1023659809 7:42460113-42460135 CTGGCTGCAGCCCCTGGTTCTGG + Intergenic
1028105259 7:86869040-86869062 CAGGCTGCACTCTCTGATTCTGG - Intergenic
1029978214 7:104853357-104853379 CTGGCTGAAAGCACTCCCTCTGG - Intronic
1032351899 7:131172212-131172234 CTCACTGCAAGCTCTGACTCCGG + Intronic
1032597693 7:133258156-133258178 CTTCCTGAAAGCACTGTTTCTGG - Intronic
1032747158 7:134797538-134797560 CTGGCTGCAAGCACAGTTGCTGG - Intronic
1033375613 7:140759066-140759088 CTGGCTGCATGCAGTGTTACGGG + Intronic
1036767970 8:11560886-11560908 CTGGCTGGAAGCACAGCTCCTGG - Intronic
1039405345 8:37307920-37307942 CTGGCTAAAAGCACAGACTCTGG + Intergenic
1040520906 8:48175287-48175309 CTGGTTGCAAACACTGTTTGTGG - Intergenic
1042735661 8:71984976-71984998 GTGGCTGAAAGCATTGACTCTGG + Intronic
1045346700 8:101300128-101300150 CTGCCTGCAAGCACTGCCTGAGG + Intergenic
1048757871 8:137757774-137757796 CTGGCTGCAGGGATTGATTCAGG + Intergenic
1049618992 8:143589391-143589413 CAGCCTGCAGGCACTGGTTCGGG - Exonic
1050236738 9:3589438-3589460 GTGGCTGAAAGCACAGGTTCTGG + Intergenic
1051817887 9:21131263-21131285 CAGGCTGCAATGCCTGATTCAGG + Intergenic
1052369517 9:27647932-27647954 CTTACTGCAAGCTCTGCTTCCGG + Intergenic
1052798787 9:32948450-32948472 CTGGTTGCAAGCACAGATTGTGG + Intergenic
1053869411 9:42474446-42474468 TTGTCTGCCAGCACTGATTTAGG - Intergenic
1056177109 9:84045695-84045717 CTGCCTGCAACCACTGCTACAGG - Intergenic
1056723621 9:89092541-89092563 CTCACTGCAAGCTCTGCTTCTGG - Intronic
1058613792 9:106803988-106804010 CTGACTGCAAGCTCTGCCTCTGG - Intergenic
1058985686 9:110207175-110207197 CTGGCTGCCAGCACTGTTCCTGG - Intronic
1060666210 9:125433551-125433573 CCGGCTGCAGGCACCGATGCTGG + Intergenic
1061035842 9:128114032-128114054 CTGGTTGCAAACCCTGATTAAGG - Intergenic
1062000551 9:134213782-134213804 CTGGCTCCATCCACTGGTTCTGG + Intergenic
1186279896 X:7980603-7980625 CTGCCTGCAATCACTTATACAGG + Intergenic
1186353541 X:8765768-8765790 CTGCCTGCAATCACTTATACAGG - Intergenic
1186562852 X:10631145-10631167 GTGGCTGGCAGCACTGATGCTGG + Intronic
1186794790 X:13034829-13034851 CTGCCTGCAATCACTTATGCAGG - Intergenic
1189370191 X:40421821-40421843 ATGGGTGAAAGCACAGATTCTGG - Intergenic
1191758712 X:64624068-64624090 CTGGCTCCAGGCACAGATTGAGG + Intergenic
1192893116 X:75411280-75411302 CTCACTGCAAGCTCTGCTTCTGG + Intronic
1195127622 X:101823368-101823390 CTGGGTGCCAGCACTGGTGCTGG - Intergenic
1195286453 X:103389285-103389307 GAGGCTGAGAGCACTGATTCTGG - Intergenic
1197724953 X:129770011-129770033 CTGGATGCAAGCACTGGTGATGG - Intergenic
1199581341 X:149363391-149363413 CTGGTTGCAAGTACAAATTCTGG - Intergenic
1201316718 Y:12654741-12654763 CTCACTGCAAGCTCTGCTTCTGG + Intergenic