ID: 928245927

View in Genome Browser
Species Human (GRCh38)
Location 2:29626941-29626963
Sequence CTTTAGGGATGTTTGGCAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 160
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 146}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
928245927 Original CRISPR CTTTAGGGATGTTTGGCAGC TGG (reversed) Intronic
908151672 1:61309190-61309212 CTATAGAGATGTTTGGCACTGGG - Intronic
909113470 1:71507235-71507257 CTTTAGGGATGTCTGGGATCAGG - Intronic
912082317 1:105952011-105952033 CTTTTGGGTTGCATGGCAGCTGG - Intergenic
912640799 1:111344249-111344271 CTTCAGGGTTTTTTGACAGCTGG + Intergenic
912714080 1:111969759-111969781 CTTTAGGGTTGTTAGCCAGAAGG - Intronic
916277889 1:163014422-163014444 CTTTTGGGCTGTGTGGGAGCTGG - Intergenic
918154970 1:181835920-181835942 CTTTTGGGCTGTGTGGGAGCTGG + Intergenic
919408037 1:197209032-197209054 CTTTTGGGCTGTGTGGGAGCGGG - Intergenic
919802073 1:201360027-201360049 CTTCCGGGATGGTGGGCAGCTGG - Intronic
920991120 1:210941018-210941040 CTATAGGCATGTTTGGCACTGGG + Intronic
1063082553 10:2782363-2782385 CTTTAGCCATGTCTGGCAACAGG - Intergenic
1063381202 10:5587422-5587444 CTTTGAGGAAATTTGGCAGCAGG + Intergenic
1063752121 10:8961701-8961723 ACTTAGGGATTTTTGGCTGCAGG + Intergenic
1063907011 10:10791486-10791508 CTTTAGAAATGTTTGGCATCAGG + Intergenic
1065277619 10:24100998-24101020 CTTAAAGGATGTTTGTTAGCAGG - Intronic
1067672064 10:48332577-48332599 CCTTAGGGATGTCTGGGATCAGG + Intronic
1073262129 10:102198427-102198449 CCTTAGGGATGTCTGGGATCAGG + Intergenic
1074021719 10:109591442-109591464 CTTAAGGAATGTTTTGCAGATGG - Intergenic
1076375810 10:129983894-129983916 CTTTTGGGCTGTGTGGGAGCTGG + Intergenic
1076519872 10:131074880-131074902 CTGCAGGGATGTTTGGCTGTGGG + Intergenic
1078098595 11:8315389-8315411 CTCCAGGGATGGATGGCAGCAGG - Intergenic
1078337108 11:10473365-10473387 CTTTAGGGAGGAAGGGCAGCTGG + Intronic
1079012799 11:16843520-16843542 CTATAGGGATCCTTGGCTGCAGG - Intronic
1080938211 11:36884760-36884782 CTGTAGAGTTGTTTGGCAGGTGG - Intergenic
1085508053 11:77071296-77071318 GTTCAGGGATGTTTGGAAGAAGG + Intronic
1086592508 11:88532896-88532918 TTTTAGGTATGTTTTGCAGATGG - Intronic
1089775615 11:120833438-120833460 CTTTAGGGAAGGTTGGGAGCAGG + Intronic
1091193079 11:133710503-133710525 CTTCAGGAATGTTTGGCAACAGG - Intergenic
1093853471 12:24069665-24069687 CTTGAAGCATTTTTGGCAGCAGG + Intergenic
1094777896 12:33753068-33753090 CTGTAGGGATGTGAGTCAGCAGG + Intergenic
1097976884 12:65695984-65696006 CTGAAGTGATGCTTGGCAGCTGG + Intergenic
1100346607 12:93737885-93737907 GTTTAGGGAATTTGGGCAGCTGG + Intronic
1101410810 12:104466485-104466507 CTTTGGGGCTGTTTGGCCGCTGG - Intronic
1105209036 13:18247154-18247176 CTTCAGAGATCTGTGGCAGCAGG + Intergenic
1105314426 13:19244151-19244173 CTTTTGGGTTGTGTGGGAGCTGG + Intergenic
1106133969 13:26960850-26960872 CTCTGGGGAAGATTGGCAGCAGG + Intergenic
