ID: 928238016

View in Genome Browser
Species Human (GRCh38)
Location 2:29562104-29562126
Sequence CTGTCTGCCTAGAAGAGCAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 237
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 224}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
928238016_928238022 6 Left 928238016 2:29562104-29562126 CCTTTGCTCTTCTAGGCAGACAG 0: 1
1: 0
2: 1
3: 11
4: 224
Right 928238022 2:29562133-29562155 TCTGCTGGACAACCATGGGTGGG 0: 1
1: 0
2: 0
3: 8
4: 128
928238016_928238020 2 Left 928238016 2:29562104-29562126 CCTTTGCTCTTCTAGGCAGACAG 0: 1
1: 0
2: 1
3: 11
4: 224
Right 928238020 2:29562129-29562151 AGTTTCTGCTGGACAACCATGGG 0: 1
1: 0
2: 0
3: 6
4: 82
928238016_928238019 1 Left 928238016 2:29562104-29562126 CCTTTGCTCTTCTAGGCAGACAG 0: 1
1: 0
2: 1
3: 11
4: 224
Right 928238019 2:29562128-29562150 CAGTTTCTGCTGGACAACCATGG 0: 1
1: 0
2: 0
3: 10
4: 201
928238016_928238021 5 Left 928238016 2:29562104-29562126 CCTTTGCTCTTCTAGGCAGACAG 0: 1
1: 0
2: 1
3: 11
4: 224
Right 928238021 2:29562132-29562154 TTCTGCTGGACAACCATGGGTGG 0: 1
1: 0
2: 0
3: 5
4: 108
928238016_928238024 18 Left 928238016 2:29562104-29562126 CCTTTGCTCTTCTAGGCAGACAG 0: 1
1: 0
2: 1
3: 11
4: 224
Right 928238024 2:29562145-29562167 CCATGGGTGGGTGCCGTCTGTGG 0: 1
1: 0
2: 2
3: 12
4: 163
928238016_928238017 -9 Left 928238016 2:29562104-29562126 CCTTTGCTCTTCTAGGCAGACAG 0: 1
1: 0
2: 1
3: 11
4: 224
Right 928238017 2:29562118-29562140 GGCAGACAGCCAGTTTCTGCTGG 0: 1
1: 0
2: 0
3: 24
4: 223

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
928238016 Original CRISPR CTGTCTGCCTAGAAGAGCAA AGG (reversed) Intronic
900129787 1:1082529-1082551 CGCTCTGCCTAGAAAAGCCAGGG - Exonic
900575601 1:3380845-3380867 CTGGCTGCCTAGGAGCACAATGG + Intronic
902952404 1:19896451-19896473 TTGTCTCCCAGGAAGAGCAATGG - Intronic
903586455 1:24419323-24419345 CTGTCTGCCTGGGAGAGCCACGG + Exonic
905042185 1:34968915-34968937 CTATCTGCCTAACAGAGGAAAGG - Intergenic
906660926 1:47580969-47580991 CTGTCTGCAGAGAAGGGCCAAGG + Intergenic
906892207 1:49729839-49729861 CTGTCTGCCTAGGACAGGGATGG - Intronic
907247064 1:53115195-53115217 CTCTCTGCCTAGCAGTGCAGAGG - Intronic
909741722 1:79037443-79037465 CTGTGTGCCTAGAAGAGCTATGG + Intergenic
909796411 1:79743000-79743022 CTGCTGGCCTAGAAAAGCAAAGG - Intergenic
910175942 1:84430312-84430334 CTCTCTGCCTAACAGAGGAAAGG - Intergenic
912901724 1:113657881-113657903 GTGTATTCCTAGAAGAGCCAGGG + Intronic
913111709 1:115663165-115663187 CTAGCAGCCCAGAAGAGCAAAGG - Intronic
914918168 1:151830917-151830939 CTGGCTGCCTGGGTGAGCAAGGG - Intronic
