ID: 928253321

View in Genome Browser
Species Human (GRCh38)
Location 2:29700832-29700854
Sequence TCTCCCTTATCAAAACCCCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 155
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 141}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
928253314_928253321 11 Left 928253314 2:29700798-29700820 CCACGGTGGTGACCCTGCCCAAA 0: 1
1: 0
2: 0
3: 10
4: 108
Right 928253321 2:29700832-29700854 TCTCCCTTATCAAAACCCCCTGG 0: 1
1: 0
2: 0
3: 13
4: 141
928253315_928253321 -1 Left 928253315 2:29700810-29700832 CCCTGCCCAAAGACATACCCAGT 0: 1
1: 0
2: 0
3: 8
4: 171
Right 928253321 2:29700832-29700854 TCTCCCTTATCAAAACCCCCTGG 0: 1
1: 0
2: 0
3: 13
4: 141
928253317_928253321 -6 Left 928253317 2:29700815-29700837 CCCAAAGACATACCCAGTCTCCC 0: 1
1: 0
2: 0
3: 9
4: 173
Right 928253321 2:29700832-29700854 TCTCCCTTATCAAAACCCCCTGG 0: 1
1: 0
2: 0
3: 13
4: 141
928253316_928253321 -2 Left 928253316 2:29700811-29700833 CCTGCCCAAAGACATACCCAGTC 0: 1
1: 0
2: 1
3: 11
4: 154
Right 928253321 2:29700832-29700854 TCTCCCTTATCAAAACCCCCTGG 0: 1
1: 0
2: 0
3: 13
4: 141
928253318_928253321 -7 Left 928253318 2:29700816-29700838 CCAAAGACATACCCAGTCTCCCT 0: 1
1: 0
2: 1
3: 14
4: 195
Right 928253321 2:29700832-29700854 TCTCCCTTATCAAAACCCCCTGG 0: 1
1: 0
2: 0
3: 13
4: 141

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
928253321 Original CRISPR TCTCCCTTATCAAAACCCCC TGG Intronic
902078818 1:13807077-13807099 TCTCCCTTATCCAAAACCACTGG + Intronic
902118580 1:14142264-14142286 CCTCCATTTTCAAAACCTCCTGG + Intergenic
903959729 1:27049249-27049271 ACTGCCTTTACAAAACCCCCAGG - Intergenic
906247088 1:44283953-44283975 TCTCTCTTCTCTAAGCCCCCTGG + Intronic
906856874 1:49316088-49316110 CCTCCCTTCTCCAAAACCCCTGG - Intronic
908996077 1:70156585-70156607 TCCCCTTTATCCAGACCCCCCGG + Intronic
909766924 1:79367802-79367824 CACCCCTTATCAAAACCCACTGG - Intergenic
909992421 1:82239730-82239752 TCTCCCTTATAGAAGCCCCTAGG - Intergenic
915108633 1:153549287-153549309 CCTCCCTGCTCAAAACCCCCAGG - Exonic
915680312 1:157575462-157575484 TCTCCCTTGTCCAAAGTCCCAGG - Exonic
916316956 1:163459680-163459702 CCTCCCTTATAATAACCCCTTGG - Intergenic
919039200 1:192360735-192360757 TCTTTCTTCTCAAAACCCACAGG + Intronic
919813153 1:201421598-201421620 TCTCCTTAAACAAAAGCCCCAGG + Intronic
920738465 1:208557411-208557433 TCTCCCTCATCAGAAACCACAGG - Intergenic
923741866 1:236662252-236662274 TCTCCCTTCCCACAACCCCCTGG - Intergenic
924880780 1:248159832-248159854 TTTCCCTTATCAAAATCACCTGG - Intergenic
1064591530 10:16897495-16897517 TTTCCCCTACCAATACCCCCGGG + Intronic
1065553336 10:26890544-26890566 TCTGGCTTAACAAAACCCCCTGG - Intergenic
1065562183 10:26975044-26975066 TCTCCTGTAACACAACCCCCTGG - Intergenic
1065599785 10:27356766-27356788 TCCGGCTTAACAAAACCCCCTGG + Intergenic
1065785401 10:29208382-29208404 TATCCCTTATCGAAGCACCCTGG - Intergenic
1073352260 10:102828295-102828317 TCTCCCCACTCAAAAACCCCAGG - Intergenic
1076837376 10:133028037-133028059 TCTCCAGCATCAAAACCTCCAGG - Intergenic
