ID: 928242969

View in Genome Browser
Species Human (GRCh38)
Location 2:29602460-29602482
Sequence TCTCCAAGCAGGTGGCCTGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 285
Summary {0: 1, 1: 0, 2: 3, 3: 25, 4: 256}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
928242969_928242973 19 Left 928242969 2:29602460-29602482 CCACCAGGCCACCTGCTTGGAGA 0: 1
1: 0
2: 3
3: 25
4: 256
Right 928242973 2:29602502-29602524 CTTAATTTTCCAGTTTAGCAAGG 0: 1
1: 0
2: 1
3: 18
4: 221

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
928242969 Original CRISPR TCTCCAAGCAGGTGGCCTGG TGG (reversed) Intronic
900298508 1:1964942-1964964 TCCACAAGCAGGTGGTGTGGGGG - Exonic
900421544 1:2557984-2558006 AGTCCAAGCTGCTGGCCTGGGGG - Intronic
900483585 1:2910933-2910955 TCTCCAAGCATCTTGTCTGGAGG + Intergenic
900655929 1:3757030-3757052 TGTCAAAGCAGGGGGTCTGGAGG - Intronic
900710605 1:4111068-4111090 TCTCAAAGCAGGTGACCAGGAGG + Intergenic
900799340 1:4727757-4727779 TCTCCATACTGCTGGCCTGGAGG + Intronic
900999646 1:6142402-6142424 TCTACAAGGAGGTGGGCAGGCGG - Exonic
901123169 1:6911275-6911297 TCTTCATGCAGGTGGCCTCCTGG - Intronic
901532665 1:9863435-9863457 TCTCCCCGCATGTGGCTTGGAGG - Intronic
902447122 1:16474465-16474487 TCTCCCAGCAGCTGAGCTGGCGG - Intergenic
904756219 1:32770214-32770236 TCGACAGGTAGGTGGCCTGGGGG - Exonic
905208192 1:36355014-36355036 TCACCAGGAAGGTGGCCTGCAGG + Intronic
906107817 1:43305226-43305248 TCTGGAAGCAGGTGGGCTGCGGG - Exonic
906125011 1:43422427-43422449 TCTCCAAGCCTGGGGCCTGGAGG + Intronic
906409670 1:45568529-45568551 CTGCCAAGCACGTGGCCTGGAGG + Exonic
906955659 1:50371584-50371606 TCCCAGAGCAGGTGGACTGGAGG - Intergenic
907275444 1:53314357-53314379 TCCCCTAGCATGGGGCCTGGTGG - Intronic
907544017 1:55243603-55243625 TCTCTGAGGAGGTGACCTGGAGG - Intergenic
907904658 1:58773365-58773387 TCCACAACAAGGTGGCCTGGGGG - Intergenic
908038354 1:60080699-60080721 TCCCCCAGCATGTGGCCTGGGGG - Intergenic
909566063 1:77054732-77054754 TTTCCCATCAGGTGTCCTGGAGG + Intronic
911926994 1:103845453-103845475 TCACCAAGAAGTTGGTCTGGAGG - Intergenic
915150340 1:153825870-153825892 TCTCTAAGAAGCTGGACTGGTGG - Intronic
915660890 1:157403971-157403993 TCTTTCAGCAGGTGGCCTGAGGG - Intergenic
917087671 1:171319900-171319922 TCTCAAAGCAGGTGGGCTCCAGG - Exonic
920387347 1:205578406-205578428 TCTCCTAACAGCTGGCCTTGAGG + Intronic
920704517 1:208241955-208241977 TCTCCTTGGTGGTGGCCTGGAGG - Intronic
921338045 1:214107882-214107904 TCTCCCAGGAGCTGGGCTGGGGG - Intergenic
922484710 1:225964395-225964417 ACTCCAAGCTGGGGCCCTGGGGG - Intergenic