915110963 1:153564488-153564510 CTGTCTGCCTAGAGGCTCAGGGG - Intronic
918195055 1:182213438-182213460 TTGTGTGCCAAGAAGAGCCAGGG - Intergenic
918435604 1:184509405-184509427 CTGGCTGGCTGGCAGAGCAAAGG - Intronic
919120603 1:193335414-193335436 CTCTCTACCTGCAAGAGCAAGGG - Intergenic
921069957 1:211650454-211650476 CTCTCTACCCAGATGAGCAAAGG + Intergenic
923610610 1:235489390-235489412 TTGTCTGACTAGAAGAATAAAGG - Intronic
1063639361 10:7815283-7815305 CTGTCAGCCTGGCAGAGCAATGG + Intergenic
1065758007 10:28951988-28952010 CTGTCAGGCTAGAAGAGTAGGGG + Intergenic
1068104732 10:52600128-52600150 CTGTCTGTCTACAGGAACAATGG + Intergenic
1069311782 10:67046481-67046503 ATATCTTCCTAGAAGAACAAGGG + Intronic
1072508227 10:96091376-96091398 CTGTTTGACTAGAAAAGCATTGG + Intergenic
1073401081 10:103258234-103258256 CAGTCTGCTTAGAACAGCAAGGG - Intergenic
1074242178 10:111650360-111650382 CTGTGTGCCTGGAAAAGCCACGG + Intergenic
1075494815 10:122910972-122910994 CTGTCTTCCTAGTAGACCATAGG - Intronic
1075618160 10:123906280-123906302 ATGTCTACCTAGAAGAGAGATGG + Intronic
1076060388 10:127409516-127409538 CTGTCCTCTTTGAAGAGCAAGGG + Intronic
1078189287 11:9078225-9078247 CTGACTGCCTAGAAGATTACTGG + Intronic
1079279293 11:19073234-19073256 CTTTCAGCCTAGAGGAGCAGAGG - Intergenic
1079741169 11:24062806-24062828 CTATCTGCTTAGAAAAGGAAAGG + Intergenic
1081863772 11:46348467-46348489 CTGCCTGCCTAGCAGAGGGATGG - Intronic
1085181978 11:74543756-74543778 CTGTGTTCCTAAAAGAGCACAGG - Intronic
1090538649 11:127675810-127675832 ATGTTTGCCAAGTAGAGCAAAGG - Intergenic
1097160595 12:57043994-57044016 CTTTCTGCCTAAGAGTGCAATGG - Exonic
1097737012 12:63193798-63193820 CTTTCTGTCCAGAACAGCAAAGG + Intergenic
1098978528 12:76930251-76930273 CTATTTGCATAAAAGAGCAAGGG + Intergenic
1100061480 12:90581827-90581849 CTGACTTCCTAGAAGAACCAAGG - Intergenic
1102275346 12:111577760-111577782 CTGTCTGCAGAAAAGAGCATTGG + Intronic
1102275641 12:111580131-111580153 CTGTCTGCAGAGAGGAGCATTGG - Intronic
1102639064 12:114350333-114350355 CTGTCTACCTTGAGGAGGAAGGG - Intergenic
1102757873 12:115357966-115357988 CAGTCTGCCTTGATGACCAAAGG + Intergenic
1103623062 12:122200574-122200596 CTGTCTGCCAAGAAAGGAAAGGG + Exonic
1106568672 13:30907503-30907525 CGGTCTGCCAAGAAGAGCTTGGG - Intronic
1106930509 13:34658964-34658986 CTGTATGTGTAGAAGGGCAATGG - Intergenic
1107988481 13:45796627-45796649 CTTTCTGCCTCTAGGAGCAAAGG - Intronic
1110686554 13:78382412-78382434 CTATCTGCTTAAAACAGCAATGG - Intergenic
1114083523 14:19220600-19220622 GTGTCTGCCTTGAAGTGAAAGGG + Intergenic
1115085749 14:29513031-29513053 CTGTGTGCCTGGAAAAGCCAAGG - Intergenic