1079037858 11:17036476-17036498 TCTCCCCTATCCTAACCCCAGGG + Intergenic
1083829112 11:65219765-65219787 TCTCCCTGGTCAAAATCCTCCGG - Intergenic
1087599658 11:100297201-100297223 ACTGCCTTACCAGAACCCCCAGG - Intronic
1087847104 11:102985789-102985811 TCTCACTTCCCAAAACACCCAGG - Intergenic
1088409028 11:109513089-109513111 ATCCCCATATCAAAACCCCCAGG - Intergenic
1089679504 11:120111384-120111406 TCTCCCGTCTCAACAGCCCCAGG - Exonic
1089826721 11:121284322-121284344 TCTCCCGTTTCAAAAACCCAAGG - Intergenic
1091127443 11:133113381-133113403 TCTCAAGTTTCAAAACCCCCAGG - Intronic
1091663083 12:2399021-2399043 TCTCCCTTAACACCTCCCCCCGG + Intronic
1094842439 12:34347775-34347797 CCTCCCCTTTCAAGACCCCCTGG + Intergenic
1101167831 12:102056779-102056801 TCCCACTAAACAAAACCCCCAGG + Intronic
1101295671 12:103421173-103421195 TCTCCCTTGTCATTAGCCCCTGG - Intronic
1104170317 12:126274358-126274380 TCTCTCTTATGAAACCCCCATGG + Intergenic
1111657824 13:91175030-91175052 TCTCCCTTGTCAAGGCGCCCGGG - Intergenic
1112369034 13:98778673-98778695 TCTAACTTAAAAAAACCCCCTGG + Intergenic
1113071141 13:106422805-106422827 TTGCCCTTAGGAAAACCCCCAGG + Intergenic
1114872051 14:26670419-26670441 TCTCCGCTATCAAAACCCACAGG + Intergenic
1116521324 14:45850802-45850824 TCTCCATTATCACAACCACTGGG - Intergenic
1117116921 14:52523488-52523510 TTTACCATACCAAAACCCCCAGG + Intronic
1118424708 14:65647938-65647960 GCTCCCTAAGCAAAACCCCAAGG - Intronic
1124554524 15:30712098-30712120 ACACCCTTCTCAAAGCCCCCAGG - Intronic
1124676725 15:31693579-31693601 ACACCCTTCTCAAAGCCCCCAGG + Intronic
1130080598 15:80729800-80729822 TCTCCTCTTTCAAAACCCACTGG - Intronic
1132790432 16:1683487-1683509 TCTCCCTCCTCAAATCCTCCAGG + Intronic
1133738306 16:8632249-8632271 TCTCCCTTATCAATTCGCCCTGG + Intronic
1133844238 16:9439301-9439323 TCTCCATTACCAAGAACCCCAGG + Intergenic
1139275844 16:65726906-65726928 TCACCTTTATCAAAACCCCAAGG - Intergenic
1141655609 16:85414564-85414586 TCTCCCTTCTCCAAAGCCCCAGG - Intergenic
1142684868 17:1571937-1571959 CCTCACTGATCAAAACCCCAAGG + Intronic
1142800682 17:2343486-2343508 TTTCCCTTATCAAAGACCTCTGG - Intronic
1147191865 17:38742561-38742583 TCTCCCTTCTCAGATCCCCGGGG - Intronic
1148152516 17:45404988-45405010 TCTCCCTTGACCACACCCCCCGG - Exonic
1148690710 17:49525219-49525241 TCTGCCTTTTCAAGACACCCCGG + Intergenic
1148835926 17:50465739-50465761 TCGCCCTTACCAATAACCCCTGG - Exonic
1148944999 17:51254034-51254056 TCTTCATTATCCAAACCCACTGG + Intronic
1154147839 18:11880787-11880809 TCACCCTTATCATTGCCCCCAGG - Intronic
1156748698 18:40423821-40423843 ACTGCCTTCTCAAAACACCCAGG - Intergenic
1158016701 18:52792062-52792084 AGTCCTTTATCAAAACACCCTGG - Intronic
1159429584 18:68334491-68334513 CCTCCCTTATCAAAAGTCCAGGG + Intergenic
1163645455 19:18486550-18486572 GCTCCCTTCTCAGAACCGCCTGG - Intronic
1168322672 19:55519169-55519191 TCTCCATCATCAACACCGCCTGG - Intergenic
926088482 2:10034929-10034951 TCTCCCTTAGCACATGCCCCAGG - Intergenic
927153775 2:20210392-20210414 TCCCCCTTTTTAAATCCCCCTGG - Intronic
928253321 2:29700832-29700854 TCTCCCTTATCAAAACCCCCTGG + Intronic