922706640 1:227793932-227793954 TCTCCAAACAGGTCTCCTGCTGG + Intergenic
924598220 1:245465437-245465459 ACCCCAAGCAGGAGGCATGGGGG - Intronic
1065390387 10:25175993-25176015 TCTCCTCGCGCGTGGCCTGGAGG - Exonic
1065857512 10:29842295-29842317 TCCCCAGGCTGGTGGCCAGGGGG + Intergenic
1067079617 10:43205714-43205736 CCAGCTAGCAGGTGGCCTGGGGG - Intronic
1067082778 10:43221074-43221096 TCTCCCAGCAGGGCGTCTGGTGG - Intronic
1069681542 10:70289016-70289038 TCTCCAAGCAGGTGTCCACATGG - Intergenic
1069794004 10:71040902-71040924 GCTCCAAGCATGTGCCCAGGAGG - Intergenic
1071124625 10:82319711-82319733 TCTCCAGGCAGGTGGGCTGCAGG - Intronic
1072782298 10:98259170-98259192 TCCCCAGGCAGGTGACCTGGTGG + Exonic
1073042746 10:100618483-100618505 ACTCCAAGCACTTGGGCTGGTGG - Intergenic
1074183188 10:111080314-111080336 TCTTCAAGCAGTGGCCCTGGAGG - Exonic
1075398461 10:122144131-122144153 TCTGCCAGCAGATGGCCTTGGGG - Intronic
1076909526 10:133379988-133380010 TCCCCTCGCAGGTGGCGTGGTGG + Exonic
1077191576 11:1257951-1257973 TGGCCAAGCAAGGGGCCTGGAGG + Intronic
1077255184 11:1578364-1578386 CCTCCAAGCAGGCCGCCTGTAGG + Intergenic
1077780578 11:5324348-5324370 TCTCCAAGCAGGAAGATTGGAGG - Intronic
1078191636 11:9096062-9096084 TCCCCCAGCAGGTGGGCTGAGGG - Intronic
1078466218 11:11552444-11552466 CCTCCCAGCACGGGGCCTGGGGG + Intronic
1080648518 11:34204559-34204581 TGCCCACGCAGGTGGCCAGGAGG + Exonic
1081277825 11:41171890-41171912 TTTCCCAGCAGCTGGCCTGGTGG - Intronic
1081864453 11:46352040-46352062 GCTCCAGGCAGCTGGGCTGGGGG + Intronic
1083147088 11:60767753-60767775 TCTCCTAGGTGGGGGCCTGGAGG + Intronic
1087629602 11:100635173-100635195 TTTCCAAGCAGAGGGTCTGGAGG + Intergenic
1089194840 11:116688181-116688203 TTACAAAGCAGGTGGCCTGCTGG - Intergenic
1089209412 11:116790343-116790365 TCTGCAGGTAGGTGTCCTGGCGG + Exonic
1090419618 11:126565291-126565313 TCCTCAAGCAGTTGCCCTGGGGG - Intronic
1091392174 12:132250-132272 TCCCCAAGCAGGGAGCCTCGTGG + Intronic
1091795517 12:3295536-3295558 CCTCCAAGCAGGGGCCCGGGAGG + Intergenic
1092061370 12:5553660-5553682 GCTCCTAGTAGGTGGCATGGTGG + Intronic
1094825258 12:34264620-34264642 TTTCCAAGCAGGGTGCCGGGAGG - Intergenic
1103403471 12:120659003-120659025 TCTCCAAGGAGCAGGCCTGGAGG - Intronic
1104378491 12:128286337-128286359 TGTCTAAGCAGGGGCCCTGGAGG - Intronic
1104858578 12:131913187-131913209 TCCCCCTGCAGGTGACCTGGTGG + Exonic
1106792334 13:33168382-33168404 TCCCCAGGCAGGTGGTCCGGTGG - Intronic
1107178731 13:37430942-37430964 TCTTCATGAAGGTGGGCTGGAGG + Intergenic