1116769830 14:49114327-49114349 CAGTTTTCCTAGCAGAGCAAGGG + Intergenic
1118933770 14:70266706-70266728 GTGTCTGCCTAGAAGAGACTTGG - Intergenic
1121667257 14:95682034-95682056 CTATCTGCCTAGCAGAGAATAGG + Intergenic
1202895130 14_GL000194v1_random:2369-2391 GTGTCTGCCTTGAAGTGAAAGGG + Intergenic
1124140541 15:27073259-27073281 ATGTCTGCCTGGAAGAGGAGGGG + Intronic
1124623340 15:31292805-31292827 CTCTCTGACCAGAAGAGCCATGG - Intergenic
1125164931 15:36691803-36691825 TTATCTGCCTAGCAGAGTAAAGG + Intronic
1126558145 15:50013301-50013323 ATGTCCCCCTAGAAGAGCTATGG - Intronic
1128259843 15:66225359-66225381 CTCTCTGCCCAGAAAGGCAATGG + Intronic
1130796742 15:87217724-87217746 CCCTCTACCTGGAAGAGCAATGG - Intergenic
1131047977 15:89328334-89328356 CTTTCAGCCTAGAAAAGCTAAGG + Intronic
1131652698 15:94419126-94419148 ATGTCTGCCTACAAAAGCACTGG + Intronic
1132334941 15:101042343-101042365 CTGTCTGCCCAGAAGACAATGGG - Intronic
1132831892 16:1932512-1932534 CTGGCTGCCTAGAACAGTATTGG + Intergenic
1135098704 16:19587161-19587183 CTGTCTGACAGGAACAGCAAGGG + Intronic
1136026395 16:27471678-27471700 CTGTCTGTAAAGAGGAGCAAAGG - Intronic
1136272291 16:29155574-29155596 CTGACTGCCTAGAAGACCCTGGG + Intergenic
1136531996 16:30876034-30876056 CTGGCTGCCTGGAGGAACAAAGG + Intronic
1138008090 16:53355796-53355818 CAGTCAGCCTAGAAGACCAGGGG + Intergenic
1138220005 16:55242383-55242405 CTGGATGCCGAGAGGAGCAAAGG + Intergenic
1138724264 16:59118815-59118837 CCATCTGCCAAGAAGACCAAAGG - Intergenic
1139611876 16:68064941-68064963 ATCTCTGCCTAGCAGAGCAGGGG - Intronic
1140374219 16:74431819-74431841 CTGCCAGCCTTGCAGAGCAAAGG + Intergenic
1140602785 16:76498673-76498695 CTGTCTCCCTGGCAGAGCAGAGG - Exonic
1142075864 16:88117490-88117512 CTGACTGCCTAGAAGACCCTGGG + Intronic
1142521092 17:505085-505107 CTGACTTTCTAGAAGAGCACCGG + Intergenic
1142521101 17:505150-505172 CTGACTTTCTAGAAGAGCACCGG + Intergenic
1142521116 17:505280-505302 CTGACTTTCTAGAAGAGCACCGG + Intergenic
1142521131 17:505410-505432 CTGACTTTCTAGAAGAGCACCGG + Intergenic
1142521147 17:505540-505562 CTGACTTTCTAGAAGAGCATTGG + Intergenic
1142521154 17:505605-505627 CTGACTTTCTAGAAGAGCACCGG + Intergenic
1142521171 17:505735-505757 CTGACTTTCTAGAAGAGCATTGG + Intergenic
1142521178 17:505800-505822 CTGACTTTCTAGAAGAGCACCGG + Intergenic
1142521195 17:505930-505952 CTGACTTTCTAGAAGAGCACCGG + Intergenic
1142521212 17:506060-506082 CTGACTTTCTAGAAGAGCATTGG + Intergenic
1142521219 17:506125-506147 CTGACTTTCTAGAAGAGCATTGG + Intergenic
1142521227 17:506190-506212 CTGACTTTCTAGAAGAGCATTGG + Intergenic
