ID: 928253947

View in Genome Browser
Species Human (GRCh38)
Location 2:29705890-29705912
Sequence GGGAGTATATCCAGCACAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 100
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 91}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
928253944_928253947 10 Left 928253944 2:29705857-29705879 CCAGGAGTCAGCAATGGCAGAGA 0: 1
1: 0
2: 1
3: 35
4: 699
Right 928253947 2:29705890-29705912 GGGAGTATATCCAGCACAGCAGG 0: 1
1: 0
2: 0
3: 8
4: 91

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
928253947 Original CRISPR GGGAGTATATCCAGCACAGC AGG Intronic
900643432 1:3698088-3698110 GTCAGTGTCTCCAGCACAGCAGG + Intronic
902053051 1:13579275-13579297 GGGAGGAGATCCAGCTCCGCAGG + Intergenic
905688423 1:39925542-39925564 GGGAATAGGTCCAGCCCAGCAGG - Intergenic
913473806 1:119217353-119217375 GGGAGTATGTCCAGAGCAGGGGG - Intergenic
915718587 1:157966783-157966805 GGGGGAATATCCAGGACAGCTGG + Intergenic
916727995 1:167540451-167540473 TGGAGTAAATGCAGCTCAGCAGG - Intronic
920617710 1:207509935-207509957 GGGATTACAGCCAGCACACCCGG - Intronic
1066314806 10:34233838-34233860 AGGTGAATATCCAGCACAGTGGG - Intronic
1067428931 10:46229380-46229402 GAGAGTAAAGCCTGCACAGCTGG + Intergenic
1068809991 10:61244525-61244547 TGTAGTATATCCAGCCTAGCAGG + Intergenic
1070392596 10:75984281-75984303 GGGAGGATATCCAAACCAGCAGG + Intronic
1071387809 10:85140224-85140246 GGGATTATAGCCACCACACCTGG - Intergenic
1075595024 10:123722898-123722920 TGGAGTATATCCATCACGGCAGG + Intronic
1082771728 11:57213217-57213239 GGGAGGATATCCAGGAAAGTAGG + Intergenic
1083697680 11:64453592-64453614 GGGAGTCTGGCCAGCCCAGCAGG + Intergenic
1087868924 11:103266973-103266995 CGGAGTATGTGCAGCAGAGCTGG - Intronic
1092162060 12:6320844-6320866 AGAAATATATCCAGCCCAGCTGG - Intronic
1102555480 12:113723954-113723976 GGGAGGATATTGAGCACAGGAGG + Intergenic
1105203768 13:18202154-18202176 GGGACTACTTACAGCACAGCAGG + Intergenic
1108482912 13:50893095-50893117 GAGAGAATATCAAGCAGAGCTGG - Intergenic
1122069744 14:99197978-99198000 GGGAAGCTATCCATCACAGCTGG + Intronic
1124069364 15:26377391-26377413 GGAAATAAATCCAGCAGAGCTGG + Intergenic
1130584345 15:85168888-85168910 GAGAGGTTACCCAGCACAGCTGG + Intergenic
1138312824 16:56042680-56042702 GGGAGCTTCTCCAGCTCAGCTGG - Intergenic
1143906865 17:10216187-10216209 GGGAGTAGGACCAGCACAGGAGG + Intergenic
1146501768 17:33370698-33370720 GGGATTCTCTCTAGCACAGCAGG + Intronic
1148579208 17:48732036-48732058 AGGAGGGTCTCCAGCACAGCTGG - Intergenic
1149000307 17:51750654-51750676 GGGAGTAGATCCCACAGAGCAGG + Intronic
1150228684 17:63538212-63538234 AGGAGTATTTCCAGCACGCCTGG + Exonic
1153872123 18:9331146-9331168 GGGATTATGTCCAGCCCACCTGG - Intergenic
1157332441 18:46713670-46713692 GGGAGCATTTCCAGGACAGATGG + Intronic
1157860593 18:51137282-51137304 GTGAAGATATTCAGCACAGCAGG + Intergenic
1158420378 18:57287791-57287813 GGGAGAATAGGCAGCAAAGCAGG - Intergenic
1160696480 19:487253-487275 GGGAGTATTTACAACACAGGGGG + Intergenic
1161766437 19:6211393-6211415 GGGAGTTTCCCCAGGACAGCTGG + Intergenic
927001171 2:18795393-18795415 AGGGGGATATCCTGCACAGCTGG - Intergenic
928253947 2:29705890-29705912 GGGAGTATATCCAGCACAGCAGG + Intronic
932172120 2:69566648-69566670 GGGAGGATCTCCAGCTCAGGAGG + Intronic
934557765 2:95296474-95296496 GGGAGGGGACCCAGCACAGCTGG + Intergenic
934903785 2:98181558-98181580 GTGAGTATGCCCAGCGCAGCAGG + Intronic
937624316 2:124025913-124025935 GGGAGGAAATCCAGCACGGTTGG - Intronic
937990584 2:127659879-127659901 GGGAGTAGGGTCAGCACAGCTGG - Intronic
938030053 2:127984587-127984609 GGGAGTCTATCCAGCCCAAGGGG - Intronic
941718924 2:168792748-168792770 GGGATTATAGCCAGCATACCTGG + Intronic
946081147 2:217119572-217119594 GGCAGTATATTCACCCCAGCTGG - Intergenic