1108671906 13:52698968-52698990 TTTTGAAGCAGGTGACCTGGAGG + Intronic
1111875514 13:93889269-93889291 TCTATAATCAGGAGGCCTGGAGG + Intronic
1112617917 13:101024411-101024433 TCACCAACCAGGAGCCCTGGGGG - Intergenic
1114365658 14:22025077-22025099 TCTCCAAGATGGTGGATTGGAGG + Intergenic
1118482634 14:66182323-66182345 CCTCCAAGCAGGGCTCCTGGAGG + Intergenic
1119718450 14:76875034-76875056 TCAAGAAGCAGGTGTCCTGGAGG + Intergenic
1119971281 14:78973225-78973247 TCTCCAAGTAGTTGCCATGGAGG + Intronic
1120637331 14:86968249-86968271 TATCCAAGAAGGTTGCCTGTGGG + Intergenic
1121227755 14:92333901-92333923 TCACCAAGCAGGTGCCCTCAGGG + Intronic
1121520788 14:94584929-94584951 TCTCCAGGCAAGTGCCATGGTGG + Intronic
1121883102 14:97517893-97517915 TCACCCAGCAGATGGGCTGGTGG - Intergenic
1122825490 14:104368553-104368575 CCTCCAGGCAGGTGCCCAGGCGG - Intergenic
1122835247 14:104427590-104427612 TCTCCCTGGAGGTCGCCTGGTGG + Intergenic
1122932131 14:104938649-104938671 TCTGCAAGCTGGTGGCCAGAAGG + Exonic
1129112350 15:73344780-73344802 TCACCAAGCAGGGGGCCTTCTGG + Intronic
1129605881 15:77024835-77024857 GCTCTCAGCAGGTGGCCCGGGGG - Intronic
1129783818 15:78294246-78294268 TCTCTAAGTAGGTGACATGGAGG - Intronic
1129852267 15:78800250-78800272 TCGCCAAGCAGGTGGCAGGCCGG + Exonic
1129955584 15:79633929-79633951 TTTGCAAACAGGTGGCCTGTGGG - Intergenic
1130247104 15:82262312-82262334 TATCCAAGCAGGTGCACTGCCGG + Intronic
1130250731 15:82298823-82298845 TCGCCAAGCAGGTGGCAGGCGGG - Intergenic
1130453519 15:84080602-84080624 TATCCAAGCAGGTGCACTGTCGG - Intergenic
1130928367 15:88401934-88401956 TCTCCAGCCAGGAGCCCTGGCGG - Intergenic
1130960257 15:88654288-88654310 TCAGCAAGCAGGTAGCATGGTGG - Intronic
1132359668 15:101201865-101201887 TCTCCCAGTAGGTGTCCAGGAGG + Intronic
1132403135 15:101526173-101526195 GCTGCAAGCTGGTGGCCTGGAGG - Intergenic
1132684045 16:1154844-1154866 CCCCCCAGCAGGTGGCCTTGGGG + Intronic
1132792419 16:1699137-1699159 TCTCCAAGCAGCTGTCATGACGG - Exonic
1132941185 16:2509137-2509159 TCTGCAGGCAGGTGGGCAGGTGG - Intronic
1133026179 16:2989879-2989901 TATCCAAGCAGTGGGCCTGTGGG - Intergenic
1133475404 16:6116539-6116561 TCTCCAAGCAGGTGGGTAAGTGG - Intronic
1134044134 16:11088997-11089019 TGGAGAAGCAGGTGGCCTGGGGG - Intronic
1134099151 16:11439415-11439437 TCTCTGAGCAGCTGGCCTGCTGG - Intronic
1136345186 16:29670892-29670914 TGTTCAAGGGGGTGGCCTGGGGG + Intronic
1136989188 16:35141736-35141758 TCTCCAAGCCTGTGTCGTGGTGG - Intergenic
1138453130 16:57105750-57105772 TCTCCAAGCTCCTTGCCTGGGGG + Intronic
1139894464 16:70277285-70277307 TGTCAGAACAGGTGGCCTGGTGG + Intronic