1142521234 17:506255-506277 CTGACTTTCTAGAAGAGCACCGG + Intergenic
1142521250 17:506385-506407 CTGACTTTCTAGAAGAGCACCGG + Intergenic
1142521260 17:506450-506472 CTGACTTTCTAGAAGAGCACCGG + Intergenic
1142521277 17:506580-506602 CTGACTTTCTAGAAGAGCACCGG + Intergenic
1142521294 17:506710-506732 CTGACTTTCTAGAAGAGCATTGG + Intergenic
1142521301 17:506775-506797 CTGACTTTCTAGAAGAGCATTGG + Intergenic
1142521309 17:506840-506862 CTGACTTTCTAGAAGAGCATTGG + Intergenic
1142521316 17:506905-506927 CTGACTTTCTAGAAGAGCACCGG + Intergenic
1142521332 17:507035-507057 CTGACTTTCTAGAAGAGCACCGG + Intergenic
1142521342 17:507100-507122 CTGACTTTCTAGAAGAGCACCGG + Intergenic
1144707101 17:17376949-17376971 TTGCCTGCCTTGAGGAGCAAGGG + Intergenic
1145991021 17:29079571-29079593 CTGGCTGCCTTGATGAGCAGGGG - Intronic
1149901173 17:60480844-60480866 CTGCATGACTGGAAGAGCAATGG + Intronic
1152247268 17:79191570-79191592 CTGGCTGCCTAGCAGTGCATCGG - Intronic
1152939629 17:83161362-83161384 CTGTGTGCCCAGAAGAGGCAGGG - Intergenic
1153314583 18:3709521-3709543 CTGTCTCCCTAAATGACCAAGGG - Intronic
1153411447 18:4798317-4798339 CTGTGTGTCTAGAAAAGGAAGGG - Intergenic
1154500202 18:14992262-14992284 GTGTCTGCCTTGAAGTGAAAGGG + Intergenic
1163551436 19:17968030-17968052 CTGTCTGCCCTGCAGAGCTAGGG + Intronic
1164936971 19:32222803-32222825 CTGTCTGCCTGGAACAGGTAGGG + Intergenic
1165100525 19:33436061-33436083 CTTTTGGCCTAGAAGAGCAGAGG + Intronic
1165970621 19:39625958-39625980 CTCTCTGCCCAGAAGATGAAAGG + Intergenic
1165975841 19:39675929-39675951 CTCTCTGCCCAGAAGATGAAAGG - Intergenic
1168557656 19:57356573-57356595 CTGGCTGTCAAGAAGAGTAAAGG - Exonic
926304651 2:11629110-11629132 CTGTGGGTCTAGAAGAGCCATGG + Intronic
927002797 2:18816371-18816393 GTGTATGCCTAGGAGAACAAGGG - Intergenic
927598783 2:24421992-24422014 CTCTCTCTGTAGAAGAGCAAAGG - Intergenic
928238016 2:29562104-29562126 CTGTCTGCCTAGAAGAGCAAAGG - Intronic
931188704 2:59978831-59978853 CTGTCTCCACAGAGGAGCAACGG - Intergenic
931700191 2:64903117-64903139 CTGTAAGCCTACAAGAGGAAAGG + Intergenic
931926914 2:67083811-67083833 CTGTCTCCATTGAAGAGAAATGG - Intergenic
932558273 2:72844521-72844543 CTTTTTGAATAGAAGAGCAAAGG - Intergenic
933572507 2:84029957-84029979 CTGTGATCCTGGAAGAGCAAGGG + Intergenic
936075837 2:109401389-109401411 CCTTCCTCCTAGAAGAGCAAAGG + Intronic
936727260 2:115334326-115334348 TAGTATGCCAAGAAGAGCAAAGG + Intronic
941017684 2:160375193-160375215 CTGTCTGCCAAATAGAGAAATGG + Intronic
941141419 2:161788269-161788291 CTGTGTGACTAGGAGAGCAGAGG + Intronic
