ID: 928253662

View in Genome Browser
Species Human (GRCh38)
Location 2:29703506-29703528
Sequence TTCAGCAGTTCTGGGAAATG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 359
Summary {0: 1, 1: 0, 2: 1, 3: 35, 4: 322}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
928253662_928253668 12 Left 928253662 2:29703506-29703528 CCTCATTTCCCAGAACTGCTGAA 0: 1
1: 0
2: 1
3: 35
4: 322
Right 928253668 2:29703541-29703563 GATGAGGCATGTGCTTAGAATGG 0: 1
1: 0
2: 0
3: 11
4: 184
928253662_928253667 -4 Left 928253662 2:29703506-29703528 CCTCATTTCCCAGAACTGCTGAA 0: 1
1: 0
2: 1
3: 35
4: 322
Right 928253667 2:29703525-29703547 TGAAAGGGCTTAAGATGATGAGG 0: 1
1: 0
2: 1
3: 6
4: 189

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
928253662 Original CRISPR TTCAGCAGTTCTGGGAAATG AGG (reversed) Intronic
900707102 1:4087679-4087701 TGCAGCAGTGCTGGGAGGTGGGG - Intergenic
901443956 1:9295620-9295642 TTCACCAGAGCTGGGGAATGGGG + Intronic
902724246 1:18324466-18324488 GTCAAAGGTTCTGGGAAATGGGG - Intronic
903148718 1:21389968-21389990 TTGGGCAGTTCCGGGAACTGAGG - Intergenic
903850013 1:26300451-26300473 TTTAGCAGGTCTGAGAAAAGGGG - Intronic
905091197 1:35432758-35432780 TTCAGTAGGTCTGGGGAAGGGGG - Intergenic
909144616 1:71914374-71914396 TTTAGCTCTTCTGTGAAATGTGG - Intronic
909711991 1:78661878-78661900 GTCAGCATGTTTGGGAAATGTGG + Intronic
910550886 1:88473440-88473462 TCCAGCTGTCCTGGGAAATATGG - Intergenic
911944211 1:104085324-104085346 TTTACCAGTTCTGAGAAATTGGG - Intergenic
912615039 1:111090938-111090960 TTCATCACTTCAGGGACATGTGG - Intergenic
917862630 1:179161815-179161837 TGCAACAGTGCTGGGAGATGGGG + Intronic
918379305 1:183938548-183938570 TTCAGCCGTCTTGGGAAATTTGG + Exonic
918650366 1:186955337-186955359 TTCAGGATTTCTGCAAAATGAGG - Intronic
919019512 1:192085803-192085825 TTCAGCTTTTCTGGGAGATTTGG - Intergenic
919550074 1:198974994-198975016 TTCAGCTGTTGCTGGAAATGTGG + Intergenic
920501806 1:206490327-206490349 TTCAGCCTTTCTGGCAAAAGTGG + Intronic
920502959 1:206496977-206496999 GTGAGAAGTGCTGGGAAATGGGG + Intronic
921306136 1:213798719-213798741 TTCAGCAGTTCTGCAGAAAGAGG + Intergenic
921878993 1:220232270-220232292 TGCAACAGTGTTGGGAAATGGGG + Intronic
921900771 1:220448394-220448416 TTCAGAAAGACTGGGAAATGTGG - Intergenic
922993880 1:229940722-229940744 TTCAGCCGTTCTGGGGAAATGGG - Intergenic
923748426 1:236724674-236724696 TGGAGCAGCTCTGGGGAATGTGG + Intronic
923922653 1:238585892-238585914 TTCAGCATTTCAGGGTAATGGGG - Intergenic
924011477 1:239669907-239669929 TCCAGCATTTGTGGGAAAGGAGG - Intronic
924141209 1:241025579-241025601 TTCATCAGTTCTCAGCAATGTGG - Intronic
1064432693 10:15284793-15284815 TTCTCTAGTCCTGGGAAATGTGG + Intronic
1065869029 10:29940383-29940405 TACAACAGTGCTGGGATATGGGG + Intergenic
1069688471 10:70334476-70334498 TTCTGGAGTTCTGGGAAGGGAGG - Intronic
1069786114 10:70988973-70988995 TTCAGGAGTCCTGGGAACTTAGG + Intergenic
1071120081 10:82266795-82266817 TTCATGACTGCTGGGAAATGAGG - Intronic
1071241575 10:83711774-83711796 TTCAGCATTACTGGGGCATGGGG - Intergenic
1072002667 10:91212361-91212383 TTCATCAAATCTGTGAAATGGGG - Intronic
1075548761 10:123376705-123376727 AACAGGGGTTCTGGGAAATGTGG + Intergenic
1075919860 10:126201618-126201640 TACAGCAGCCCTGGGAGATGGGG + Intronic