1140031926 16:71345729-71345751 CCCCCAAGGAGGTGGCCAGGAGG - Intergenic
1142067830 16:88072849-88072871 TCCCAAAGCAGGTGGCACGGAGG - Intronic
1142193378 16:88728143-88728165 ACTCCCAGCAGGTGGCCTTTAGG - Intronic
1142285747 16:89170864-89170886 GCTCCAGGCAGGGGGCCTCGGGG + Intergenic
1147497975 17:40936339-40936361 TCTCCAGGTAGGAGGCCAGGCGG + Exonic
1147540141 17:41350551-41350573 TCTCCAGGTAGCTGGCCAGGCGG + Exonic
1147542158 17:41369534-41369556 TCTCCAGGTAGCTGGCCAGGCGG + Exonic
1147543694 17:41382030-41382052 TCTCCAGGTAGCTGGCCAGGCGG + Exonic
1147545371 17:41397323-41397345 TCTCCAGGTAGCTGGCCAGGCGG + Exonic
1147547235 17:41411478-41411500 TCTCCAGGTAGTTGGCCAGGCGG + Intergenic
1147548878 17:41424163-41424185 TCTCCAGGTAGTTGGCCAGGCGG + Exonic
1147550861 17:41440561-41440583 TCTCCAGGTAGTTGGCCAGGCGG + Exonic
1147557645 17:41489537-41489559 TCTCCAGGTAGTTGGCCAGGCGG + Exonic
1147645210 17:42029136-42029158 TGACCATGGAGGTGGCCTGGAGG + Intronic
1148844618 17:50522091-50522113 TCTCCCAGCAGGTGTGGTGGAGG - Intronic
1148845584 17:50527983-50528005 CCTCCAAGCACTTGCCCTGGCGG + Intronic
1150930687 17:69581497-69581519 TCTGCAAACAGGTGTGCTGGAGG - Intergenic
1150991854 17:70268913-70268935 TCTGCAAGCTGGAGGTCTGGTGG - Intergenic
1151770817 17:76159467-76159489 TCTCCAAGCACGTGAAGTGGAGG + Exonic
1151822834 17:76506422-76506444 TCTCCCTGCTGGAGGCCTGGGGG - Intergenic
1152235749 17:79137541-79137563 AGTCCAGGCAGGTGGACTGGGGG - Intronic
1152385499 17:79971852-79971874 TCTCGGAGCAGGTGGCATGGGGG + Intronic
1152763506 17:82122258-82122280 GGTCCCAGCAGCTGGCCTGGTGG - Intronic
1153530930 18:6044953-6044975 TCCACCAGCAGGTGGCCTGAGGG - Intronic
1153543305 18:6180369-6180391 ACTTCAGGCATGTGGCCTGGGGG - Intronic
1154111018 18:11568426-11568448 TGTCAAAGCAGATGACCTGGTGG - Intergenic
1155365709 18:25047398-25047420 TCTCAAAGCTGCTGGCCTGTTGG + Intergenic
1157404778 18:47413712-47413734 TCTCAGAGGAAGTGGCCTGGTGG - Intergenic
1158314957 18:56201686-56201708 CCTCCATGAAGCTGGCCTGGAGG - Intergenic
1160537640 18:79603627-79603649 TCCCCAGGCAGGAGACCTGGAGG + Intergenic
1160964696 19:1741953-1741975 TCTCCCAGCTGGTGTCCTTGGGG - Intergenic
1160967847 19:1754350-1754372 TCCCCAGCCAGGTGGCCTGGCGG - Exonic
1163382317 19:16977295-16977317 TCTCCAAGGTGCTGGCCAGGGGG - Intronic
1163403137 19:17106546-17106568 CCTCCCAGCAGGTGGCCAGGGGG + Intronic
1163419131 19:17204368-17204390 TCTGCCAGTAGGTGGCCTTGGGG + Intronic
1163664990 19:18598979-18599001 ACTCCAAGGTGGGGGCCTGGTGG - Intronic