942250175 2:174040524-174040546 CTGTCTGCCAAGAAGGCAAAGGG - Intergenic
942592232 2:177558427-177558449 ATGTCTGCCTGGAAAAGCTATGG + Intergenic
943258438 2:185627747-185627769 ATTTCTTCCTAGAAGTGCAATGG - Intergenic
944419957 2:199519111-199519133 CTGTCTGCCAAGAAAAACCAAGG - Intergenic
946098435 2:217296617-217296639 CTTTCTGCCTAACAGAACAAAGG + Intronic
946586027 2:221188754-221188776 CTGTCTGCGTGCAAAAGCAAAGG - Intergenic
947514605 2:230791179-230791201 CTGCCTGATTAGCAGAGCAAAGG + Intronic
1173032944 20:39379102-39379124 CTGCCTGCCAGGAAGAGGAAGGG + Intergenic
1173454334 20:43190692-43190714 CTGTCTCCCTAGAAAAGGAAAGG - Intergenic
1174271917 20:49375814-49375836 CTGTCTCTATAGAAGAACAAAGG + Intronic
1174371815 20:50094985-50095007 CTGTCTGCCTAAAACAGCTTGGG - Intronic
1175952185 20:62589377-62589399 ATGTCTGCCCAGCAGGGCAAGGG + Intergenic
1176614834 21:9018356-9018378 GTGTCTGCCTTGAAGTGAAAGGG + Intergenic
1176710374 21:10145515-10145537 GTGTCTGCCTTGAAGTGAAAGGG - Intergenic
1177881643 21:26702149-26702171 CTGTGTGCCTGGAAAAGCCACGG - Intergenic
1178126992 21:29526567-29526589 CTGTGTGCCTGGAAAAGCCACGG - Intronic
1178967738 21:37139196-37139218 CTGTTTTCCTAGAAAAACAAAGG + Intronic
1180294452 22:10872667-10872689 GTGTCTGCCTTGAAGTGAAAGGG - Intergenic
1180497258 22:15902081-15902103 GTGTCTGCCTTGAAGTGAAAGGG - Intergenic
1182282274 22:29224519-29224541 CTGGCTGCCTGGGAGGGCAAGGG - Intronic
1184312116 22:43652626-43652648 CTATCTGCCTAGCAAAGCAGAGG + Intronic
1185269429 22:49922220-49922242 CTGTCTGCCCAGAATAGCCTAGG - Intronic
952943323 3:38459532-38459554 CTGTCTGCCAAGCGGAGCACTGG + Intronic
953043704 3:39277330-39277352 CACTCTGCCCAGAAGAGCCAGGG - Intronic
953343025 3:42151376-42151398 CTGTCTTCCTCTAAGAGCAAAGG + Intronic
954270355 3:49503128-49503150 CTGTGTGCCTAGGAGTGGAAGGG + Intronic
955140333 3:56262239-56262261 CTGTGTGGCTTGAAGAGCAGGGG + Intronic
958666902 3:97152196-97152218 ATGTCTGACAAGAAGAGCAGAGG + Intronic
960226433 3:115174469-115174491 CTGCCTGCCCAGAAAAGAAAAGG + Intergenic
960397354 3:117153644-117153666 CTGTCTGACCAAATGAGCAAAGG - Intergenic
960933025 3:122873888-122873910 CTGTCTGCCTGGTAAAGCATCGG + Intronic
962385521 3:134929477-134929499 CTGACTGCCTGGAAGAGCTGTGG + Intronic
962576439 3:136759328-136759350 CTGTCTGCCTATCTGAGAAAGGG - Intergenic
962935128 3:140073750-140073772 TTCCCTGCCTAGAAGTGCAAAGG + Intronic
963542289 3:146607985-146608007 CTGCCTTCCTAGAAGAACGATGG + Intergenic
964003461 3:151805065-151805087 CTGTAGGACTAGCAGAGCAAGGG - Intergenic
965538799 3:169851976-169851998 TTTTCAGGCTAGAAGAGCAAAGG + Intronic
965940666 3:174176503-174176525 CAGTCTGCTTAGTAGAGAAAGGG - Intronic