1076102753 10:127796102-127796124 TTCAGGGGTTCTGGGAAACTAGG + Intergenic
1077042109 11:529482-529504 TCCAGCAGTTGTGGACAATGAGG + Intergenic
1078260565 11:9703326-9703348 TTCATCAGTTGTTGGACATGTGG + Intronic
1080552433 11:33384365-33384387 TTCAGCAGTTGATGGACATGTGG + Intergenic
1081699321 11:45142844-45142866 TTCAGCAGCTCTTCCAAATGTGG + Intronic
1084559815 11:69897441-69897463 TGCAGCAGTATTGGGAAGTGGGG - Intergenic
1085029785 11:73264206-73264228 TTCTGCAGTTCTGGGATAGTGGG - Intergenic
1085034117 11:73289877-73289899 ATCTGCAGTTCTGGGCAATTTGG - Intronic
1085524095 11:77154411-77154433 TTCAGCAGCCCTGGGCCATGTGG + Intronic
1086381685 11:86261504-86261526 CTCAGCAGTTCTGGGATTTGGGG + Intronic
1087229635 11:95645867-95645889 TTCAACAGTGCTGGGAGATGGGG + Intergenic
1087235671 11:95715839-95715861 TGCAGCACTCTTGGGAAATGTGG + Intergenic
1088234262 11:107705658-107705680 TTTAGCAGATTTGGGAACTGAGG - Intergenic
1088526749 11:110764006-110764028 TTCAGCAGTATTAGAAAATGAGG + Intergenic
1089613736 11:119683888-119683910 CTCAGCACTTCTGGGAAGTGAGG - Intronic
1090167701 11:124568840-124568862 TTCTGAAGTTTTCGGAAATGGGG - Intergenic
1090732625 11:129585030-129585052 TGCAGCAGTGCTGGTTAATGAGG - Intergenic
1091101861 11:132881865-132881887 TTCTCCAGATCTGGGAAATGTGG + Intronic
1091316710 11:134618968-134618990 TTCAGCAGGGCTGGGAAAAGTGG + Intergenic
1092943483 12:13432145-13432167 TTCAGCATTTCTAGGTCATGAGG - Intergenic
1094706509 12:32919450-32919472 TTTAGCATTTCTGGTGAATGAGG - Intergenic
1096255631 12:50060373-50060395 TTCAGTAGGTTTGGGAAGTGGGG - Intronic
1096289559 12:50330100-50330122 TTCAACAGATTTTGGAAATGTGG + Intronic
1097037353 12:56132607-56132629 TTGAGCAGCTCTGTGAAATGGGG + Intronic
1098150710 12:67543531-67543553 GTCAGCAGGTCTGGAGAATGGGG + Intergenic
1098601516 12:72336867-72336889 TGCAGCAGTTTTGGGAGGTGGGG - Intronic
1099068185 12:78010496-78010518 TTCTTCATTTCTGGAAAATGGGG - Intronic
1100793911 12:98159794-98159816 TACAGGAGTTCTGGGATTTGTGG + Intergenic
1100975933 12:100122736-100122758 TTCAGCAGGGATGGGACATGTGG - Intronic
1101126783 12:101643353-101643375 TTCAGGAGTTCTGGGATAGTGGG - Intronic
1101214956 12:102572048-102572070 TGCAGCAGTTTTGGGAGGTGGGG + Intergenic
1102036571 12:109773746-109773768 TTCAACAGATCTGGAAATTGAGG - Intergenic
1102522557 12:113487630-113487652 CTCGGCATTTCTGGGAGATGGGG + Intergenic
1105804980 13:23947397-23947419 GGCAGCAGTCCTGGGAACTGGGG - Intergenic
1106403106 13:29448539-29448561 TCCAGCAGTACTGGGGACTGGGG - Intronic
1106403761 13:29455338-29455360 TTGTGCAGTGCTGGGAAATACGG + Intronic
1107292766 13:38875460-38875482 TTTGACAGTTCTGGAAAATGAGG + Intronic
1107694619 13:42988154-42988176 TTATCCAATTCTGGGAAATGGGG - Intronic
1107828770 13:44355207-44355229 CTAAGCATTTTTGGGAAATGAGG + Intergenic
1108312559 13:49210361-49210383 TTCATCAGTACTGGGAAGTCTGG - Intergenic
1109023373 13:57129033-57129055 TGCAGCAGTGCTGGGAGGTGGGG + Intergenic
1109351280 13:61185085-61185107 TTCAGGAGTTATGGGAATTGGGG - Intergenic
1110104398 13:71653167-71653189 TCCAGAAGATTTGGGAAATGGGG - Intronic
1111472478 13:88701596-88701618 TTAAGAAGTTCTGAGAAGTGGGG - Intergenic
1114669857 14:24404108-24404130 TTCCTCAGATCTGGGAAATGTGG + Intronic
