ID: 928242969

View in Genome Browser
Species Human (GRCh38)
Location 2:29602460-29602482
Sequence TCTCCAAGCAGGTGGCCTGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 285
Summary {0: 1, 1: 0, 2: 3, 3: 25, 4: 256}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
928242969_928242973 19 Left 928242969 2:29602460-29602482 CCACCAGGCCACCTGCTTGGAGA 0: 1
1: 0
2: 3
3: 25
4: 256
Right 928242973 2:29602502-29602524 CTTAATTTTCCAGTTTAGCAAGG 0: 1
1: 0
2: 1
3: 18
4: 221

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
928242969 Original CRISPR TCTCCAAGCAGGTGGCCTGG TGG (reversed) Intronic