966070340 3:175869797-175869819 TGGTCTGGATAGAAGAGCAAAGG + Intergenic
966268901 3:178081462-178081484 GTGGCTGCATTGAAGAGCAAGGG - Intergenic
968562844 4:1294171-1294193 CCTTCTGCCCAGAAGAGCCATGG + Intronic
968731184 4:2270096-2270118 CTGCCTGCCTAGAGGACCACTGG + Exonic
969137512 4:5042618-5042640 CTGTCTGCTAAGGAGACCAAAGG + Intergenic
972345350 4:38188325-38188347 CTGTTTGCCTTTAGGAGCAATGG + Intergenic
973606591 4:52593317-52593339 CTGTCTGCCACGAAGGCCAAAGG - Exonic
974192515 4:58524817-58524839 CTGTATGCCTAGAAAAGAAGAGG + Intergenic
975665365 4:76729625-76729647 CTGACTTTCTAGATGAGCAAAGG + Intronic
977033167 4:91914272-91914294 CTGTCTGGCTACTATAGCAAAGG + Intergenic
978671846 4:111257395-111257417 CTGTCTTCCTTGAAGAGAAGTGG + Intergenic
980134479 4:128846569-128846591 CTGTCAGGGAAGAAGAGCAAGGG - Intronic
981634360 4:146859150-146859172 CAGTTTGTCTACAAGAGCAATGG - Intronic
985820206 5:2154562-2154584 CTTTCTGGATAGAAGAGCAAGGG - Intergenic
986158540 5:5201233-5201255 ATGACTGCCCAGAAGTGCAAGGG + Intronic
986859513 5:11910156-11910178 TTATCTGCCTAGCAGAGGAAAGG + Intergenic
989621273 5:43386886-43386908 CTGTCTGCCTAGAGTCTCAAGGG - Intronic
990027684 5:51215077-51215099 CTGTTTGCCTGGAACTGCAAGGG + Intergenic
992062004 5:73061220-73061242 CTGTTTTCCCAGAGGAGCAAAGG - Intronic
993631998 5:90297688-90297710 GTGTCTGCGAAGAAGAGGAAAGG - Intergenic
995879887 5:116832632-116832654 CTTACTGCCTATTAGAGCAAAGG + Intergenic
1000095236 5:157966003-157966025 CTGCCTGGCTCGAAGAGCCAGGG - Intergenic
1000729637 5:164817189-164817211 TATTCTGCCTTGAAGAGCAAAGG + Intergenic
1001570373 5:172726952-172726974 CTGTCAGCCTAGGAGGGCAGGGG + Intergenic
1002812831 6:650023-650045 CTTCCTGCCTGCAAGAGCAAAGG + Intronic
1003411868 6:5872021-5872043 CAGTGTGCCCAGAAGAGGAATGG - Intergenic
1004290131 6:14359138-14359160 CTCTCTGCCAGGAAGAACAAAGG + Intergenic
1005170348 6:22978238-22978260 TTGTCTGCATAGAAGATCAAAGG - Intergenic
1007255264 6:40523958-40523980 GTGTCTGCATAGAAGGGCAGGGG + Intronic
1010594544 6:77748085-77748107 CTGTGTGCCTGGAAAAGCCATGG - Intronic
1013375387 6:109509667-109509689 CTGGCTGCCTCCAAGAGCACAGG - Intronic
1014302630 6:119701587-119701609 CTGTGTAGCTAGAATAGCAAAGG + Intergenic
1015848948 6:137551922-137551944 ATCTCTGCCTTGAAGGGCAAAGG + Intergenic
1017400627 6:154056814-154056836 GTGCCTGCCAAGAAGAACAAGGG + Intronic
1019041451 6:169109294-169109316 CTATCTGCCTGGATGAGCATGGG - Intergenic
1024527290 7:50359742-50359764 CTGTCTGCAGAGGAAAGCAAGGG - Intronic
1024698812 7:51884662-51884684 CTGTCTGCTAACAAGAGCTATGG - Intergenic