1116996536 14:51330577-51330599 TTGAGCAGTCATGGGAACTGGGG + Intergenic
1117149960 14:52876316-52876338 TTCATAAATTATGGGAAATGAGG + Intronic
1117723974 14:58654356-58654378 TTCAGAAGTTCTGTGATATTTGG + Intergenic
1118085274 14:62407501-62407523 TTCCCCTGTTCTGGGAAACGTGG + Intergenic
1118723096 14:68608199-68608221 ATCAGCAGTTTCTGGAAATGTGG - Intronic
1119166173 14:72495677-72495699 CTCAGCAGTTATGGAAACTGAGG + Intronic
1122072934 14:99216507-99216529 GTCCACAGTGCTGGGAAATGTGG - Intronic
1123786099 15:23675214-23675236 TTAATCAGTTCTGGGCAATCAGG - Intergenic
1124181857 15:27483568-27483590 TTCAGTTGCACTGGGAAATGAGG + Intronic
1124202581 15:27690982-27691004 TACAGCAGATCTGGGAGCTGGGG + Intergenic
1124211610 15:27769371-27769393 TTCCGGATTGCTGGGAAATGGGG + Intronic
1125539271 15:40460349-40460371 TTCAGCATTCATGGGAAAGGTGG + Intronic
1126341050 15:47641568-47641590 TCCAGAAGTTTGGGGAAATGTGG + Intronic
1126855170 15:52831821-52831843 TTTCCCAGTTCTGGGAAAAGTGG + Intergenic
1128200461 15:65801432-65801454 TTCCTCAGTTCTGAGAACTGGGG - Intronic
1129227355 15:74177830-74177852 CTCAGCAGTTCTGGGAGCTCTGG - Intergenic
1130547161 15:84865167-84865189 TTGGGGAGTTCTGGGTAATGGGG - Intronic
1130916436 15:88308781-88308803 GCCAGCTGTTCTGGGAAATTTGG - Intergenic
1131815455 15:96217029-96217051 TTGTCCAGTTCAGGGAAATGAGG + Intergenic
1131903442 15:97114939-97114961 TTCAGCACTTGTGGACAATGTGG + Intergenic
1131986185 15:98044556-98044578 TTCAGCAGGTGTGGAAAAGGAGG - Intergenic
1133930474 16:10228229-10228251 ATCAGTCGTTCTGGGAACTGGGG + Intergenic
1134359625 16:13519004-13519026 TGCAACAGTTCTGGGAGGTGGGG - Intergenic
1135482015 16:22828502-22828524 TTCAGCAGCTTTGGGAAAGTCGG - Intronic
1135858180 16:26031308-26031330 TTCAGCAGCTCCCAGAAATGTGG + Intronic
1138352828 16:56355434-56355456 TTCACCTGTTCTCAGAAATGGGG - Intronic
1139220288 16:65174962-65174984 TTCAGCAGTTTTAGAAAGTGAGG + Intergenic
1139703759 16:68726207-68726229 GTCACCTCTTCTGGGAAATGGGG + Intergenic
1140264536 16:73408878-73408900 TTGAGCAGGTCTGGAAGATGAGG - Intergenic
1140335601 16:74102399-74102421 TTCACAGGTTCTGGGAAATAGGG - Intergenic
1141414862 16:83862876-83862898 TGCAGAAGTTCTGGGAAAGGGGG - Intergenic
1141947520 16:87320731-87320753 TTCATCCGCTCTGGAAAATGTGG + Intronic
1142864003 17:2779504-2779526 TTCAGGAGGTCTGGGAAACTGGG - Intronic
1143381786 17:6501235-6501257 TTCTGCATTCCTGGGGAATGGGG + Intronic
1143857671 17:9864277-9864299 TTCAGTAGGCCTGGGAGATGGGG - Intronic
1146515031 17:33482564-33482586 CTCAGCAGCCCTGGGAGATGGGG + Intronic
1147443128 17:40459648-40459670 GTCAGCACCTCTGGGAGATGTGG + Intergenic
1148366842 17:47061685-47061707 TGCAGCAGTTCTTAAAAATGAGG + Intergenic
1148577480 17:48722195-48722217 TTCAGAAGTTTTGGGAAACAAGG - Intronic
1150835907 17:68564247-68564269 TTTAGCTGTTGTGGGAAATGGGG + Intronic
1151706979 17:75774355-75774377 GTCAGCAGGTCTGGGGAATGAGG - Intergenic
1153023834 18:656546-656568 TTCAGTAAAACTGGGAAATGTGG + Intronic
1154080973 18:11256518-11256540 TTATGCAGTTCTGAAAAATGAGG + Intergenic
1154224313 18:12488114-12488136 TTCAGCAGTTTTGGAGAATATGG - Intronic
1154311581 18:13271142-13271164 TTCAGAAATGCTGGGAAATAGGG + Intronic
1155232938 18:23792535-23792557 TGCAGCAGTGTTGGGAGATGAGG - Intronic
