ID: 928254069

View in Genome Browser
Species Human (GRCh38)
Location 2:29706855-29706877
Sequence GGGACTTGGCCAAGGTGGCA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 568
Summary {0: 1, 1: 0, 2: 3, 3: 54, 4: 510}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
928254069 Original CRISPR GGGACTTGGCCAAGGTGGCA TGG Intronic
900123960 1:1061420-1061442 GGGACCTGGCCAGGGTGGGCTGG + Intergenic
900318093 1:2069357-2069379 GGGTCCTGGGCAAGGGGGCATGG + Intronic
900809135 1:4787771-4787793 GCGACTTGGCCCACGGGGCACGG + Exonic
900996806 1:6127293-6127315 GGGACTTTGCCATGTTGGCCAGG - Intronic
901643061 1:10702731-10702753 GGGAAGTGGCCACGGTGGCCTGG + Intronic
901652080 1:10748810-10748832 GGGCCTTGGCCATCATGGCAGGG - Intronic
901839700 1:11946154-11946176 GGGACTTGCCCCAGGTCACATGG + Intronic
902377252 1:16035587-16035609 GTGACTTGACCAAGGTCACAAGG - Intergenic
902381347 1:16053885-16053907 GTGACTTGCCCAAGGTCACACGG - Intronic
902382430 1:16058842-16058864 GTGACTTGACCAAGGTCACAAGG - Intronic
902402581 1:16166273-16166295 GGGGCTGGGCCAAGGTGGGAAGG - Intergenic
902431034 1:16363323-16363345 GAGACTTGCCCAAGGTCACAAGG + Intronic
902726259 1:18338104-18338126 GGGACTTGGCCGAGGTTGGAGGG + Intronic
902820507 1:18940339-18940361 GTGACTTGCCCAAAGTTGCACGG - Intronic
903086717 1:20867467-20867489 GTGACTTGGCCAAAGTCACATGG - Intronic
903164747 1:21512294-21512316 GTGACTTGTCCAGGGTCGCATGG - Intronic
903180731 1:21603581-21603603 GGGACTGGGCCAGGGTCCCAGGG + Intronic
903268467 1:22172960-22172982 GTGACTTGGCCAAGGTTTCATGG + Intergenic
903334823 1:22617821-22617843 GTGACTTGCCCAAGGTCACACGG + Intergenic
903448369 1:23436802-23436824 GGGACCTGGCCGAGGTGGGCTGG - Intronic
903742202 1:25564875-25564897 GTGACTTGCCCAAGGTCTCACGG + Intronic
904442935 1:30543470-30543492 GTGACATGGCCATGGTGGCAGGG + Intergenic
904478054 1:30777227-30777249 GTGACTTGCTCAAGGTGGCCTGG - Intergenic
904608735 1:31713715-31713737 AGGACTTAGCTAAGGTGGTATGG - Intergenic
904770915 1:32881058-32881080 GGGAGTTGGCCTTGGTGGGATGG - Intergenic
905112792 1:35609312-35609334 GGGCCTTGGCCAAGGCTGCCAGG + Exonic
905322461 1:37127744-37127766 GGAACTTGTCCAAGGCTGCACGG + Intergenic
905486285 1:38299062-38299084 GGCACTTGTGCAAGGTGGAAGGG - Intergenic
905798527 1:40829147-40829169 GGCCCTTGGCCAAAGTGTCAGGG + Intronic
905823156 1:41009753-41009775 GGGACCTGGCCAATATGCCAGGG - Intronic
906132490 1:43468947-43468969 TGGAGGGGGCCAAGGTGGCAGGG + Intergenic
906262631 1:44405839-44405861 GGGAATTGGACAAGTTGGGAGGG + Intronic
906473351 1:46149720-46149742 GGGATTTCGCCAAGTTGGCCAGG + Intronic
906683237 1:47745124-47745146 AGGACTTGGCCAAGGTCACATGG + Intergenic
906774025 1:48512485-48512507 GGGACTTGCCCAAGGCCACAGGG + Intergenic
906881129 1:49592377-49592399 GGGATTTCGCCATGTTGGCAAGG - Intronic
907262950 1:53235305-53235327 GGAACTTGCCCAAGGTCACATGG + Intronic
907412074 1:54290028-54290050 GGCACTTGTCCAAGGTCACATGG + Intronic
907585860 1:55617289-55617311 GGGACTTGGCCAATATGTAAAGG - Intergenic
907679663 1:56551363-56551385 AGGACTTGGCAGAGGTGGAAGGG - Intronic
907803977 1:57800118-57800140 GCAACTTGGCCAAGGTTACATGG + Intronic
910870524 1:91829041-91829063 GGGTCATGGCCCAGGTGTCATGG - Intronic
911266882 1:95753608-95753630 TGGAGGCGGCCAAGGTGGCACGG - Intergenic
912391434 1:109305979-109306001 GTGACTTGTCCAAGGTCACAGGG + Intronic
912749009 1:112270038-112270060 GGGACTGGGAGAAGGTGGCTAGG - Intergenic
915900528 1:159843470-159843492 GTGACTTGGCCAGGCAGGCATGG + Intronic
916212796 1:162372479-162372501 GGGACTGAGCCCAGGTGCCATGG - Intronic
916246616 1:162694519-162694541 GGGACTTGGCCAAGGTTTAAGGG - Intronic
917150750 1:171942102-171942124 TGGACTTAGCAAAGGTGGCTTGG + Intronic
917717146 1:177749647-177749669 GGGTGTTGGCCTAGGTGGAAAGG + Intergenic
917818929 1:178740858-178740880 GCGATTTGCCCAAGGTTGCAGGG - Intronic