1107448323 13:40487322-40487344 CTCTAGCGCTGTTTGGCAGATGG + Intergenic
1108935404 13:55875439-55875461 CCTTAGGGATGTCTGGGATCAGG + Intergenic
1110003623 13:70237687-70237709 CTTAAGGAATGGTTAGCAGCTGG + Intergenic
1110472200 13:75873005-75873027 CTTTAGGAGTGTTCAGCAGCAGG - Intronic
1110690779 13:78428101-78428123 CCTTAGGGATGTTTGGGATTAGG + Intergenic
1114488291 14:23078205-23078227 GTTTGGGGCTGTGTGGCAGCTGG + Exonic
1116938810 14:50770112-50770134 CTTCAGGGCTGTTTGGCACCTGG - Intronic
1118888389 14:69886131-69886153 CTTTCGGCATCTTGGGCAGCGGG + Intronic
1121503495 14:94458819-94458841 CTTTTGGGTTGTGTGGGAGCTGG - Intergenic
1122930883 14:104932659-104932681 GTTTGGGGACGGTTGGCAGCTGG - Intronic
1126098553 15:45106136-45106158 CCTTAGGGATCTTGAGCAGCAGG + Exonic
1128368385 15:67021313-67021335 ATTAAAGCATGTTTGGCAGCGGG - Intergenic
1132286524 15:100667541-100667563 CTGGAGGTAAGTTTGGCAGCAGG + Intergenic
1133354943 16:5129253-5129275 CTTTAAGTATGTTTGGATGCTGG + Intergenic
1137629555 16:49932588-49932610 TTTTAGAGAGGTTTGGCAGCTGG + Intergenic
1139479297 16:67220158-67220180 CTTCAGTGATATTTGGCATCTGG - Intronic
1141526420 16:84614681-84614703 CTTGTGAGATGTTTGGAAGCAGG + Intronic
1142863564 17:2777439-2777461 CTTGAGGGATCTTTGGGAGCGGG + Intronic
1147569549 17:41560183-41560205 CTTTAGGGATGATTGGACGCTGG + Intergenic
1147895214 17:43746158-43746180 ATTAATGGATGTTTGGCTGCTGG - Intergenic
1203159774 17_GL000205v2_random:38696-38718 CTCCAGGGATGTGGGGCAGCTGG - Intergenic
1156702958 18:39846490-39846512 CGTTAGAGATGTGTCGCAGCTGG - Intergenic
1157324049 18:46656599-46656621 CTTTGGGGATGTTCAGGAGCTGG + Intronic
1158457816 18:57622914-57622936 CAATCGGGATGTTTCGCAGCGGG - Intergenic
1158526177 18:58216322-58216344 CTTTAGGGCTGTGTGGGTGCTGG + Intronic
1158641767 18:59209611-59209633 CTTTAAGGAGATTTTGCAGCTGG + Intergenic
1159752463 18:72319462-72319484 TTTTAGCTATGTTTGTCAGCAGG - Intergenic
1160142865 18:76340857-76340879 CTGTAGGGAGGTTTGGAAGGTGG - Intergenic
1160305370 18:77729309-77729331 CTTTATGGATTTTTGGCAGAAGG - Intergenic
1167438953 19:49497127-49497149 CTCTAGGGCTGGTTGGCTGCCGG + Intronic
925307217 2:2857081-2857103 CCTTCGGGATGTTAGGCAACTGG - Intergenic
928245927 2:29626941-29626963 CTTTAGGGATGTTTGGCAGCTGG - Intronic
933236741 2:79872823-79872845 CTTTACTGATGTTTTCCAGCTGG + Intronic
935546698 2:104406976-104406998 CTTTAGGTGTGTTTGGTAGGTGG - Intergenic
935687559 2:105697750-105697772 CTTAAGGGATGTGTGGGAGGGGG - Intergenic
937675306 2:124583654-124583676 CTTTTGGGAGGTTTGGAAGGGGG + Intronic
941702087 2:168614554-168614576 CTTTTGGGTTGTGTGGAAGCTGG + Intronic
941964756 2:171290062-171290084 CTCTAGGGATGCTAGGCAGATGG - Intergenic
943953451 2:194158429-194158451 CCTTAGAGATGTTTGGGATCAGG + Intergenic
944353203 2:198754603-198754625 CTTTAGGAATGCTTGTCAGTGGG + Intergenic
946862521 2:224013907-224013929 CTGTTGAGAAGTTTGGCAGCTGG - Intronic