1156569447 18:38236601-38236623 TTCTGGAGTTGTGGAAAATGAGG + Intergenic
1156651462 18:39231593-39231615 TCCAGCATTTCTTGGGAATGTGG - Intergenic
1157430073 18:47617347-47617369 TGCAACAGTGCTGGGACATGGGG + Intergenic
1157444357 18:47733606-47733628 GACAGCAGCTTTGGGAAATGAGG + Intergenic
1157687966 18:49658188-49658210 CTCAGCTGTTCTGGGGGATGAGG + Intergenic
1157844114 18:50986662-50986684 TTCTGTTGTTCTGGAAAATGGGG + Exonic
1158309901 18:56146526-56146548 GTCAATAGTTCTGGGAAAGGAGG - Intergenic
1158668135 18:59451196-59451218 TTGAGCAGTTGAGGGAAGTGTGG - Intronic
1158859181 18:61575418-61575440 TTCTGAAGTTCTGGGAATTTGGG - Intergenic
1159545171 18:69831624-69831646 TTCAGCACATTTGAGAAATGGGG - Intronic
1160254869 18:77239715-77239737 TTCAGAAGTTAAGAGAAATGAGG - Intergenic
1160411806 18:78680096-78680118 CTCAGCAGTGCTGAGACATGGGG + Intergenic
1161438751 19:4279162-4279184 TTCAGCTGTTCTGGGGAGGGAGG - Exonic
1161512325 19:4678710-4678732 TTCAACAGAGCAGGGAAATGGGG - Intronic
1161874278 19:6895580-6895602 TTCAGCAGGTCTGGGGAAGGGGG - Intronic
1163655117 19:18541461-18541483 GTTAGCAGATCTGGGAAACGGGG + Intronic
1164696599 19:30249464-30249486 TTCAGCAGTCCTGTGAGATGGGG + Intronic
1166181151 19:41109970-41109992 TTCACCAGTTGATGGAAATGTGG - Intergenic
1166240890 19:41492956-41492978 TTCAGGAGATCTGGGAGATCTGG + Intergenic
1166930091 19:46297118-46297140 GGCAGGAGTTCTGGGAATTGGGG + Intronic
1167985051 19:53307537-53307559 TTCAGCAGTTCTGCTTCATGTGG - Intergenic
925116455 2:1382560-1382582 TTCACCAGTTTTGGTAACTGTGG - Intronic
925284190 2:2705274-2705296 TTCAGCAGTTCCGGAGACTGTGG - Intergenic
925287289 2:2724152-2724174 TGCAGCGGTGCTGGGAAGTGGGG - Intergenic
926283773 2:11471405-11471427 TGCAACAGTGCTGGGAAGTGGGG - Intergenic
926680325 2:15658238-15658260 TGCAGAGGTTCTGGGAGATGTGG + Intergenic
927119669 2:19945441-19945463 TTCAGAAATTCTGGTAAATAAGG + Intronic
927929733 2:27036481-27036503 CTCAGCAGTTCCAGGAACTGAGG - Exonic
927951778 2:27175161-27175183 TGCAGCAGGCCAGGGAAATGTGG - Intergenic
928253662 2:29703506-29703528 TTCAGCAGTTCTGGGAAATGAGG - Intronic
928261357 2:29769924-29769946 TTTAGGAGTTCTGGGAAAATAGG - Intronic
929137643 2:38639925-38639947 TTCAGCAGTTCAGGAAAAAAGGG - Intergenic
929342398 2:40837059-40837081 TTCAGTAAATCTGGGAAAAGTGG - Intergenic
930002956 2:46873598-46873620 TTCACCAGATCTGTGCAATGGGG - Intergenic
930007032 2:46906205-46906227 GTCAGCAGTCCTGGCAGATGAGG - Intronic
930447096 2:51487739-51487761 TTCATCAGTTCTGCCATATGAGG + Intergenic
930875133 2:56206673-56206695 TGCAGCAGTGTTGGGAGATGAGG - Intronic
931153870 2:59605747-59605769 TTCAGCAGTTGATGGAAATTTGG + Intergenic
931982645 2:67710969-67710991 TTCAGCAGCTTTGAGAAATGAGG + Intergenic
932116518 2:69055028-69055050 TCCAACAGTTCTGTGAAGTGGGG - Intronic
932417491 2:71582363-71582385 TCCAGCAGTTCTAGGAGATAGGG + Intronic
932734443 2:74244758-74244780 TTCAGCAGGTCTGGGGTAGGAGG + Intronic
933520196 2:83362027-83362049 TTTAGCAGTTCCGCAAAATGCGG - Intergenic
934886558 2:98030475-98030497 TGGAGGAGTCCTGGGAAATGTGG - Intergenic
936519300 2:113201740-113201762 CTCAGCAAGTCTAGGAAATGAGG - Exonic
937228046 2:120381055-120381077 CTCACCAGTCCTGGGAAAAGCGG + Intergenic
938839089 2:135140825-135140847 TTTATCAGTTCTGGGAATGGTGG + Intronic
