ID: 928242706

View in Genome Browser
Species Human (GRCh38)
Location 2:29600595-29600617
Sequence GTTTCAGGCTGATATCGTGG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 68
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 66}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
928242701_928242706 3 Left 928242701 2:29600569-29600591 CCTGCTGGGAGATGGGCAATGCA 0: 1
1: 0
2: 1
3: 14
4: 164
Right 928242706 2:29600595-29600617 GTTTCAGGCTGATATCGTGGGGG 0: 1
1: 0
2: 0
3: 1
4: 66
928242700_928242706 9 Left 928242700 2:29600563-29600585 CCTAAGCCTGCTGGGAGATGGGC 0: 1
1: 1
2: 3
3: 18
4: 287
Right 928242706 2:29600595-29600617 GTTTCAGGCTGATATCGTGGGGG 0: 1
1: 0
2: 0
3: 1
4: 66

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
928242706 Original CRISPR GTTTCAGGCTGATATCGTGG GGG Intronic
902231417 1:15030002-15030024 GTTTCAGGCTGGTTTCATGCTGG - Intronic
905303693 1:37003464-37003486 TTTTGAGGCTGATACCATGGAGG - Intronic
909334344 1:74453963-74453985 GTTTCAGGCTAACACCGTAGGGG + Intronic
919736167 1:200952533-200952555 GTTTCGGGCTGATAACGGGGAGG + Intergenic
922143671 1:222916842-222916864 GTTTCAGGCTGAAAGAGTGAGGG + Intronic
923536541 1:234856728-234856750 GTTTAAGGCTGTTCCCGTGGAGG + Intergenic
1063690309 10:8280942-8280964 GTTTCACCCTGAGATGGTGGAGG + Intergenic
1074792181 10:116901193-116901215 GTTTCAGACAGATCTAGTGGAGG - Intronic
1075349429 10:121710607-121710629 TTTTCAGGCTGATTTGGGGGAGG + Intergenic
1080989555 11:37514405-37514427 GTTCCAGGCTGATATCCTTATGG + Intergenic
1084209106 11:67612792-67612814 GTTTCAGGCAGCTGTAGTGGAGG + Intergenic
1088453508 11:110008842-110008864 CTTTCAGGCTGAATTTGTGGTGG - Intergenic
1088933730 11:114378051-114378073 GTTTCAGGATGATTTCCTGTAGG + Intergenic
1094077648 12:26495498-26495520 GTTTATGGCAGATATTGTGGTGG + Intronic
1096077221 12:48813494-48813516 GTTTCAGGCAGAGAATGTGGAGG + Intergenic
1098909717 12:76196506-76196528 GTTTTAGCCTGAGATCTTGGTGG + Intergenic
1102058943 12:109917642-109917664 GTATCACGCTGATATAATGGTGG - Exonic
1103723813 12:122988187-122988209 GTGACAGGGTGACATCGTGGGGG + Intronic
1105599472 13:21873168-21873190 TTTTCAGGGTGATGTCGTGATGG + Intergenic
1107296973 13:38919659-38919681 GTTTGAGGCTGTTTTCATGGGGG + Intergenic
1107866783 13:44710759-44710781 GTTTCAGGTTGATGTGGAGGTGG + Intergenic
1110198434 13:72818656-72818678 GTTTAAGACTGATAACATGGTGG - Intronic
1119170231 14:72529339-72529361 GGTTCAGGCTGTTATAATGGTGG + Intronic
1119950901 14:78744116-78744138 GTACCAGGCTGATATCCTGCAGG + Intronic
1121175934 14:91890649-91890671 GTTTCAGTCTGGTTTTGTGGGGG + Intronic
1122051765 14:99065668-99065690 GTCTCAGCCTGATCTCCTGGGGG - Intergenic
1130764663 15:86857764-86857786 GGTTCAGGCTGCCATCCTGGGGG - Intronic
1135234612 16:20743378-20743400 GTTTCATGCTGCTTTCGTTGCGG + Intronic