918047506 1:180950424-180950446 TGAACGGGGCCAAGGTGGCAGGG + Exonic
919654020 1:200180281-200180303 GGGAGATGTCCATGGTGGCAGGG - Intergenic
919818179 1:201455233-201455255 GGGAGTTGTCCAAGGTCACAGGG + Intergenic
919836165 1:201574906-201574928 GGCACTTGGCTAGGGAGGCATGG + Intergenic
920365866 1:205448155-205448177 GTGACTGGGCCAAGGTCACACGG + Intronic
922862489 1:228831115-228831137 GGGACTGGGCCAAGGAGGCAGGG + Intergenic
923455055 1:234157623-234157645 GGCACTTGAGCAAGGTGGCGGGG + Intronic
923715723 1:236423362-236423384 GGAATTTCACCAAGGTGGCAGGG + Intronic
1063501548 10:6559548-6559570 GGGATTTCGCCAAGTTGGCCAGG + Intronic
1065924128 10:30420941-30420963 GTGACTTGCCCAAGGTCACATGG + Intergenic
1066010070 10:31186909-31186931 GGGACATGGCCCAGGTGCAAGGG + Intergenic
1067101305 10:43336696-43336718 AGGACTTGGCCAAGGTGACTAGG - Intergenic
1067372776 10:45700446-45700468 GTGACTTGGGCAATGTGGCCAGG - Intergenic
1067387001 10:45825677-45825699 GTGACTTGGGCAATGTGGCCAGG + Exonic
1067419127 10:46131574-46131596 GTGACTTGGGCAATGTGGCCAGG - Intergenic
1067447270 10:46358930-46358952 GTGACTTGGGCAATGTGGCCAGG - Intergenic
1067504478 10:46838163-46838185 GTGACTTGGGCAATGTGGCCAGG - Intergenic
1067590109 10:47501837-47501859 GTGACTTGGGCAATGTGGCCAGG + Exonic
1067637231 10:48009932-48009954 GTGACTTGGGCAATGTGGCCAGG + Intergenic
1067876260 10:50010402-50010424 GTGACTTGGGCAATGTGGCCAGG - Exonic
1069126625 10:64643307-64643329 GGGATTTGGCCATGTTGGCCAGG - Intergenic
1070133824 10:73674361-73674383 GTGACTTGGGCAATGTGGCCAGG + Exonic
1070772149 10:79088709-79088731 GGGACTTGGGGAAGGTGGGTGGG + Intronic
1071481476 10:86068169-86068191 GTGACTTGGCCAAGGTCACATGG + Intronic
1071508432 10:86246608-86246630 GGGACCTGGAAAAGGAGGCAGGG - Intronic
1071607891 10:87010121-87010143 GTGACTTGGGCAATGTGGCCAGG - Intergenic
1071959483 10:90796172-90796194 TGCACTTGGCCAAGGAGGGAGGG + Intronic
1072199138 10:93143134-93143156 GGGCTTTGGCCAAGCTGACATGG + Intergenic
1072389890 10:94972497-94972519 GGGATTTGGCCATGTTGGCCAGG - Intronic
1075050636 10:119180904-119180926 GGGACTGGGAGAAGCTGGCATGG + Intergenic
1075446996 10:122519900-122519922 GGGACTTGCCCCAAGTGTCATGG - Intergenic
1075921202 10:126215017-126215039 GGGGCTTGGACCAGGTGCCATGG - Intronic
1075998072 10:126894166-126894188 AGGACGTGGCCAAGGCAGCAGGG - Intergenic
1076171327 10:128322538-128322560 AGGACTTGCCCAAGGTTCCAAGG - Intergenic
1076674781 10:132142235-132142257 GGGAGTTGGCCCAGGTGGGAGGG + Intronic
1076695577 10:132245857-132245879 GGGACTGGGCTGAGGGGGCAGGG - Intronic
1077301579 11:1849686-1849708 GGGGCTTGGCCAGGGAGGGAAGG + Intergenic
1077532808 11:3105154-3105176 GTGACTTGTCCAAGGTCACACGG + Intronic
1078256768 11:9664680-9664702 GGGACTTGCCCAAGGTCGCTGGG + Intronic
1079312726 11:19380753-19380775 GGCATTTTGCAAAGGTGGCAAGG - Intronic
1079391424 11:20025124-20025146 GTGACCTGCCCAAGGTGCCAGGG - Intronic
1081807701 11:45899476-45899498 GGGATCTGTCCAAGGTGCCAGGG + Intronic
1082614888 11:55347780-55347802 GGAATTTGGCCAAGTTGGCCAGG + Intergenic
1082791036 11:57346982-57347004 GTGACTTGGCCAAGGTCACAGGG - Intronic
1082802764 11:57426784-57426806 GGAACTTGCCCAAGGTCACAGGG + Intronic
1083445525 11:62705994-62706016 GCGACTTGCCTAAGGTCGCACGG + Intronic
1083609383 11:63997929-63997951 GGGACTTGCCCAGGGTCCCAGGG + Exonic
1083724286 11:64620204-64620226 GGGGCTTGGGCCAGGTGGCAGGG + Intronic
1083741819 11:64715291-64715313 GGGACTTGCCCAAGGTCACACGG + Intronic
1083814574 11:65125422-65125444 GGGCCTTGGCTGAGGTGGGATGG + Intronic
1083916015 11:65744258-65744280 TGGAGGTGGCCAAGGTGGCAGGG - Intergenic
1084198848 11:67542030-67542052 GGGGTTTGGCCATGGTGGCCAGG + Intergenic
1085121119 11:73968283-73968305 GGAACTTGGCCAAGGTCACACGG + Intronic
1085174538 11:74474483-74474505 GTGACTTGGCCCAGGTCCCAGGG - Intergenic