939367588 2:141253251-141253273 TTCAGATGTTCTGGAAAATAAGG - Intronic
939611707 2:144318891-144318913 GAAAGCAGTGCTGGGAAATGAGG - Intronic
940743240 2:157536263-157536285 TTCCTCAGTTCTGGAAAATTTGG - Intronic
940835459 2:158516364-158516386 GTTAGCAAGTCTGGGAAATGTGG - Intronic
941997706 2:171616446-171616468 CTCTGCAGTTCTTGGAGATGGGG + Intergenic
942228936 2:173841611-173841633 TTCAGCAGCTCTGGGAAGAGAGG - Intergenic
942820870 2:180113208-180113230 TTCTGCAGTTTAAGGAAATGGGG - Intergenic
943997028 2:194782363-194782385 TTCACAAGTTCTGGGAATTGGGG - Intergenic
945184127 2:207122546-207122568 TTCAACAGATGTGGAAAATGAGG + Intronic
945860576 2:215116982-215117004 TTCACCAGTTGTTGGAACTGTGG - Intronic
945981561 2:216316536-216316558 GTCCACAGTCCTGGGAAATGGGG + Intronic
946520724 2:220461573-220461595 GTCAGCAGTTAAGGGAATTGAGG - Intergenic
947996462 2:234531779-234531801 TTCAGCAGTTCCAGGAGAGGAGG - Intergenic
1169245371 20:4020504-4020526 TTCAGGAGTTCTGGGTGATTGGG - Intergenic
1170124095 20:12943307-12943329 TTCATCAGTTCTAGGAAGTTTGG - Intergenic
1170328759 20:15184702-15184724 TGCGACAATTCTGGGAAATGCGG + Intronic
1170847991 20:19978182-19978204 TTCAGAAGCTATAGGAAATGAGG - Intronic
1171322898 20:24262151-24262173 CTCAGAAGTTCTGAGAAATTCGG - Intergenic
1173460686 20:43240931-43240953 TTCAGAATTTCTGGGAAAAGTGG - Intergenic
1173547567 20:43910692-43910714 TTCAGCAGCTCTGGGGCATAGGG - Intergenic
1173561948 20:44012458-44012480 TTCTGCTGATCAGGGAAATGTGG + Intronic
1173746663 20:45442672-45442694 GTCAGCAGTTCCTGGAATTGAGG + Intergenic
1174619027 20:51859891-51859913 TGCAGCTGTCCAGGGAAATGGGG - Intergenic
1175485460 20:59342751-59342773 TTCTGCAGATGTGGGAACTGGGG + Intergenic
1176214041 20:63939913-63939935 TTCAGCAGTCCTGGGTCAGGAGG + Exonic
1177140512 21:17353082-17353104 TTCAGCTGCTGTGGGGAATGAGG - Intergenic
1177809359 21:25908903-25908925 TTCAGGAGTTCAGGGGTATGGGG + Intronic
1179382340 21:40911129-40911151 TGCAGCAGATATGGGAGATGTGG - Intergenic
1181892601 22:26076968-26076990 ATCAGCAGTACTGGAAACTGGGG - Intergenic
1181974149 22:26716744-26716766 TTCAGGAGTAATGGGAAATAAGG - Intergenic
1181975723 22:26728029-26728051 TGCAGCAGTTTTGGGAGGTGGGG - Intergenic
1182811092 22:33117239-33117261 TTCAGAGATTCTGGGATATGTGG + Intergenic
1184308357 22:43624493-43624515 TTAAGCACGTTTGGGAAATGGGG - Intronic
1185297711 22:50062347-50062369 ACCAGCAGTTCTGGGATCTGGGG + Intronic
949145205 3:691282-691304 TTTAGCTGTTCTGGGACGTGAGG - Intergenic
949839584 3:8305506-8305528 TTCAGCAGGTCTGGGGAAGGAGG - Intergenic
950474754 3:13208360-13208382 TAGAGCAGTTCTGGGATCTGGGG - Intergenic
950483248 3:13257629-13257651 TGCAGCTGGTCTGAGAAATGGGG + Intergenic
951105800 3:18740863-18740885 TTCAGCAGTTCTAGTATCTGTGG + Intergenic
951447145 3:22795967-22795989 TTCAGCACTACTGGAAAATGAGG + Intergenic
951480294 3:23154183-23154205 TGCAGCAGTTTTGGGAAGTGGGG - Intergenic
951556315 3:23924056-23924078 TTCCACAGTTGTGGGAAGTGTGG - Intronic
953765545 3:45737985-45738007 GTCAGGATTTCTGGGAAGTGAGG + Intronic
954562248 3:51567125-51567147 TGCAGCAGTTCTGGCAGAAGAGG - Intronic
954692328 3:52402193-52402215 TTCAGTAATACTGGGAAAAGGGG + Exonic
954934946 3:54317954-54317976 TACAGTAGTACTGGGAGATGGGG - Intronic
954940813 3:54371108-54371130 TTCATCAGTTCTTGGACATTTGG + Intronic