948531173 2:238606587-238606609 CTTTTGGGTTGTGTGGGAGCTGG + Intergenic
948713953 2:239846968-239846990 CTTTTGGGCTGTGTGGGAGCTGG + Intergenic
1170241775 20:14174475-14174497 CTTTTGGGCTGTATGGGAGCTGG - Intronic
1170758834 20:19231183-19231205 CTTCAGAGATGTTTGGCATGGGG - Intronic
1171290209 20:23978869-23978891 CTTCAGAGATCTGTGGCAGCAGG + Intergenic
1173087613 20:39939278-39939300 ATTTAGAGATGTGTGGCAGTGGG - Intergenic
1174935202 20:54860099-54860121 CTTTGAGGATGTTTTGTAGCAGG + Intergenic
1177064978 21:16419342-16419364 CTTCAGGGGAGATTGGCAGCTGG + Intergenic
1180767218 22:18352144-18352166 CTTCAGAGATCTGTGGCAGCAGG - Intergenic
1180779091 22:18510235-18510257 CTTCAGAGATCTGTGGCAGCAGG + Intergenic
1180811812 22:18767555-18767577 CTTCAGAGATCTGTGGCAGCAGG + Intergenic
1181197966 22:21201797-21201819 CTTCAGAGATCTGTGGCAGCAGG + Intergenic
1181401779 22:22654008-22654030 CTTCAGAGATCTGTGGCAGCAGG - Intergenic
1181617352 22:24064142-24064164 CATTATGGAGGTTGGGCAGCCGG - Exonic
1181703734 22:24635101-24635123 CTTCAGAGATCTGTGGCAGCAGG - Intergenic
1183706824 22:39479389-39479411 CTTACGGGGTGTCTGGCAGCGGG + Intronic
1203228840 22_KI270731v1_random:93038-93060 CTTCAGAGATCTGTGGCAGCAGG - Intergenic
949377346 3:3405176-3405198 CTTTCGGGCTGTGTGGGAGCTGG + Intergenic
949515037 3:4800074-4800096 CTGTAGGGATGACTGGAAGCAGG + Intronic
949554937 3:5144651-5144673 CCTTAGGGATGTCTGGGATCAGG + Intronic
951822897 3:26833408-26833430 CTTTAGATGTGGTTGGCAGCTGG - Intergenic
951854914 3:27185561-27185583 CCATAGGGATGGTTGGCAGGAGG - Intronic
953185273 3:40631656-40631678 CTTTTGGGCTGTGTGGGAGCTGG + Intergenic
959009765 3:101061410-101061432 CTTTTGGGCTGTATGGGAGCTGG - Intergenic
961764382 3:129197588-129197610 CTATAGGGCTGCTTGGCAGCAGG + Intergenic
962686890 3:137856596-137856618 CTTCAGGGGTGATGGGCAGCTGG - Intergenic
962941704 3:140130465-140130487 CTTTAGGGAAGTTTGACTGGGGG + Intronic
963296565 3:143553048-143553070 CCTTGGGTGTGTTTGGCAGCAGG - Intronic
965647578 3:170900005-170900027 CTTTAGAGATGTTAGGCATGTGG + Intronic
972097344 4:35364573-35364595 CTTTTGGGCTGTGTGGGAGCTGG - Intergenic
973912836 4:55600402-55600424 GTTTATAGATGTTTGGCATCAGG - Intronic
981300282 4:143178971-143178993 CCTTAGGGATGTCTGGTATCAGG + Intergenic
984526409 4:180863840-180863862 GTTAAGGGATGTTTTGCACCTGG + Intergenic
984746787 4:183228683-183228705 CGTTAAGGATGTGGGGCAGCTGG + Intronic
986775764 5:11012516-11012538 CGCTAGGGTTGCTTGGCAGCCGG - Intronic
986781830 5:11073620-11073642 TTTTGGGGAATTTTGGCAGCTGG - Intronic
990029855 5:51244472-51244494 ATTTGGGTATGATTGGCAGCAGG + Intergenic
995671491 5:114609362-114609384 CTGTAGGCGTTTTTGGCAGCAGG + Intergenic
996128500 5:119753204-119753226 CTTTTGGGATGTATAGGAGCTGG + Intergenic
999390583 5:151186661-151186683 CTATTGTGATGTTTGGCTGCAGG - Intronic
1003264877 6:4556721-4556743 CTTGAGGGAGGTTTTGCAGAAGG - Intergenic