1085394151 11:76198174-76198196 GTGACTTGCTCAAGGTCGCAAGG - Intronic
1085418211 11:76333905-76333927 GGGATTTGGCCATGTTGGCCAGG - Intergenic
1086085152 11:82945867-82945889 CAGAGGTGGCCAAGGTGGCAGGG + Intronic
1086207983 11:84283306-84283328 GGAACTTGGCCATGGTCACAAGG - Intronic
1086365060 11:86100687-86100709 GGGGCTTGGCCATGTTGGCCAGG + Intergenic
1089687911 11:120168792-120168814 GGGACTTGGGCAGGGTGTGAAGG - Intronic
1089969075 11:122677980-122678002 GGGATTTTGCCATGTTGGCAAGG + Intronic
1090062281 11:123474558-123474580 GTGACTTGGCCAAGGTTAGAAGG + Intergenic
1090329272 11:125917805-125917827 GTAACTTGCCCAAGGTTGCATGG - Intronic
1090437007 11:126695489-126695511 GGGACTTGGGAAATGTGGCAGGG - Intronic
1092117748 12:6021443-6021465 GGGCCATAGTCAAGGTGGCAGGG - Intronic
1092318005 12:7440120-7440142 GGGACGTGGCCACGCTGGCGCGG - Intronic
1093047188 12:14460837-14460859 GGGATTTGGCAAGGATGGCAAGG - Exonic
1093573385 12:20695530-20695552 GAGAATTGGCCACGCTGGCAAGG - Exonic
1094838480 12:34333222-34333244 GGGTCCAGCCCAAGGTGGCAGGG + Intergenic
1094840093 12:34339238-34339260 GGGAGCTGCCCAAAGTGGCAGGG + Intergenic
1094843776 12:34352672-34352694 GGGTCCAGCCCAAGGTGGCAGGG - Intergenic
1094844664 12:34356191-34356213 GGGGCCAGCCCAAGGTGGCAGGG - Intergenic
1095653333 12:44639903-44639925 GTGAATTGGGGAAGGTGGCATGG - Intronic
1095961256 12:47835559-47835581 GGGATTGGGTCAGGGTGGCATGG + Intergenic
1096688839 12:53307104-53307126 AGCGCTGGGCCAAGGTGGCACGG - Exonic
1097174354 12:57134147-57134169 GGGTGTTGGCCAAGTTAGCATGG + Intronic
1097500201 12:60392282-60392304 AGGATGGGGCCAAGGTGGCAGGG - Intergenic
1100351166 12:93784404-93784426 GTGAGTTGCCCAAGGTTGCACGG + Intronic
1100507805 12:95237201-95237223 GGAACTTGCCCAAGGTCACAAGG - Intronic
1100707975 12:97222141-97222163 GTGACTTGCCCAAGGTCACACGG + Intergenic
1101145766 12:101839130-101839152 AGGCCTAGGCCAGGGTGGCAAGG + Intergenic
1101437175 12:104673762-104673784 GGAACTTGCCCAAGGTCACACGG - Intronic
1102138648 12:110596424-110596446 GGGATTTCGCCATGGTGGCCAGG - Intergenic
1102577327 12:113864109-113864131 GTGACTTGCCCAAGGTTCCATGG + Intronic
1102639925 12:114358062-114358084 GTGACTTGCCCAAGGTCACATGG + Intronic
1102730837 12:115107850-115107872 GAGACCTGCCCAAGTTGGCAGGG + Intergenic
1103340230 12:120217011-120217033 GGGTCCTGCTCAAGGTGGCAGGG + Intronic
1103917462 12:124383467-124383489 AGCACTGGGCCAAGGTGGCACGG - Intronic
1104742460 12:131188588-131188610 TGGAGGGGGCCAAGGTGGCAGGG - Intergenic
1105349408 13:19602131-19602153 GGGACGTGGCCACGCTGGCGAGG + Intergenic
1107388036 13:39933666-39933688 GTGACTTGCCCAAGGTTGCACGG - Intergenic
1108269800 13:48748614-48748636 GTGAACTGGCCAGGGTGGCATGG - Intergenic
1108598472 13:51970600-51970622 GGGACTTTGCCAAGATGTCCGGG + Exonic
1112010349 13:95288612-95288634 GGGACTTTGCCATGTTGGCCAGG - Intronic
1113296519 13:108964807-108964829 GGGACTTGGCCAAGAGGTCTCGG - Exonic
1113355585 13:109576841-109576863 AGGACTTGCCCAAGGTCTCAAGG - Intergenic
1113469053 13:110531483-110531505 GTGACTTGCCCAAGGTCACACGG - Intronic
1114455073 14:22848814-22848836 GGGACCTTGATAAGGTGGCAGGG + Intronic
1114695803 14:24626688-24626710 GGCTCTTGGCCAAGGAGGCTGGG + Intergenic
1114813869 14:25932515-25932537 GTGACTTGCCCAAGGTCACAGGG + Intergenic
1115453300 14:33573650-33573672 AGGACTTGGCCAATTTGGAAAGG + Intronic
1115583219 14:34783525-34783547 GGGATTTGGCCATGTTGGCCAGG + Intronic
1115667425 14:35567524-35567546 GTGACTTGGCCAAGATCACAAGG + Intronic
1116025272 14:39507010-39507032 GGGATTTTGCCATGTTGGCAAGG + Intergenic
1116478198 14:45365721-45365743 AGGCCTTGGCCAAGGATGCATGG - Intergenic
1117042666 14:51780935-51780957 GGGAGCTGTCCAAGGTGTCACGG + Intergenic
1117061773 14:51971193-51971215 AGGACTTGCCCAAGGTCGCATGG - Intronic
1117581404 14:57155181-57155203 GTAACTTGGCCAAGGCTGCATGG + Intergenic