955847571 3:63182615-63182637 TTGAGAAGTTCTGGGAAATAAGG + Intergenic
956652763 3:71520548-71520570 TGTTGCTGTTCTGGGAAATGTGG - Intronic
958150894 3:89693311-89693333 TTCAGCATTTCTGAAAACTGTGG + Intergenic
958969946 3:100600642-100600664 TTCAGCTGCTGTGGGGAATGGGG + Intergenic
959931783 3:111992989-111993011 TTGATCAGTTCTGGGAATGGTGG - Exonic
963049862 3:141131854-141131876 TTCAGCAGTTTTAGTCAATGTGG + Intronic
963102669 3:141621838-141621860 GCCAGCAGTTCTGAGAAAAGAGG - Intergenic
965124872 3:164613226-164613248 CTCATCAGTTCTAGGAAATAAGG + Intergenic
965786874 3:172344566-172344588 TTTATCAGTTCAGGGAAATTAGG + Intronic
965961927 3:174439855-174439877 TTTGGCAGTTCTGCAAAATGAGG - Intronic
966013624 3:175113661-175113683 TTCATCACTTGTTGGAAATGGGG - Intronic
966587892 3:181647992-181648014 TTAAGCAGTTCTATAAAATGGGG - Intergenic
966597915 3:181742696-181742718 TTCAACAGAGCTGGGAAAAGGGG - Intergenic
966672967 3:182549762-182549784 TTCAGCATAAATGGGAAATGTGG - Intergenic
967277111 3:187786865-187786887 TTCTCCATTTCTGGGAAGTGAGG - Intergenic
967759951 3:193212546-193212568 TTCATCTGTTGTGGGAAATTTGG + Intergenic
968228162 3:196988949-196988971 TTCTACAGGACTGGGAAATGAGG - Intronic
969440327 4:7213124-7213146 TTAAGCAGTTCTGAGGATTGGGG - Intronic
969534654 4:7748299-7748321 TGCAGCAGTTTTGGGACCTGAGG - Intergenic
970142968 4:13002763-13002785 TTCATCAGTTGTGGTACATGTGG + Intergenic
970449889 4:16156227-16156249 TTCATTAGGGCTGGGAAATGAGG - Intergenic
970593689 4:17580444-17580466 GTCTGCAGTTCTGGGAAGTCAGG + Intronic
971197140 4:24480394-24480416 ATCAGATGTTCTGGCAAATGAGG - Intergenic
972529359 4:39947862-39947884 TGCAGCAGTGTTGGGAATTGGGG - Intronic
972705569 4:41539306-41539328 TTCAGCAGTCCCGGGAGAAGGGG + Intronic
973557984 4:52105347-52105369 CTCAGCAATTCTGGAGAATGGGG - Intergenic
973649762 4:52986855-52986877 TTCAGTAGTTGTGGTAAATGAGG + Intronic
973878006 4:55241031-55241053 TTCACCAGTTCTGGGAGCAGAGG - Intergenic
976706000 4:88019801-88019823 ATCTGCAGTTTTGGGAAATGGGG - Intronic
977223605 4:94368627-94368649 TTAAGCAGCACTTGGAAATGTGG + Intergenic
978079283 4:104572042-104572064 TTCAGCATTTCTTGAAAATTTGG - Intergenic
978326928 4:107569076-107569098 CTCAGCAGTGCTGGGAAAACTGG + Intergenic
979782769 4:124675262-124675284 TTCACCAGTACTGCGTAATGCGG - Intronic
980137300 4:128871124-128871146 TTCAGCTGTTTTAGAAAATGTGG + Intronic
980451726 4:132982037-132982059 TTAATCACTTCTGTGAAATGAGG - Intergenic
980673162 4:136037010-136037032 TACAGAAGTTCTGGTAAGTGAGG - Intergenic
981272999 4:142866644-142866666 ATCAGCAGTAATAGGAAATGTGG + Intergenic
981461282 4:145015909-145015931 TTCAGCAGTTCTTGTAATGGTGG - Intronic
981825019 4:148930084-148930106 TTCAGCAGTTCTTGCAGTTGTGG - Intergenic
982176488 4:152709999-152710021 TTTAGCAATTCTGGGCAATAAGG + Intronic
983230324 4:165123585-165123607 TTCAGCAGTTTTAAAAAATGAGG - Intronic
983315153 4:166122665-166122687 TTCAGCAGACCTTGGAATTGAGG - Intergenic
983437897 4:167739223-167739245 TTCATGAGTTCTATGAAATGTGG + Intergenic
986776332 5:11017215-11017237 TTGAGCAGATTTTGGAAATGAGG + Intronic
987101684 5:14596743-14596765 TCCTGCAGTTCTGGGGACTGGGG + Intronic
989034033 5:37150844-37150866 ATCAGAATTTCAGGGAAATGGGG + Intronic