928420499 2:31134679-31134701 CCTCCCTTACACAAACCCCCTGG + Intronic
930163289 2:48179326-48179348 TCCACCTTCTCAAAACCCTCTGG - Intergenic
931244258 2:60479480-60479502 TCTCCCTTAACAAGCCCCTCAGG + Intronic
934761425 2:96859002-96859024 TCTTCATGATCAAAACCCACCGG + Intergenic
937044870 2:118845959-118845981 CCTGCCTTATCTAAACACCCTGG + Intronic
937086320 2:119174285-119174307 TTTACCCTATCAAAGCCCCCTGG + Intergenic
940690242 2:156908763-156908785 TCTCCCTTGCCAAAACTCCTTGG + Intergenic
940992639 2:160113616-160113638 TCTACATTTTCAAAACTCCCAGG - Intronic
943340219 2:186671779-186671801 TCTCCCCTATCACCAGCCCCTGG + Intronic
944960692 2:204869339-204869361 TCACTCGTATCAAAATCCCCTGG - Intronic
1170393020 20:15895609-15895631 TCTCCTGTATGAAAGCCCCCAGG - Intronic
1179960706 21:44765765-44765787 ACATCCTTATCAGAACCCCCCGG - Intergenic
1182214612 22:28705529-28705551 TGTCCCTTATCCAAAACGCCTGG - Intronic
1182889215 22:33802773-33802795 TCTCCCTAAACAATACCACCAGG + Intronic
949331667 3:2930240-2930262 TTTCCCTTATTAAAACCGCTTGG - Intronic
949607645 3:5671909-5671931 TCCTCCTTATCACAACTCCCAGG - Intergenic
950114928 3:10444609-10444631 TCCCCCTTATCAACCCCGCCAGG + Intronic
952273703 3:31857200-31857222 TCTTCCTTGACAAAACCCTCCGG - Intronic
955997212 3:64688935-64688957 CCTCCCATCTCTAAACCCCCTGG - Intergenic
956120878 3:65964729-65964751 TCTCCCTGACCAGAATCCCCAGG + Intronic
958003059 3:87775792-87775814 TATAACCTATCAAAACCCCCGGG - Intergenic
959249972 3:103929436-103929458 TCTCCCCTTTCAAAACATCCTGG + Intergenic
959633018 3:108530420-108530442 TCTCCCTCTTCACAACTCCCTGG - Intergenic
960841564 3:121963862-121963884 ACTCCCTGAACAAAGCCCCCAGG + Intergenic
961108931 3:124267315-124267337 TCTGCATTTTCAAAATCCCCAGG - Intronic
963598978 3:147360952-147360974 TTTACCATATCATAACCCCCAGG - Intergenic
964762367 3:160146473-160146495 TATCCCTGATCAAATCCCACAGG + Intergenic
969021046 4:4140557-4140579 TCTCCCTCTTCAAAACACCTAGG - Intergenic
969493302 4:7512161-7512183 TCTCCCTTAACGACACCGCCTGG - Intronic
969732813 4:8966867-8966889 TCTCCCTCTTCAAAACACCTAGG + Intergenic
970489347 4:16556403-16556425 TCTTCCTTTTTAGAACCCCCAGG + Intronic
971014100 4:22469663-22469685 TCTGCCTTCACAAAACCCCAGGG + Intronic
971374249 4:26043768-26043790 TCTCCCTTCTCTCAAGCCCCTGG + Intergenic
972708459 4:41569480-41569502 GCTCCCTTAGCATAACCCCTGGG - Intronic
975170716 4:71229182-71229204 TCTCACTCAGCATAACCCCCTGG + Intronic
979943380 4:126792385-126792407 TCTCCCTCCTCAAAATACCCAGG + Intergenic
988509679 5:31854817-31854839 GCTCACTTGTCAAAACCCCACGG - Intronic
991650305 5:68845858-68845880 TATCCCTTATCCAAACCACTTGG + Intergenic
993576153 5:89603132-89603154 TCTTCCTTTGCAAAATCCCCAGG - Intergenic
993576227 5:89604413-89604435 TCTCCATTTACAAAATCCCCAGG - Intergenic
996535894 5:124577394-124577416 TCTCAAGTATCAAAACCCACTGG + Intergenic
996938485 5:128974944-128974966 GATCCCTTATTAAAAGCCCCAGG - Intronic
998134343 5:139666853-139666875 GCTCCCCTCTCAAAACCCACTGG - Intronic
999933530 5:156459850-156459872 TCTTCCTTGTTCAAACCCCCAGG - Intronic