1119158584 14:72433771-72433793 GTGACTTGCCCAAGGTCACATGG - Intronic
1119805012 14:77476844-77476866 GGGACTTTGCCATGTTGGCCAGG - Intronic
1119968533 14:78943727-78943749 TAGTCTTGGACAAGGTGGCAGGG + Intronic
1120759913 14:88275654-88275676 GGGACTTCGCCATGTTGGCCAGG - Intronic
1121667392 14:95683832-95683854 GGTACTGGGCCAAAATGGCAGGG - Intergenic
1122092837 14:99351474-99351496 ATGACTTGCCCAAGGTCGCAGGG - Intergenic
1122201339 14:100124427-100124449 GGAACTTGCCCAAGGTTGCAAGG - Intronic
1202840194 14_GL000009v2_random:114386-114408 TGGAGGGGGCCAAGGTGGCAGGG - Intergenic
1123631216 15:22260878-22260900 GGATCCTGGCCAAGGTTGCACGG - Intergenic
1123939725 15:25211009-25211031 GGGTCATGTCCAGGGTGGCAGGG + Intergenic
1125798356 15:42421585-42421607 GAGATTTGGCCAGTGTGGCATGG - Intronic
1126419615 15:48457556-48457578 GGGACATGGCCAAGCTGGTGAGG - Intronic
1126420474 15:48467048-48467070 GGAACTTGCCCAAGGTTACATGG + Intronic
1127859160 15:62978738-62978760 GAGACTTGGCCAAGCTTGCTTGG + Intergenic
1128064125 15:64753960-64753982 GTGACTTGTCCAAGGTCACATGG + Intronic
1128698909 15:69789747-69789769 GTAACTTGCTCAAGGTGGCATGG + Intergenic
1128709464 15:69860920-69860942 GAGACTTGTCCAAGGTCACATGG + Intergenic
1128772818 15:70295191-70295213 GGGTCTTGCCCAAGGTGGGGTGG - Intergenic
1129237351 15:74231669-74231691 TGGACTTGCCCAAGGTCACACGG - Intergenic
1129494929 15:75970485-75970507 GGGCCTTGGCCTAGGCAGCAGGG + Intronic
1129526047 15:76215150-76215172 GTGACTTGGCCAAGGCCACATGG - Intronic
1129773017 15:78214630-78214652 GGGTTTTGGCCATGGTGGCTAGG + Intronic
1130164616 15:81440623-81440645 GTGACTTTGCCAAGGTCCCAAGG - Intergenic
1130661973 15:85837911-85837933 GGGAGGTGGGGAAGGTGGCAAGG - Intergenic
1130898057 15:88185936-88185958 GGGACATGGACCAGGTGGCCAGG + Intronic
1131228830 15:90646106-90646128 GGGAGCTGGCCCAGGTGGCCTGG - Intergenic
1131420295 15:92299331-92299353 GGGCCTTGGCAAAGGTGGTGGGG - Intergenic
1132145039 15:99424578-99424600 GGGATATTCCCAAGGTGGCAGGG + Intergenic
1132480752 16:165093-165115 GGAACTTGGCCCAGGCGGCGTGG - Intronic
1132585649 16:704962-704984 GGGCCTTGGCCAAGGTTGGAGGG - Intronic
1133008287 16:2896665-2896687 GGGCCTTGGCAAGGGTGGCGGGG - Exonic
1133658014 16:7885608-7885630 GGGTTTTGGCCAATGAGGCAGGG + Intergenic
1133922256 16:10163830-10163852 GGGATATTGCCCAGGTGGCAGGG - Intronic
1134642591 16:15841327-15841349 GGGGCTTCGCCAAGTTGGCCAGG + Intronic
1135851269 16:25966181-25966203 GGGACATGGCCAAGGTCATATGG + Intronic
1136179317 16:28539896-28539918 GGGACTCGCCCAAGGTCACACGG - Intergenic
1136340754 16:29641525-29641547 AGGATTTTGCCAAGTTGGCAAGG + Intergenic
1136459781 16:30402564-30402586 GGGACTTTGCCAGATTGGCAAGG - Intergenic
1136470553 16:30477025-30477047 GAGACTTGACCAAGGTCACATGG + Intronic
1137610236 16:49813056-49813078 GGGAGTGGACCAAGGTGGGAAGG - Intronic
1137676195 16:50304967-50304989 AGGACTTGGCCAGGAGGGCAGGG - Intronic
1137734695 16:50715177-50715199 GTGACTTTGCCAAGGTTGTACGG - Intronic
1138457513 16:57129880-57129902 GGGTCCTGGCCCAGGTGGCCAGG - Intronic
1139138476 16:64233435-64233457 TGGAGGTGGCCAAGGTGGTAGGG - Intergenic
1140072859 16:71667954-71667976 GGGGCTTGGTGAAGGCGGCAGGG - Intronic
1140590432 16:76345574-76345596 GGGATTTGGCCAATGTGATAAGG + Intronic
1140641676 16:76980972-76980994 GGGACTTGCCCAAGGTCATATGG - Intergenic
1140836539 16:78799593-78799615 GGGACTTGGCCAAGGTCACATGG + Intronic
1141245047 16:82298134-82298156 GGAACTGGTCCGAGGTGGCATGG + Intergenic
1141262415 16:82466134-82466156 TGGGCTTGACTAAGGTGGCAGGG - Intergenic
1141517406 16:84554858-84554880 GGGACCAGGTCAAGGTGTCAAGG - Intergenic
1141971803 16:87489620-87489642 GGATCCTGGCCAAGGTTGCACGG + Intronic
1141984461 16:87570926-87570948 GGGACTTGCCCAAGGTCACTCGG - Intergenic
1142824742 17:2502076-2502098 GTGATTTGTCCAAGGTCGCATGG + Intronic