990894742 5:60686608-60686630 TTCAGCTTTTCTGAGCAATGGGG - Intronic
991146969 5:63318482-63318504 TTCAGCAGAACTAGGAAAGGTGG + Intergenic
991594103 5:68284837-68284859 TCCAGCAATCCTGGGAAATAAGG + Intronic
992846410 5:80753517-80753539 TTGACTAGTTCTGGGAATTGAGG + Intronic
993204194 5:84859554-84859576 ATAAGAAGTTGTGGGAAATGGGG + Intergenic
993810755 5:92473001-92473023 TGCAGCAGTGTTGGGAAATATGG + Intergenic
995816371 5:116173230-116173252 AACAGCAGTTCTTGGAAATCAGG + Intronic
995942955 5:117607355-117607377 TGCAGCATTTCTGGGAAAGGGGG + Intergenic
996845283 5:127891972-127891994 GGCAGCAGTACTGGGTAATGTGG - Intergenic
998414636 5:141937290-141937312 GTCAGCCGCTCTGGGAAATGAGG + Exonic
999484876 5:151985421-151985443 TGCAGCCTTTCAGGGAAATGGGG + Intergenic
1000089315 5:157916545-157916567 TGCAGCAGTGTTGGGAGATGGGG + Intergenic
1002038699 5:176494423-176494445 CTCAGCAGTCCTGAGAGATGGGG + Intronic
1003629110 6:7770722-7770744 CTCAGAAGTTCTAGGAAAGGGGG + Intronic
1004028658 6:11844397-11844419 TTCAGCCCTTCTGGGGAATTTGG - Intergenic
1004305904 6:14501883-14501905 TTCAGGAGTTAGGGAAAATGAGG - Intergenic
1005501954 6:26436514-26436536 TTCAGCAGTTCTGGAGCAAGTGG - Intergenic
1007024996 6:38562431-38562453 TTTAAAAGTTCTGGGAGATGAGG - Intronic
1007182594 6:39941063-39941085 TCCAGGAGCTCAGGGAAATGAGG - Intergenic
1008368291 6:50707235-50707257 CTCAGCAGGTCTGTGAGATGGGG - Intergenic
1009026713 6:58008602-58008624 AACAGTTGTTCTGGGAAATGTGG + Intergenic
1009202258 6:60760075-60760097 AACAGTTGTTCTGGGAAATGTGG + Intergenic
1009968137 6:70599105-70599127 CTCAGCAGTTCTTGGAAATGTGG - Intergenic
1012341242 6:98127073-98127095 TTCAGGAGCTCTGGGAGATTCGG - Intergenic
1012390788 6:98737294-98737316 TGCAACAGTTCTGGGAGGTGGGG - Intergenic
1012428120 6:99136403-99136425 TTCAGTAGATCTGGTATATGAGG + Intergenic
1013617117 6:111853895-111853917 TTCAGCCATTGTGGGAAGTGGGG + Intronic
1014820412 6:125982902-125982924 TTCAGCAGGTCTGGGAGTCGGGG + Intergenic
1015344373 6:132138560-132138582 TTTAGCAGTAGTGGGCAATGTGG - Intergenic
1017621795 6:156306851-156306873 TTTACCAGTTCTGTGAAATGAGG - Intergenic
1017993901 6:159514177-159514199 TGCAGCAGTTCTGGGAACCTCGG - Intergenic
1018356858 6:163026962-163026984 TTCATCAGTTCTGAGCAACGTGG + Intronic
1020385036 7:7591796-7591818 TTCAGCAGATTTGGGAAGTACGG + Intronic
1021234458 7:18125154-18125176 TGCAGCAGTCCTGGGGAATGAGG + Intronic
1021472875 7:21025883-21025905 TTAAGCATTTCTGTGAAATTGGG + Intergenic
1023303135 7:38794898-38794920 TTTAGCTGTTCTGTGAAAGGGGG - Intronic
1023487764 7:40704978-40705000 TTCAGCATATCTGACAAATGAGG - Intronic
1024530812 7:50391241-50391263 TACAGCAGATCTGGGCAATGTGG - Intronic
1024774680 7:52769840-52769862 CTAAGCAGTTTTGGAAAATGTGG - Intergenic
1026412305 7:70136695-70136717 TTCAGCATGTCTTTGAAATGTGG + Intronic
1027655203 7:80921458-80921480 TTAAGCAGTGTGGGGAAATGTGG - Intronic
1028175695 7:87655796-87655818 TCCAACAGTGCTGGGAAGTGGGG + Intronic
1028859680 7:95634778-95634800 TTCTGAAGTACTGGGGAATGGGG - Intergenic
1030640154 7:111995789-111995811 TTTAGCAGCACTGCGAAATGAGG - Intronic
1032741421 7:134743090-134743112 CTGAGAAGTGCTGGGAAATGTGG - Intergenic
1032964061 7:137075096-137075118 TTCACCTGTTCTGGGAAATATGG - Intergenic
1034056105 7:148036339-148036361 TTCAGCAGTGTTGGGAGGTGGGG + Intronic