1000268105 5:159657571-159657593 TTACCCTCATCGAAACCCCCTGG - Intergenic
1000431657 5:161159768-161159790 TTTCCCTTATCAGACCCTCCAGG + Intergenic
1005211729 6:23473447-23473469 ACTCCCTTATCAAAACACTAGGG + Intergenic
1012039918 6:94190893-94190915 TCTCCTTTAGCAACACCCTCAGG - Intergenic
1015054976 6:128889700-128889722 TCTTCCTTATTAAAAGCCACAGG + Intronic
1017224349 6:152002870-152002892 TCTCTCTTATCAAAATCTCCTGG - Intronic
1020190798 7:5996034-5996056 CCTCCCCTTTCAAAACCTCCCGG + Intronic
1020308467 7:6852582-6852604 TCTCCCTCTTCAAAACACCTAGG - Intergenic
1021925211 7:25527965-25527987 TCTTCCTGATCAAGACTCCCTGG + Intergenic
1022384621 7:29889680-29889702 GTTCCCTTATCAAAAGCCCCAGG - Intronic
1026019859 7:66698313-66698335 TCCCTCTGATCAGAACCCCCAGG + Intronic
1027001320 7:74656872-74656894 TCTCCATTTTCAAAACCCACCGG + Intergenic
1030085516 7:105812084-105812106 GCTCCCTTCTCAAGCCCCCCTGG + Intronic
1034822296 7:154227388-154227410 TTTCCCTTCTCCCAACCCCCTGG - Intronic
1036888882 8:12581923-12581945 TCTCACTTACCAACACACCCTGG + Intergenic
1038577461 8:28717348-28717370 TCGCCCTCATCATTACCCCCGGG + Exonic
1038826133 8:31004370-31004392 TCTCCATTATCAAAACGTGCTGG - Intronic
1039037113 8:33371903-33371925 TCTCACTAATCAAAACACACAGG + Exonic
1039672049 8:39612531-39612553 TCTTCCTGAACCAAACCCCCTGG - Intronic
1039818198 8:41113366-41113388 TCATCCTTATCAAAACTCTCAGG - Intergenic
1040284435 8:46092718-46092740 TCTCCCTTTTCAGAAGACCCTGG + Intergenic
1040284637 8:46093583-46093605 TCTCCCTTCCCAGAAGCCCCTGG + Intergenic
1040284688 8:46093785-46093807 TCTCCCTTTTCAGAAGTCCCTGG + Intergenic
1040285397 8:46098124-46098146 TCTCCCTTCCCAGAAGCCCCTGG + Intergenic
1040296601 8:46152155-46152177 TCTCCCTTCCCAGAAGCCCCTGG - Intergenic
1040296784 8:46152966-46152988 TCTCCCTTCACAGAAACCCCTGG - Intergenic
1040307820 8:46221340-46221362 TCTCCCATACCAGAAGCCCCCGG + Intergenic
1040318230 8:46276129-46276151 TCTCCCTTCCCAGAAGCCCCTGG - Intergenic
1040318670 8:46278001-46278023 TCTCCCTTCCCAGAAGCCCCTGG - Intergenic
1040319481 8:46285434-46285456 TCTCCCTTTCCAGAAGCCCCTGG - Intergenic
1040341747 8:46444547-46444569 TCTCCCATACCAGAAGCCCCAGG - Intergenic
1049431040 8:142565006-142565028 ACTCCCTTACCAAACCGCCCCGG - Intergenic
1051352879 9:16214964-16214986 TCTCACTTCTCAAAAAGCCCCGG + Intronic
1051497736 9:17743811-17743833 TTTCCCTTATCAAAAGCACAAGG - Intronic
1051534700 9:18143558-18143580 CCTCCCTTGTCAGAACCCCATGG + Intergenic
1055422812 9:76161906-76161928 TCTCCCTCATCAAGACCACCTGG + Intronic
1060535118 9:124379866-124379888 TCTGAGTTATCAAAACCACCTGG - Intronic
1061047410 9:128174083-128174105 CCTCCCTCCTCAAAGCCCCCAGG - Intronic
1061893798 9:133636509-133636531 CCTCCCCTATCACATCCCCCTGG + Exonic
1061937743 9:133867542-133867564 TCTCCCTTTCCAGGACCCCCTGG + Intronic
1186509112 X:10117332-10117354 GCTCCCTTTTCAGAGCCCCCAGG + Exonic
1187611396 X:20947472-20947494 TCTCCCCTCGCAAATCCCCCAGG - Intergenic
1189116945 X:38352543-38352565 GCTTCCTTATCAAAGTCCCCTGG - Exonic
1193168061 X:78304200-78304222 TCTCACTTGTCAAAGCCCACAGG + Intronic