1142876662 17:2855114-2855136 GGGACTTTGAGAAGCTGGCATGG + Intronic
1142916722 17:3146674-3146696 GTGACTTGGTCCAGGAGGCAGGG - Intergenic
1145030496 17:19501406-19501428 GGGAGTTGGCCGGGTTGGCAGGG - Intronic
1145790334 17:27622672-27622694 GTAACTTTGCCAGGGTGGCAGGG - Exonic
1145816305 17:27797456-27797478 GGGACTTGCCAAAGGTTACAGGG + Intronic
1145970936 17:28956119-28956141 GGGTCTTGGATAGGGTGGCAAGG + Intronic
1146008476 17:29177059-29177081 GGGACTTGCTCAAGGTCACACGG - Intronic
1146285895 17:31574010-31574032 GGGCCTTGGGCAAAGTGGCCTGG + Intronic
1146412422 17:32598180-32598202 GGGATTTGGCCATGTTGGCCAGG - Intronic
1146467383 17:33096907-33096929 GGGACAAGGCCAGAGTGGCAGGG + Intronic
1146679489 17:34796767-34796789 GAAACTTGCCCAAGGTGTCAGGG - Intergenic
1147120603 17:38333161-38333183 GGCACATAGCCCAGGTGGCAGGG + Intronic
1147664319 17:42136514-42136536 GTGACTTGGCCAAGGTCACACGG - Intronic
1147723069 17:42550453-42550475 GGGAGGGGGCCCAGGTGGCATGG + Exonic
1147724281 17:42556679-42556701 GGGAGGGGGCCCAGGTGGCATGG + Intergenic
1148001502 17:44390150-44390172 GGACCTTGGTCTAGGTGGCAAGG + Intergenic
1148051312 17:44771392-44771414 GGAACTTGCCCAGGGTGGCACGG + Intronic
1148732309 17:49844958-49844980 GTGACTTGTCCAAGGTCACACGG + Intronic
1149995975 17:61406060-61406082 GGGACTTGCCAAAGGTCACACGG - Intronic
1150283225 17:63941269-63941291 TGGACTTGCCCATGGTGCCAGGG - Exonic
1150645181 17:66973463-66973485 GTGACTTACGCAAGGTGGCATGG + Intronic
1150656117 17:67040806-67040828 GGGAAATGGCCACCGTGGCAGGG + Intergenic
1150808340 17:68336659-68336681 GGGATTTTGCCATGTTGGCAAGG - Intronic
1151183893 17:72349623-72349645 GGGAGAAGGCCAAGGTTGCATGG - Intergenic
1151344072 17:73490960-73490982 GGAACTTGCCCAAGTTTGCATGG + Intronic
1151414075 17:73950110-73950132 TTGACTTGGCCAAGGTCACATGG - Intergenic
1151513816 17:74579484-74579506 GGGAATAGCCCCAGGTGGCACGG + Exonic
1151611631 17:75179850-75179872 GGGATTTTGCCATGGTGGCCAGG + Intergenic
1152243435 17:79172464-79172486 GGGACGTGGACAGGGTGGCCTGG - Intronic
1152580845 17:81165082-81165104 GGGACTTGGCCCTGGGGCCATGG + Intronic
1153364224 18:4235915-4235937 GGGGTTTGGCCAAGTTGGCCAGG + Intronic
1153849700 18:9081489-9081511 GGGATTTCGCCATGGTGGCCAGG + Intergenic
1154259905 18:12821751-12821773 GGGAGTTAGACAAGGAGGCAAGG + Intronic
1154331004 18:13428930-13428952 GGGTCTAGGGCAAGGTGGAAAGG + Intronic
1154346033 18:13544269-13544291 GGGACTTGTCTAGGGTGCCATGG + Intronic
1156474830 18:37398796-37398818 GGGATTTGTCCAAGGTGGCTGGG - Intronic
1157508043 18:48245312-48245334 GGGACTTGGGAAGGGTGGGAGGG + Intronic
1158520461 18:58168394-58168416 GGGATTTGCCCAAGATAGCATGG - Intronic
1158833509 18:61305225-61305247 GTGACTTGCCCAAGGTCGCCTGG - Intergenic
1159028724 18:63209602-63209624 GGGGATTCTCCAAGGTGGCATGG + Intronic
1160820871 19:1057157-1057179 GGGGCTTGTCCAAGATGGCCTGG + Intronic
1161004874 19:1930104-1930126 GGGACTTGCACCAGGGGGCAGGG + Intergenic
1161211159 19:3066584-3066606 GTGACTTGGCCAAGTGGGTAGGG + Intergenic
1161439271 19:4281109-4281131 GTGACTTGGCTAAGGTCTCACGG + Intronic
1161672862 19:5623749-5623771 GGGACTCGGCCAAGGTCACACGG + Intronic
1161682102 19:5685211-5685233 GCGACTTGCCCAAGGTCACACGG - Intronic
1162293250 19:9794458-9794480 GGGGCTTCGCCACGTTGGCAAGG + Intergenic
1162381354 19:10333621-10333643 GGGGCTTAGCCAACGGGGCAAGG - Exonic
1162727698 19:12700016-12700038 GGAACATGGTCAAGGTGGAAGGG - Exonic
1162775249 19:12975298-12975320 GGGGCTTGCCCATGGTGCCAGGG - Intergenic
1163126132 19:15245204-15245226 GGGACTTGTCCAGGGTCACATGG + Intronic
1163236352 19:16032655-16032677 GGGACTTGGGTAAGGGGGCCTGG + Intergenic
1163317136 19:16548525-16548547 GGGACTAGGGGGAGGTGGCAGGG - Intronic
1163391681 19:17035007-17035029 GGGATTTCGCCAAGTTGGCCAGG - Intergenic