1143796650 17:9342389-9342411 GTTTCAGGATGATCCAGTGGGGG + Intronic
1149626814 17:58085304-58085326 GGTGCAGGCTGAAATGGTGGTGG + Intronic
1152115232 17:78382332-78382354 GGTTCAGCCTGAGATGGTGGGGG + Intronic
1156798908 18:41084190-41084212 GTTTCAGGCTCATGTCATTGTGG + Intergenic
1157723055 18:49940458-49940480 GTTCCAGGGTGATATGATGGGGG + Intronic
925682720 2:6439920-6439942 GTGTGAGGCTGATGTCTTGGTGG - Intergenic
928242706 2:29600595-29600617 GTTTCAGGCTGATATCGTGGGGG + Intronic
931638906 2:64364176-64364198 GCTTCAGTCTGATGTGGTGGAGG + Intergenic
939984321 2:148814999-148815021 GTTGGAGGCTGAAATCATGGGGG - Intergenic
948283069 2:236763151-236763173 GGTTCATGCTGACATTGTGGTGG + Intergenic
948333520 2:237190480-237190502 GTTTCAGGCAGATAACTAGGGGG - Intergenic
1170730419 20:18970109-18970131 CTTTCAGGCTGAAATCAAGGTGG + Intergenic
1174683101 20:52427121-52427143 ATTTAAGAGTGATATCGTGGGGG + Intergenic
1174685036 20:52446482-52446504 GATTCAGGCAGACATCATGGTGG + Intergenic
1179105090 21:38392407-38392429 GGTCCAGGCTGATCTCCTGGGGG + Exonic
1182174197 22:28266595-28266617 GTTTCAGGATGACAGCCTGGTGG + Intronic
1184333916 22:43842078-43842100 GATTCAGGCTGAGACCGTGCGGG - Intronic
949966767 3:9363233-9363255 ACTTCAGGCGGATCTCGTGGCGG + Exonic
951786158 3:26421530-26421552 GTTCTAGCCTGATATCCTGGTGG + Intergenic
972627163 4:40810925-40810947 TTTTCAGTCTGGTATGGTGGAGG - Intronic
980719986 4:136682996-136683018 GTTTCAGGCTGCTAGCTTTGTGG - Intergenic
985126048 4:186695671-186695693 GTTTCAGCCTTATATTCTGGTGG + Intronic
986817420 5:11428060-11428082 TTTTCATGCTGTTCTCGTGGTGG - Intronic
987403561 5:17502436-17502458 GTTTCAGACTGCAATGGTGGTGG + Intergenic
987497026 5:18659125-18659147 GTTTCAGGATGTTATCATGCAGG + Intergenic
987836389 5:23168604-23168626 GTTTCAGGATGATCCAGTGGTGG - Intergenic
992422712 5:76622554-76622576 GTTTCAGGCTAACATTGTGATGG + Intronic
995587004 5:113658431-113658453 ATTTCACACTGATATTGTGGGGG + Intergenic
995677839 5:114683275-114683297 ATTTCAGGTTGATATGGTGAAGG + Intergenic
997691331 5:135829452-135829474 TTTTCAAGCTGATATCGCCGCGG + Intergenic
997906076 5:137818637-137818659 GTGTCAGGCAGATAACTTGGCGG - Intergenic
999318397 5:150598855-150598877 GGTGCAGGCTGACATGGTGGGGG + Intergenic
1001756762 5:174176334-174176356 GCTGGAGGCTGATATCCTGGTGG + Intronic
1019951832 7:4379396-4379418 GTTTCAGGGTGACATTGTGAAGG - Intergenic
1021383025 7:19991454-19991476 GGTTCTGGCTGTTATCGTGTTGG - Intergenic
1021626696 7:22600653-22600675 GTTTCAGAATGATATTGTTGTGG + Intronic
1050713519 9:8493140-8493162 TTTTCATGCTGATATCGAAGGGG + Intronic
1062023627 9:134330497-134330519 GTTTCAGGGTGCTATGGTGTGGG + Intronic
1062721253 9:138045375-138045397 GTTTCAGGCAGAGAGAGTGGTGG + Intronic
1187910336 X:24105418-24105440 GTTTCAGAATTAGATCGTGGTGG - Intergenic