1164696815 19:30251131-30251153 TCTGTGATCAGGTGGCCTGGTGG - Intronic
1165357031 19:35310679-35310701 TCTCCAAAAAGGGGACCTGGTGG + Intronic
1166104521 19:40590722-40590744 CCCCCCAGCAGGTGGCCTGACGG + Exonic
1166326218 19:42052719-42052741 TCCCCAAGCGGCTGGCCTGGAGG - Intronic
1167169211 19:47820021-47820043 TCTCCTAGCAGGGGGTTTGGGGG + Intronic
1167276294 19:48542052-48542074 TCTCAGAGGAGGTGGCCTGATGG - Intergenic
1167301140 19:48678446-48678468 TCTGCAGGCTGGTGACCTGGAGG - Intergenic
1167322730 19:48806505-48806527 ACTCCCTGCAGGTGGCATGGCGG - Exonic
1167459043 19:49614778-49614800 GCTCCAAGCAGCTGCCATGGTGG + Intronic
1168326365 19:55540770-55540792 TCTCCATCCAGGTGGCCCTGGGG + Exonic
925188510 2:1865270-1865292 TGTGCAAGCAGCTGGGCTGGAGG - Intronic
925732367 2:6928553-6928575 GCTAGAAGCTGGTGGCCTGGGGG - Intronic
928242969 2:29602460-29602482 TCTCCAAGCAGGTGGCCTGGTGG - Intronic
929111379 2:38407823-38407845 TCTTCCAGGAGTTGGCCTGGAGG - Intergenic
932474088 2:71990363-71990385 TTTCCAGCCAGGTGGCCTGTGGG - Intergenic
932606546 2:73169495-73169517 TCGACAAGCAGGAGGTCTGGTGG + Intergenic
933820381 2:86105747-86105769 TCTCCAAGAACATGCCCTGGCGG - Exonic
933925880 2:87090940-87090962 TCGACAAGCAGGAGGTCTGGTGG - Intergenic
934124102 2:88869699-88869721 GCTCCAATCAGGTGGTCTGGAGG + Intergenic
934676495 2:96253302-96253324 CCCCGGAGCAGGTGGCCTGGGGG + Exonic
936083297 2:109449650-109449672 TCTCCAACCAGCTGCTCTGGTGG - Intronic
936089081 2:109489355-109489377 AATCCAGGCATGTGGCCTGGGGG + Intronic
941104544 2:161338113-161338135 TCTCCAAGCACATAGCCTTGTGG + Intronic
941125659 2:161580334-161580356 TGTCCAGGTAGGAGGCCTGGTGG - Intronic
942841050 2:180360845-180360867 TCTCCAAGATGGTGGATTGGAGG - Intergenic
943939306 2:193970600-193970622 TGTCCAAGCAGGCAGCCTGTGGG - Intergenic
944131475 2:196352217-196352239 CCTCTTAGCAGGTGGCCTGGTGG - Intronic
944399314 2:199307401-199307423 TCTAAAAGAAGGTGCCCTGGTGG + Intronic
948601840 2:239111839-239111861 TCTCCACGCAGCTGGCCTCCCGG - Intronic
948851660 2:240711315-240711337 TCTCCTGGCTGGGGGCCTGGCGG + Intergenic
948909575 2:240996361-240996383 TCTTCAGGCGGGTGGGCTGGTGG - Intergenic
948941606 2:241199685-241199707 GCCCTCAGCAGGTGGCCTGGCGG - Intronic
1169734365 20:8822145-8822167 TCTCCAAGCACCTGGCATAGAGG + Intronic
1170566636 20:17611538-17611560 GCTCCCAGCAGGTGGCCTGAAGG + Intergenic
1172029749 20:31973580-31973602 TCTCCAAGGAGGTGGCATGTGGG + Intronic
1172248544 20:33462973-33462995 TCTCCAGGCTGGTGGCCTCAGGG + Intergenic
1174371199 20:50089309-50089331 CCTCCAAGGAGGGGGCTTGGCGG + Intronic