1163432302 19:17275673-17275695 GTGACTTGGCCAGGGTCACATGG + Intronic
1164400879 19:27901392-27901414 GGAAGTTGGACAAGGTGCCAGGG + Intergenic
1164764504 19:30753712-30753734 AGGACTTTGCCAAGGTCACAGGG - Intergenic
1165437074 19:35801711-35801733 GGGACTGGGGGAAGGTTGCAGGG - Intronic
1165717195 19:38053998-38054020 GGGACCTGTCCAAGGTCACACGG + Intronic
1166113767 19:40640224-40640246 GGGACTGAGCCAAGGGGGCCAGG - Intergenic
1166203019 19:41250899-41250921 ATGACTTGCCCAAGGTTGCACGG - Intronic
1166351562 19:42201167-42201189 GTGACTTGCCCAAGGTCACACGG + Intronic
1166831585 19:45642583-45642605 GGGACTTCCCCAAGGTCACACGG - Exonic
1167020674 19:46873047-46873069 GGGACTTGCCCAAGGCCACATGG + Intergenic
1167036389 19:46997563-46997585 GTCACTTGCCCAAGGTGACACGG + Intronic
1167269019 19:48497833-48497855 GGGGCTGGGCCAAGGGGGCCAGG + Exonic
1167418863 19:49391005-49391027 GGGACTTGGGAGAGGTGGCTGGG + Intronic
1167722903 19:51190986-51191008 GGGACGGGGCCGAGGTGGCCTGG - Intergenic
1167794116 19:51698155-51698177 GTCACTTGGCCAAGGTCGCATGG + Intergenic
925317574 2:2937632-2937654 AGGACTGGGCCAAGGTCTCATGG + Intergenic
925845425 2:8029058-8029080 TGGCCTTGGCCAGGGAGGCAGGG - Intergenic
925909857 2:8566513-8566535 GGGAGGGGACCAAGGTGGCATGG - Intergenic
925971239 2:9108013-9108035 GGGACTTGGGCAGGGGTGCAGGG - Intergenic
926216860 2:10911404-10911426 GGGACTTGCCCAAGGTCACGCGG - Intergenic
926694898 2:15764337-15764359 GGGACTTCCCCAAGGTCACATGG + Intergenic
927158180 2:20234148-20234170 ATGACTTGTCCAGGGTGGCAGGG - Intergenic
927484994 2:23482409-23482431 GGCACCTGGCCAAGGAGACATGG + Intronic
927836144 2:26400935-26400957 GTGACTTGCCCAAGGTGGCAGGG + Intergenic
927970882 2:27305918-27305940 GTGACTTGCCCAAGGTCGTAGGG - Intronic
928254069 2:29706855-29706877 GGGACTTGGCCAAGGTGGCATGG + Intronic
928455140 2:31413936-31413958 GGGACTTAGGGAAGGTGACATGG - Intronic
928534816 2:32229709-32229731 GAGAAGTAGCCAAGGTGGCATGG + Intronic
929053326 2:37856096-37856118 ATGACTTGGCTAAGGTGCCATGG + Intergenic
930027512 2:47038297-47038319 GTGACTTGCCCAAGGTCACATGG + Intronic
931432718 2:62221417-62221439 GACACTTGCCCAAGGTTGCAGGG - Intronic
931773984 2:65524143-65524165 GGGCCTTGGCCACGTTGGGATGG - Intergenic
932008820 2:67954945-67954967 GTGACTTGCCCAAGGTCACATGG - Intergenic
932439888 2:71727719-71727741 GGAACTTGGCCAATGTGGAGGGG + Intergenic
932631519 2:73347367-73347389 GCAACTTGGCCAAGGTCGCCGGG - Intergenic
932706987 2:74033902-74033924 GGGATTTGGCCATGTTGGCCAGG - Intronic
933183953 2:79258325-79258347 GGGAACTGCCCAAGGTCGCATGG - Intronic
933738119 2:85511687-85511709 TGGGCTAGGCCAAGATGGCAGGG - Intergenic
934102558 2:88666839-88666861 GAGACTGGGCCAAGGTTCCAAGG - Intergenic
934672253 2:96222122-96222144 GGGCCTTGGCAAGGGTGGTAGGG + Intergenic
937034588 2:118770207-118770229 GCAACTTGCCCAAGGTCGCATGG - Intergenic
938136888 2:128766198-128766220 GACGCTTGGCCCAGGTGGCATGG + Intergenic
938180448 2:129177622-129177644 GGGATTTGGCCATGTTGGCCAGG + Intergenic
938180721 2:129179452-129179474 TGGAAGGGGCCAAGGTGGCAGGG + Intergenic
941128439 2:161616054-161616076 GTGACTTGCCCAAGGTCACATGG + Intronic
942385372 2:175437284-175437306 GTAACTTGGCCAAGGGGACATGG + Intergenic
942906156 2:181183321-181183343 GGGAATTCCCCAAAGTGGCAAGG + Intergenic
944325230 2:198396701-198396723 TGGTCTTGGCCAAGGAGGCATGG + Intronic
944390991 2:199219397-199219419 GGGCCTTTTCCAGGGTGGCAGGG - Intergenic
946014465 2:216592860-216592882 GTGACTTGGACAATGTGGCATGG - Intergenic
946163974 2:217852649-217852671 GGGGCTTGGCCACAGGGGCAAGG - Intronic
946664301 2:222033014-222033036 GGGCCTTGGCCAAAGTGGGATGG + Intergenic
946681273 2:222219353-222219375 AGTGCTTGGCCCAGGTGGCAAGG - Intronic
947452571 2:230222034-230222056 GGGATTTTGCCATGTTGGCAAGG - Intronic
948048499 2:234961828-234961850 GGAACTGGGCAAAGTTGGCATGG - Intronic