946549412 2:220784469-220784491 ATGATTATATCCAGCACAGTAGG + Intergenic
1173054803 20:39601090-39601112 GGGAGTATTTACACCACAGAAGG + Intergenic
1176662427 21:9650898-9650920 AGGAGTTTATCCAGCACAGAAGG - Intergenic
1176714200 21:10335932-10335954 GGGACTACTTACAGCACAGCAGG - Intergenic
1180761263 22:18209826-18209848 GGGACTACTTACAGCACAGCAGG - Intergenic
1180774404 22:18414793-18414815 GGGACTACTTACAGCACAGCAGG + Intergenic
1180807557 22:18725610-18725632 GGGACTACTTACAGCACAGCAGG + Intergenic
1181070519 22:20333800-20333822 GGGACTACTTACAGCACAGCAGG + Intergenic
1181193503 22:21161743-21161765 GGGACTACTTACAGCACAGCAGG + Intergenic
1181215941 22:21330856-21330878 GGGACTACTTACAGCACAGCAGG - Intergenic
1182510183 22:30814111-30814133 GATAGTATCTCCAGCACAGGCGG - Intronic
952254110 3:31680739-31680761 GGGATTCTCTACAGCACAGCTGG + Intronic
952871910 3:37908231-37908253 GGGCGAATGTCCATCACAGCAGG + Intronic
953694857 3:45149586-45149608 GGGAGTCTGACCAGCACAGGAGG + Intergenic
964644655 3:158946244-158946266 TGGAGTAAATCCAGCATAGAGGG - Intergenic
965306780 3:167075229-167075251 GGGACTATAGCCACCACACCCGG + Intergenic
967092675 3:186148706-186148728 GAGAGTAAATCCAGCCCAGCAGG + Exonic
967198302 3:187048797-187048819 TGGAGAACATCCAGCACAGAAGG - Intronic
968279189 3:197462731-197462753 GGGTCTATGGCCAGCACAGCTGG + Intergenic
968581175 4:1396084-1396106 GGGAGCAGCTCCAGCACTGCGGG + Intergenic
969148591 4:5146415-5146437 GAAAGCATATCCAGCACAGGAGG + Intronic
971294675 4:25377577-25377599 GGGAGCAGACCCAGCACAGGCGG - Intronic
971933579 4:33117950-33117972 GGGAGTCTATCCCTCACACCAGG - Intergenic
976201296 4:82581601-82581623 GGGATTATAGCCACCACACCCGG + Intergenic
980314740 4:131183638-131183660 GAAAGTATATTCAGCACACCCGG - Intergenic
981024783 4:140066690-140066712 GGGAATATACACAGCACAGGAGG + Intronic
985412969 4:189705627-189705649 AGGAGTTTATCCAGCATAGAAGG + Intergenic
985540555 5:485577-485599 GGGGCTAGAGCCAGCACAGCAGG - Intronic
985911585 5:2887890-2887912 GGGAGTATAGACTGCAAAGCTGG - Intergenic
990640838 5:57781881-57781903 GAGAAGATATCCAGCACAGAGGG - Intergenic
994075733 5:95647153-95647175 GCGAGTATCTCCAGGACGGCCGG - Exonic
997009035 5:129855115-129855137 GGGAGTACATCAAGCACTGCTGG - Intergenic
997513003 5:134466087-134466109 GGGAGTATTTCCAGAACTGCTGG - Intergenic
998587265 5:143439903-143439925 GGGATTATAGCCACCACACCTGG - Intergenic
999232833 5:150072028-150072050 GGCAGTATTTCCAGCATAGTTGG - Intronic
999407962 5:151323996-151324018 GGGAGAAAATCCCGCACAGTGGG + Intronic
999846382 5:155485471-155485493 GGGAGTGGATTAAGCACAGCTGG - Intergenic
1001396187 5:171420693-171420715 GGGAGGAGATCCCGCAGAGCCGG + Intronic
1003067564 6:2916761-2916783 TGTAGTGTCTCCAGCACAGCAGG + Intergenic
1003193514 6:3894772-3894794 GGGTGTATTTCCAGCCCAGCAGG - Intergenic
1006345796 6:33481387-33481409 GGGCGTATACCCAGCAGAGGGGG - Intergenic
1011128649 6:84033257-84033279 GGGAGTAGTTTCAGCATAGCAGG - Intergenic
1033445966 7:141422369-141422391 GGGAGCAGAACCAGCTCAGCTGG - Intronic
1037178025 8:15970226-15970248 GGCAGTATATTCAACACAGCAGG + Intergenic
1039919251 8:41881861-41881883 GGGAGCATAGCCAACACAGATGG + Intronic
1041260814 8:56019260-56019282 GGCAGTATCTCCAGGTCAGCAGG + Intergenic
1048208081 8:132431521-132431543 GGGAGTCTATCCAGAAAGGCAGG + Intronic
1050080433 9:1910253-1910275 TGGAGAATATCCACCACAGAAGG - Intergenic
1051516378 9:17934764-17934786 GGTAGTTTATCCATCACAACTGG - Intergenic
1055537046 9:77258991-77259013 GGGAATATGTACAGCATAGCAGG + Intronic
1057366767 9:94429764-94429786 TGGAGTAAATGCAGCACCGCTGG - Intronic
1057656568 9:96958300-96958322 TGGAGTAAATGCAGCACCGCTGG + Intronic
1057757017 9:97847043-97847065 GGGAGCATATCCAGGATAACTGG - Intergenic
1060683468 9:125586287-125586309 GGGAATATATCCAGCAGTGTGGG - Intronic
1192257431 X:69474233-69474255 GGGAGGATCTCGAGCACAGGAGG - Intergenic