1174755151 20:53150929-53150951 TCTCCAAGCAGCAGGCTTTGTGG - Intronic
1175285167 20:57833072-57833094 TCTCCAAGCAGGCGGTCAGTGGG + Intergenic
1175491404 20:59383254-59383276 ACTCTAACCAGGCGGCCTGGAGG - Intergenic
1175948000 20:62567651-62567673 TCTGAAAGCAGGTGGCAGGGGGG + Intronic
1176891848 21:14327841-14327863 TCTCCAGTCAGGAGGCATGGAGG - Intergenic
1179250413 21:39667089-39667111 CCTCCAGGGAGGTGGCCTCGGGG - Exonic
1179594180 21:42431041-42431063 GCTCCACGCAGCTGTCCTGGTGG + Intronic
1179722725 21:43324703-43324725 TCTGGGAGCAGGAGGCCTGGGGG - Intergenic
1180008678 21:45035210-45035232 TCCACAGGCAGGTGACCTGGAGG + Intergenic
1180044337 21:45296804-45296826 TTTCCAAACTGGTGGCCGGGGGG + Intergenic
1182584191 22:31334363-31334385 TTTCACAGCAGGTGTCCTGGTGG + Intronic
1183279750 22:36925668-36925690 TCTCTAAGGAGGTGACCTGGGGG - Intronic
1183335639 22:37244393-37244415 CCTCCACGCAGGGGGCCTGTGGG - Intronic
1183934134 22:41252540-41252562 TCTCGAAGCAGCTGGGCTGACGG + Intronic
1183974065 22:41500185-41500207 TCTCCAGGCACTGGGCCTGGTGG - Intronic
1184686403 22:46098313-46098335 TCACCATCCAGGTGGCCTGGGGG + Intronic
1184783666 22:46661545-46661567 TCCCCCAGCAGGTGGGCAGGCGG + Intronic
1184828442 22:46968954-46968976 TCTCCATCCACGTGGACTGGTGG + Intronic
1184883061 22:47324041-47324063 TCTGCAAGCAGTTTGCCAGGTGG - Intergenic
1185247392 22:49780454-49780476 CCACCCAGCAGGAGGCCTGGCGG + Intronic
1185343965 22:50303424-50303446 TCTCTGAGCAGGTGGCATGCTGG + Intronic
949205877 3:1438896-1438918 TCTCTAAACACGTGGCCTGGTGG - Intergenic
950168782 3:10821967-10821989 TCTGAAAGGAGGTGGTCTGGGGG - Intronic
950485346 3:13269996-13270018 TCTCCAATCTGGTGGCCTAGGGG - Intergenic
953582169 3:44167110-44167132 TCCCCAAGGAGGTGGGATGGAGG + Intergenic
954035323 3:47848173-47848195 TCTCCAGGCAGGACACCTGGAGG - Exonic
954384795 3:50238372-50238394 GCTCCAAGGAGCAGGCCTGGTGG - Intronic
954692266 3:52401873-52401895 TCTCCTAGGAGCTGTCCTGGTGG - Exonic
955124075 3:56092265-56092287 TCTTCAAGTAGGTGGCATGTGGG - Intronic
955199999 3:56843069-56843091 TCTCTGAGGAGGGGGCCTGGTGG - Intronic
957998029 3:87716121-87716143 TCTCCATTCTGTTGGCCTGGGGG - Intergenic
959889780 3:111541551-111541573 TCTCCCACCAGGTTGGCTGGAGG - Intronic
960265422 3:115615706-115615728 ACTCCTAGCACCTGGCCTGGTGG - Intergenic
964371304 3:156003541-156003563 TCTCCCAGCAGGAGGCATGGGGG + Intergenic
968578584 4:1379257-1379279 TGTCCTAGAAGGAGGCCTGGTGG + Intronic
969253894 4:5989879-5989901 TCTGCAAGGAGGAAGCCTGGAGG - Intergenic
971811112 4:31428475-31428497 TTTGCATGCAGGTGGCCTGCAGG - Intergenic