1024973966 7:55096536-55096558 CTGTCTTCCTAGAAGTAAAATGG - Intronic
1026940520 7:74285178-74285200 CTTTCTGCCTAGCAGAGCAGAGG - Intergenic
1027463747 7:78487711-78487733 CTATCTGGCTAGCAGAGGAAGGG + Intronic
1027610225 7:80351413-80351435 CTGTTTACCTAGAGGAGAAAAGG - Intergenic
1027789182 7:82617379-82617401 CTGACATCCTAGCAGAGCAAGGG - Intergenic
1028115806 7:86996310-86996332 CTGTCAGCATAGAGGAGAAATGG + Intronic
1028903546 7:96127897-96127919 GTGGTTGCCAAGAAGAGCAAAGG - Intronic
1033275318 7:139967268-139967290 CTCTCTGCCTATTTGAGCAAAGG - Intronic
1034520709 7:151617230-151617252 CAGTCTGGCAACAAGAGCAAGGG + Intronic
1035063788 7:156090916-156090938 CTGTTTGCCTAGTGGAGCCAAGG - Intergenic
1035570636 8:670456-670478 CGGTCTGCCTGGCGGAGCAAAGG - Intronic
1037278661 8:17210791-17210813 CTGTCTGCCTACCTGAGCAGTGG - Intronic
1037287734 8:17318875-17318897 CTGGGTGCCTGGAAGAGCAGAGG - Intronic
1039974901 8:42354581-42354603 CTGTCTGCCCAGAAGTACAGTGG + Intronic
1040798987 8:51320730-51320752 CTGGCTGGCTAGAAGTGAAATGG + Intronic
1042115292 8:65425051-65425073 CTATCTGCCTAGCAGAGAAAGGG + Intergenic
1043089845 8:75885485-75885507 TTTTCTGCCTAGCAGAGGAAAGG + Intergenic
1043184171 8:77124701-77124723 CTTTCTTCCTAGATGAGAAATGG - Intergenic
1044399848 8:91758004-91758026 TTGTCTGCCTAGGAGCACAAAGG + Intergenic
1044773710 8:95665134-95665156 CTGTCTGCCTACTTGAGAAAAGG + Intergenic
1047415395 8:124660860-124660882 GTGTCTTCCCACAAGAGCAAAGG + Intronic
1047785404 8:128149615-128149637 CTGTCTTTCTAGAACAGCACTGG + Intergenic
1049742251 8:144246814-144246836 CTGTCTGCCTATAGGAGCATGGG + Intronic
1049958080 9:711641-711663 CTGTCTTGCAAGAAGAGAAAAGG + Exonic
1053316313 9:37054805-37054827 CTCACTGCCTAGCAGAGGAATGG + Intergenic
1054328345 9:63729169-63729191 TTGTCTGCCTTGAAGTGAAAGGG - Intergenic
1056290939 9:85143223-85143245 CTGTCTGTCTGGAAGAGCATAGG + Intergenic
1058789276 9:108425089-108425111 TTTGCTGCCAAGAAGAGCAAAGG - Intergenic
1059043540 9:110840589-110840611 CTGTCAGCCCTGCAGAGCAAGGG - Intergenic
1059158734 9:112013550-112013572 CTGTCTGCCCAGAGCAACAAAGG + Intergenic
1059960527 9:119560096-119560118 CTGTCTGCCTAGTTGAACAGAGG - Intergenic
1062105698 9:134753692-134753714 CTGTCTGCCTCGAACAGAACCGG - Intronic
1202795138 9_KI270719v1_random:114510-114532 GTGTCTGCCTTGAAGTGAAAGGG - Intergenic
1189847743 X:45151985-45152007 TTGGCTGCCTAGAAAAGAAATGG + Exonic
1191674216 X:63777923-63777945 CTGTGTGCCTGGAAAAGCCATGG - Intronic
1196883803 X:120224011-120224033 CTGGCTCCCTCGAAGAGCACAGG + Intergenic
1198775317 X:140173025-140173047 CTGTGTGCCTGGAAAAGCCATGG + Intergenic