1034582654 7:152059027-152059049 TTTTGTAGTTCTGGCAAATGTGG + Intronic
1035836862 8:2764128-2764150 TTCAGCAGCTCTGGGCCATAGGG + Intergenic
1036023129 8:4871042-4871064 GTCAGCAGTGCTGGGAGGTGAGG + Intronic
1036779854 8:11638883-11638905 TGCAGCAGTCCTGTGAAATCAGG - Intergenic
1037054189 8:14417286-14417308 TTCAGTAGTTCTAGGCAGTGAGG + Intronic
1038345188 8:26725930-26725952 TTCATCAGTACTGAGAGATGAGG + Intergenic
1038730846 8:30126374-30126396 TGCAGCAGTGTTGGGAGATGGGG - Intronic
1040549723 8:48428810-48428832 TCCATCAGCTCTGGGAAATCAGG + Intergenic
1042096366 8:65220206-65220228 TACAGCAGTGCTGGGAAGTGGGG + Intergenic
1042301464 8:67287147-67287169 TTTATCAGTTCTGGGAATAGTGG - Intronic
1042338628 8:67655666-67655688 TTCAGAAGTTCCAGGAAAAGAGG + Intronic
1042805953 8:72771257-72771279 ATGAGCAGTTCTGTGAAAGGAGG - Intronic
1043802345 8:84625627-84625649 TTCATTAGTTCAGGGAACTGAGG + Intronic
1044516352 8:93143238-93143260 TTCAGCAGTTGCAGGAAATGAGG - Intronic
1047717999 8:127613522-127613544 TTCAGCAGTTACGGGAAGTGAGG - Intergenic
1048885730 8:138907921-138907943 TGCAGCAGTGTTGGGAGATGTGG - Intronic
1049870623 8:144972537-144972559 TCCAGGAGACCTGGGAAATGAGG - Intergenic
1052181619 9:25535617-25535639 TGCAGAAGTTCTGGGTAAGGGGG + Intergenic
1054717597 9:68572000-68572022 TTTACCAGTTCTGGGAAATTGGG - Intergenic
1057559303 9:96114811-96114833 TTCATCAGACCTGGGAAGTGGGG - Intronic
1057727746 9:97580175-97580197 TGCAGCAGTTCTTGGCAGTGGGG + Intronic
1057797109 9:98165845-98165867 TTCAGTAGGTCTGGGGAAGGAGG - Intronic
1058190970 9:101915141-101915163 GTCAGCAGCTCTGGGCACTGGGG + Intergenic
1059099447 9:111455572-111455594 CTTAGCAGTTCTGGGAATGGTGG - Intronic
1059146802 9:111907048-111907070 TTCAGTAGTTTTGGGGGATGAGG + Intronic
1059599709 9:115763413-115763435 TGAAGCAGTTTTGGGAGATGTGG - Intergenic
1060130753 9:121096240-121096262 TTTAGCTGTTCTGGTAAATTTGG + Intronic
1203778607 EBV:88093-88115 CTCAGTGCTTCTGGGAAATGCGG + Intergenic
1186558303 X:10584229-10584251 TGCAGCAGTACTGGGATGTGGGG - Intronic
1186888365 X:13937615-13937637 TTCAGGAGTGCTGCGGAATGAGG + Intronic
1189093031 X:38107573-38107595 TTTATCAGTTCTGGGAATGGTGG + Intronic
1189948352 X:46203442-46203464 ATCAGCAGTATTGGGAGATGAGG + Intergenic
1189968798 X:46397239-46397261 TTCACCATTTGTGTGAAATGGGG + Intergenic
1190497565 X:51041264-51041286 TTCTGCAGTTCTCATAAATGAGG + Intergenic
1192295586 X:69844350-69844372 TTTAGAAGTTGTGGGAAATAAGG + Intronic
1193389051 X:80905528-80905550 TTTAGCAGTTCTTGTAATTGTGG + Intergenic
1194325556 X:92511850-92511872 TTCCGCATTTCTGGAAGATGAGG + Intronic
1196729944 X:118930622-118930644 TGCAGCAGTGTTGGGAAGTGGGG + Intergenic
1196909496 X:120471240-120471262 TTCAGAATCTCTGGGGAATGAGG - Intergenic
1197572158 X:128163153-128163175 TGCAGCTGTTGTGGGAAATGGGG + Intergenic
1197792692 X:130271288-130271310 TTCAGCACTTCCAGTAAATGAGG + Intergenic
1199199974 X:145075759-145075781 TGCAGGAGGTCTGGGAAGTGTGG - Intergenic
1199714489 X:150496720-150496742 GTCAGCAATGCTGGGTAATGAGG - Intronic
1199779786 X:151047764-151047786 TGCAGCAGTATTGGGAAGTGGGG + Intergenic
1200634286 Y:5631016-5631038 TTCCGCATTTCTGGAAGATGAGG + Intronic
1202070739 Y:20989459-20989481 TTCAGCATGCCTGGGAAAAGAGG - Intergenic