972398188 4:38674891-38674913 TCTGAAAGCAGCTTGCCTGGAGG - Intronic
972693657 4:41423621-41423643 TCTCCAAGCCTATAGCCTGGGGG + Intronic
982128539 4:152205774-152205796 TTTCCAAGTAGGCTGCCTGGTGG + Intergenic
982175901 4:152705319-152705341 TCTTCAACCAGCTGGGCTGGCGG + Intronic
985145127 4:186888885-186888907 ACTCCAAGAAAGTGGACTGGGGG + Intergenic
985766924 5:1784971-1784993 CATCCATGCAGGTGGCGTGGGGG + Intergenic
985860118 5:2464272-2464294 CCTCCATGCAGGTGGCCTGGCGG + Intergenic
986527884 5:8700411-8700433 TTGCCAAGCCTGTGGCCTGGTGG - Intergenic
992074193 5:73175871-73175893 TATGCAGGGAGGTGGCCTGGAGG + Intergenic
994682794 5:102910171-102910193 TCTCTAAGAACGTGACCTGGGGG - Intronic
998107208 5:139476205-139476227 TCTCCAAGCCTCTGGACTGGGGG - Exonic
998213649 5:140220763-140220785 TCTTCAAGCAGGAGGGCAGGTGG + Intronic
998642037 5:144021994-144022016 TCTCTCAGCAGGTAGCCTGAAGG + Intergenic
1001246901 5:170111609-170111631 TCTCCCAGCAGCTTCCCTGGCGG + Intergenic
1001481033 5:172089367-172089389 TCTCCAACCTGGTGGGTTGGTGG + Intronic
1003105055 6:3209095-3209117 TCTCCAGACAGGTGGGGTGGGGG + Intergenic
1003219381 6:4144864-4144886 TCCCAAAGCAGGTGCACTGGGGG - Intergenic
1003306225 6:4932011-4932033 TCTCCCAGCAGTTTTCCTGGTGG - Intronic
1005756051 6:28925773-28925795 TCTGGAGGCAGGTGACCTGGGGG + Intergenic
1007038287 6:38698390-38698412 TCTCCAATCAGGTAGATTGGTGG - Intronic
1007742597 6:44021885-44021907 TCTCCAGGCCTGAGGCCTGGTGG - Intergenic
1007743173 6:44025104-44025126 TCTCCAGGCCTGAGGCCTGGTGG - Intergenic
1019167290 6:170107133-170107155 TCACCAAAGAGGTGTCCTGGGGG - Intergenic
1020049583 7:5072767-5072789 TCCCGCAGCAGGTGCCCTGGGGG - Intronic
1020850606 7:13347844-13347866 GCTCCAAGAAGGTGGATTGGAGG - Intergenic
1021007794 7:15421646-15421668 TCACCAAGAAGGTGGACAGGAGG + Intronic
1021510237 7:21426982-21427004 ACTCAAAGCAGGGGGCCTGAGGG + Intergenic
1023873423 7:44274710-44274732 TCTGCTGGCGGGTGGCCTGGAGG + Intronic
1024006726 7:45229767-45229789 TCTCCCAGGAGGTGGCGTGGTGG - Intergenic
1024249783 7:47497364-47497386 TCCCCAAGCACAGGGCCTGGTGG - Intronic
1024530002 7:50383716-50383738 TCTCTAAGCCGGTGCCCTGGGGG + Intronic
1026977769 7:74508809-74508831 TCTCCTAGCAGGTGACCTGGGGG + Intronic
1032709380 7:134448896-134448918 TCACCCAGCAAGTGGCCAGGAGG - Intronic
1033492423 7:141856335-141856357 TCTCCAAGTAGATGGATTGGAGG - Intergenic
1034936794 7:155205029-155205051 TCTGCAAGCAGGTGGAATGCAGG + Intergenic
1034970926 7:155418638-155418660 TTTCCAGGCAGTGGGCCTGGGGG + Intergenic
1035333493 7:158111429-158111451 TCCCCAGCCAGGTGGCCTTGTGG - Intronic