1005691539 6:28311515-28311537 CTTTTGGGCTGTGTGGGAGCTGG - Intergenic
1008231196 6:48986653-48986675 CTTTTGGGCTGTGTGGGAGCTGG + Intergenic
1012099288 6:95010349-95010371 TGTTAGGGATATTTGCCAGCAGG - Intergenic
1014358724 6:120447140-120447162 TTTTAGGCATTTTTGGCAGGAGG - Intergenic
1015054611 6:128884805-128884827 CTTTAATAATGTTAGGCAGCTGG + Intronic
1015196578 6:130530069-130530091 CTTTTGGGCTGTGTGGAAGCAGG + Intergenic
1021517480 7:21504065-21504087 GCTTAGGGATGTTTGGGAGCAGG + Intronic
1022894879 7:34740211-34740233 CTTTTGGGTTGCTTGGGAGCTGG - Intronic
1023162269 7:37308952-37308974 TGTTAGGCATGTTAGGCAGCAGG + Intronic
1023163217 7:37318262-37318284 CTACAGGGATCTCTGGCAGCTGG - Intronic
1024025350 7:45405432-45405454 CTTTATGGATATTTGGAGGCAGG + Intergenic
1024053681 7:45646102-45646124 TTTGGGGGATGTTTGGAAGCAGG + Intronic
1026163636 7:67890831-67890853 CTTCCAGGATGGTTGGCAGCTGG - Intergenic
1028529657 7:91824782-91824804 CTTTTGGGCTGTGTGGGAGCTGG - Intronic
1033894589 7:146054976-146054998 CTTTAGGGATATTTGGGATTAGG + Intergenic
1041564936 8:59266074-59266096 TTTTATGGATGGTTTGCAGCTGG + Intergenic
1045994171 8:108343179-108343201 CTTTTGGGTTGTGTGGGAGCTGG + Intronic
1059704132 9:116804024-116804046 CTTTAGGTATCGTTGGCAGGTGG - Intronic
1060783112 9:126428044-126428066 CTTTCAGGATGTTTGACACCAGG + Intronic
1061485965 9:130920674-130920696 GTTTAAGGAGGTTTGGCGGCAGG - Intronic
1062289664 9:135788889-135788911 CTGTAGGGAGGTGTGGCAGCGGG - Intronic
1188565517 X:31522143-31522165 CTTGAGGGATGAGTAGCAGCTGG + Intronic
1192618248 X:72650452-72650474 CTTTAGGGATTTTTAGCCCCTGG - Exonic
1192869457 X:75172391-75172413 CTTTTGGGTTGTGTGGGAGCTGG - Intergenic
1193007952 X:76642354-76642376 CTTTTGGGCTGTTTAGGAGCTGG - Intergenic
1193680996 X:84518778-84518800 CTTTTGGGTTGTGTGGGAGCTGG - Intergenic
1194655538 X:96569179-96569201 CTTTAGGTTTGTCTGGCATCAGG - Intergenic
1194993779 X:100571810-100571832 CCTTAGGGATGTCTGGGATCAGG + Intergenic
1197988931 X:132296305-132296327 CTTTAGGGATGTTTCAGAGAGGG + Intergenic
1200827097 Y:7657364-7657386 CATTCGGGATGACTGGCAGCAGG + Intergenic
1200884060 Y:8251907-8251929 CATTTGGGATGACTGGCAGCAGG + Intergenic
1201063848 Y:10070497-10070519 CATTTGGGATGGCTGGCAGCAGG + Intergenic
1201295957 Y:12463421-12463443 CTTTACGGGTGTTGGGCTGCGGG + Intergenic
1202119714 Y:21510040-21510062 AATTCGGGATGGTTGGCAGCAGG - Intergenic
1202122167 Y:21533581-21533603 AATTCGGGATGGTTGGCAGCAGG - Intronic
1202156840 Y:21895802-21895824 AATTCGGGATGGTTGGCAGCAGG + Intronic
1202159286 Y:21919343-21919365 AATTCGGGATGGTTGGCAGCAGG + Intergenic
1202185735 Y:22184258-22184280 AATTCGGGATGGTTGGCAGCAGG + Intergenic
1202205625 Y:22402138-22402160 AATTCGGGATGGTTGGCAGCAGG - Intronic
1202232778 Y:22672421-22672443 CATTCGGGATGACTGGCAGCAGG - Intergenic
1202310378 Y:23523737-23523759 CATTCGGGATGACTGGCAGCAGG + Intergenic
1202560424 Y:26146857-26146879 CATTCGGGATGACTGGCAGCAGG - Intergenic