948152251 2:235753511-235753533 GGGATTTCGCCATGGTGGCCAGG - Intronic
948508906 2:238449947-238449969 GGGATGTGGCCAAGGCCGCACGG - Exonic
948636992 2:239344995-239345017 GGAGCTTGGACAAGGTGGCAGGG - Intronic
948751563 2:240136213-240136235 TGGACCTGGACGAGGTGGCACGG - Exonic
1168919584 20:1520205-1520227 GTGACTTGCCCAAGGTCACAGGG - Intergenic
1168939466 20:1696428-1696450 GGGCCTTGCCCAAGGTCACAGGG - Intergenic
1169777949 20:9276590-9276612 GGGATTTGTCCAAGGTCACATGG + Intronic
1172110320 20:32540852-32540874 GGGACTTGGACAAGGGCTCAGGG - Intronic
1172331629 20:34079741-34079763 GAGACTTGCCCAAGGTTACATGG + Intronic
1172495894 20:35383892-35383914 GTGACTTGCCCAAGGTCACAAGG - Intronic
1172647170 20:36477858-36477880 GGGACTTGCCCAAGGTCATACGG + Intronic
1173207661 20:41007343-41007365 TGAAGTGGGCCAAGGTGGCAGGG + Intergenic
1173362986 20:42361045-42361067 GAGCCAAGGCCAAGGTGGCAGGG - Intronic
1173421856 20:42908201-42908223 GTGACTTGTCCAAGGTCACATGG - Intronic
1173642677 20:44614936-44614958 GGGACCTGGGCTAGGGGGCAGGG - Intronic
1173708882 20:45137132-45137154 GGGAGGTAGCCAAAGTGGCAAGG - Intergenic
1173872245 20:46349341-46349363 GGGACTTGGCCAAGGAGGAGTGG + Intronic
1174177492 20:48654129-48654151 GGGACTTGCCGAAGGTTCCAGGG - Intronic
1174412164 20:50343388-50343410 GTGACTTGCCCAAGGTCACACGG + Intergenic
1175065052 20:56277288-56277310 TGGAAGGGGCCAAGGTGGCAGGG - Intergenic
1175537853 20:59727602-59727624 GTGACTTGCCCAAGGTCACATGG - Intronic
1178663233 21:34523972-34523994 GGGGCTTTGCCATGTTGGCAAGG + Intronic
1179567267 21:42257143-42257165 GGAACTTGCCCAAGGTCACACGG + Intronic
1180127191 21:45800702-45800724 GGCACATGGCCCAGGTGGGAGGG - Intronic
1180569190 22:16699856-16699878 GGGCCATAGTCAAGGTGGCAGGG - Intergenic
1181256596 22:21566907-21566929 GTGACTTGCCCAAGGTCACACGG - Intronic
1181762813 22:25069593-25069615 GGGACTTGGCCAAGGTCACGCGG - Intronic
1181936912 22:26445601-26445623 GGGACTTGCCCAAGGTCCCGAGG - Intronic
1182081998 22:27536217-27536239 GTGACTTGGCCAAGGTCACTTGG - Intergenic
1182097996 22:27638824-27638846 GGGACTTGCCCAAGATCACAGGG + Intergenic
1182778618 22:32849824-32849846 GTGACTTGACCAAGGTCTCATGG - Intronic
1183106032 22:35615725-35615747 GAGACTTGTCCAAGGTCACATGG + Intronic
1183183889 22:36280646-36280668 GTGACTTGCCCAGGGTGACAGGG + Intergenic
1183241621 22:36661820-36661842 GAGGCTTGGCCAAGGTTCCATGG - Intronic
1183321620 22:37168469-37168491 AGGAAGTGGCCAAGGTGGGATGG - Intronic
1183671417 22:39274985-39275007 GAGACTGGGTCAAGGTGTCACGG - Intergenic
1183714693 22:39526876-39526898 AGGAGTTGGCCAAGGGGGCCAGG - Intergenic
1184060022 22:42075706-42075728 GGAACTTGCCCAAGGTTACATGG - Intronic
1184246104 22:43236542-43236564 GGGACCTGGCCAAGCTTGTAGGG + Intronic
1184419820 22:44373271-44373293 GGGATTTTGCCATGTTGGCAAGG + Intergenic
1184646621 22:45898803-45898825 GTGACTTGTCCAAGGTACCACGG + Intergenic
1184778136 22:46633400-46633422 GGGACTTGGATGAGGTGGCATGG + Intronic
1184908462 22:47508967-47508989 AGGACATGGCCAACCTGGCATGG - Intergenic
949500621 3:4676982-4677004 GGGACATGGCCATGTTGGGAGGG - Intronic
950033184 3:9865244-9865266 GGGATTTGGCCATGTTGGCCAGG + Intergenic
950353543 3:12381841-12381863 GTGACTTCTCCAAGGTGTCATGG + Intronic
950554236 3:13685641-13685663 GTGACTTGCCCAAGGTCACATGG - Intergenic
950679180 3:14573353-14573375 GGGACCTGGAGAAGCTGGCAGGG - Intergenic
952121179 3:30246238-30246260 GGCACCTGGCCAAGCTAGCAGGG + Intergenic
952893306 3:38059118-38059140 GGGAATTGGCCGAGCTGGCTGGG + Intronic
953163726 3:40445431-40445453 CGGAAGGGGCCAAGGTGGCAGGG - Intergenic
953215309 3:40912739-40912761 GTGACTTGCCCAAGGTCACATGG - Intergenic
954222475 3:49163138-49163160 GGGCCAAGGCCAAGGTGGCTCGG - Exonic
954423057 3:50428745-50428767 GGGACTTGCCCAAGGTCACTAGG + Intronic
955412386 3:58664106-58664128 GTAACCTGCCCAAGGTGGCAAGG - Intronic