1035372405 7:158387795-158387817 TCTCCAAGCCGCTGCCCTGTGGG + Intronic
1036170140 8:6475731-6475753 TGTCCAAGCAGGTTTCCTGCAGG + Intronic
1036665308 8:10733551-10733573 GCTCCACGCAGCCGGCCTGGCGG + Intronic
1037338636 8:17816974-17816996 TCTCCAAGAAGGTGGGATGGTGG + Intergenic
1037855979 8:22370869-22370891 CCTCCAGGCTGGTGGGCTGGTGG + Intronic
1038266024 8:26040604-26040626 TCACCAAGCAGGTGAGCCGGAGG - Exonic
1038848575 8:31252542-31252564 TCTCAAATCAAGTGTCCTGGAGG - Intergenic
1039433811 8:37545970-37545992 TCTCCAGGCATGGGGCTTGGGGG - Intergenic
1040470672 8:47733660-47733682 TCTCCAGGCTGCTGGACTGGAGG - Intronic
1041215309 8:55594720-55594742 TCTCCAAACAGGTGCCATGGAGG + Intergenic
1045506566 8:102782734-102782756 TCACCACGCAGGTGTCCAGGTGG + Intergenic
1045556267 8:103217611-103217633 CCACCAACCAGGTGGCCTGATGG - Intronic
1047309262 8:123677863-123677885 TCTGCAGGCAGGCGGGCTGGGGG + Intergenic
1051421766 9:16896134-16896156 TCTCCAAGCTGGTTACCTTGAGG + Intergenic
1058197738 9:101999619-101999641 TCTCCATGCAGGTGACCAGCTGG - Intergenic
1058545774 9:106059399-106059421 TCTGCAGGCAGGTTGTCTGGTGG + Intergenic
1059771010 9:117425727-117425749 TCTCCCAGCAGCTGGCCAGCAGG + Intergenic
1060723289 9:125992210-125992232 CCTCCAAGCATGTGGCTTTGAGG - Intergenic
1061813972 9:133182169-133182191 GCTCCATGCTGGGGGCCTGGTGG + Intergenic
1062086221 9:134650328-134650350 TCTGCTGGCGGGTGGCCTGGGGG + Intronic
1062188254 9:135230063-135230085 CCTCCCAGCTGGTGGCCAGGAGG - Intergenic
1062555616 9:137112367-137112389 CCTCCAAGCAGGTAGCCTGGAGG - Intronic
1185747905 X:2586134-2586156 TCTCCCAGCAGATAGCCGGGTGG + Intergenic
1187098618 X:16170251-16170273 CCTCCATGCAGGTGTCCTTGAGG - Intronic
1189491554 X:41474703-41474725 TCTCCAAGCTGCTGGCCCCGAGG + Exonic
1189761769 X:44329077-44329099 TCACCAAGTAGGAAGCCTGGAGG - Intronic
1191210007 X:57875065-57875087 TTTCCAAGATGGTGGACTGGAGG + Intergenic
1193278544 X:79620853-79620875 TCCACAGGCAGGTGGTCTGGGGG - Intergenic
1195465329 X:105173161-105173183 TTTCCATGTAGGTGGCCAGGTGG - Intronic
1196475567 X:116080440-116080462 TTTCCAAGCAAGTCACCTGGAGG + Intergenic
1196812059 X:119636696-119636718 GCTCCAAGCAGCTGCGCTGGGGG - Intronic
1199353871 X:146837350-146837372 TCTCCAAGCAGCTGGTCTATGGG + Intergenic
1199996650 X:153030416-153030438 TGTCCAGGCAGGAGGCCAGGAGG + Intergenic
1200003642 X:153074184-153074206 CCTCCAGGCAGGAGGCCAGGAGG + Exonic
1200004081 X:153075825-153075847 CCTCCAGGCAGGAGGCCAGGAGG - Intergenic
1200149620 X:153944796-153944818 GCTCCCAGCAGGGGCCCTGGAGG - Intergenic