956859441 3:73307917-73307939 GTAACTTGCCCAAGGTGGCAGGG + Intergenic
956885363 3:73553756-73553778 AGGAGTAGGCCAAGGTGACAGGG + Intronic
957486645 3:80870767-80870789 TGGAGCGGGCCAAGGTGGCAGGG - Intergenic
957665396 3:83218749-83218771 TGGAATGGGCCAAGGCGGCAGGG + Intergenic
958443427 3:94184522-94184544 GAGACTTGTCCAAGGTGGAAAGG - Intergenic
960011201 3:112835774-112835796 TGGAGGGGGCCAAGGTGGCAGGG + Intronic
960165818 3:114400182-114400204 GTGACTTGGCCATGGTCACACGG - Intronic
961566957 3:127770787-127770809 GTGACTTGCCCAAGGTCACAAGG + Intronic
962314616 3:134351255-134351277 GGCACCTGGCCAAGGAGGAAGGG + Intergenic
962316250 3:134361280-134361302 TGGACATGGGCCAGGTGGCAGGG + Intronic
962426898 3:135278096-135278118 GGGAATTTTCCAAGGTGGCAGGG + Intergenic
962573128 3:136731429-136731451 GATACTTGGCCAAAGTGGTAGGG - Intronic
962785999 3:138768729-138768751 TGGAGGGGGCCAAGGTGGCAGGG + Intronic
962796231 3:138851927-138851949 GGGATTTTGCCAAGTTGGCCAGG + Intergenic
965261298 3:166489467-166489489 TGGAGTGGGCCAAGGTGACAGGG - Intergenic
965431379 3:168593363-168593385 GGGGCTTCGCCAAGTTGGCCAGG - Intergenic
967827589 3:193890422-193890444 GTCACTTGGCCAAGGTGACATGG + Intergenic
968044479 3:195616370-195616392 GAGACTTGGCCAGGGTCACAGGG + Intergenic
968045279 3:195620481-195620503 GGGACTTGCCCAAGGTCACTCGG - Intergenic
968060268 3:195722421-195722443 GAGACTTGGCCAGGGTCACAGGG + Intronic
968061134 3:195726824-195726846 GGGACTTGCCCAAGGTCACTCGG - Intronic
968386892 4:148415-148437 GGGATTTGGCCAATTTGGCCAGG - Intronic
968723070 4:2222000-2222022 GAGACGTGCCCAAGGTGGCTGGG - Intronic
968760930 4:2442549-2442571 GGGAGGTGGCCGAGGAGGCACGG - Intronic
968901367 4:3433509-3433531 GGGGCTAGGACAGGGTGGCATGG - Intronic
968901386 4:3433577-3433599 GGGGCTAGGACAGGGTGGCATGG - Intronic
968915255 4:3494478-3494500 CGGACTAGGACAAGGTGGTAAGG - Exonic
969065673 4:4478619-4478641 GGGAGTTGGCCAAGGTGCCTGGG + Intronic
969266440 4:6067029-6067051 GGGACCTGGGCATGGTGGCCAGG - Intronic
969275217 4:6130135-6130157 AGGACTTTGCCAAAGTGGCCTGG - Intronic
969485285 4:7468912-7468934 GTGACTTGTCCAAGGTCACACGG - Intronic
969955613 4:10887728-10887750 GGGAGTTTGCCAACGTGGGAAGG + Intergenic
970319916 4:14864965-14864987 GTAACTTGCCCAAAGTGGCATGG + Intergenic
971066469 4:23038498-23038520 GTGACTTGCCCAAGGTGACATGG + Intergenic
972358329 4:38303407-38303429 TGGAGGGGGCCAAGGTGGCAGGG + Intergenic
974516923 4:62927788-62927810 GAGACTTGGCAAAAGTGACAAGG + Intergenic
974644253 4:64671813-64671835 TGGAGGGGGCCAAGGTGGCAAGG + Intergenic
975101804 4:70522150-70522172 GTAACTTGCCCAAGGTGACATGG - Intronic
975391035 4:73817537-73817559 GGGAACTGTCCAAGGTGACAGGG + Intergenic
975761088 4:77620674-77620696 GGGACATGGCCCAAGTGGCTGGG - Intergenic
977969734 4:103199179-103199201 GGGGCTTCGCCATGTTGGCAAGG + Intergenic
978229968 4:106386106-106386128 TGGAGGGGGCCAAGGTGGCAGGG + Intergenic
979459691 4:120967875-120967897 GTGACTTGACCAAGGTCACATGG + Intergenic
980210257 4:129778392-129778414 TGCACCTGGCCAAGTTGGCAAGG - Intergenic
980262129 4:130463307-130463329 GGGATTTCACCAAGTTGGCAAGG - Intergenic
980901326 4:138907994-138908016 GGGTTTTGGCCATGTTGGCAAGG - Intergenic
981013964 4:139954126-139954148 GCAACTTATCCAAGGTGGCAGGG - Intronic
981809069 4:148752734-148752756 GGAAATTGGCAAAGGTGCCATGG + Intergenic
981987529 4:150875512-150875534 GGGCTTTGGCCAATGTGGCTGGG - Intronic
983485241 4:168324691-168324713 GGAATTTAACCAAGGTGGCAGGG + Intergenic
984325133 4:178241820-178241842 TGGAGGTGGCCAAGGTGGTAGGG - Intergenic
984752798 4:183295269-183295291 GGGACTTCTCCAAGGTTGGATGG - Intronic
984930208 4:184840506-184840528 GGGATTTGGCCATGTTGGCCAGG + Intergenic
984931365 4:184850352-184850374 GGGACATGGGCAAGATGGAAGGG - Intergenic
984992823 4:185397101-185397123 GGGACTGGACAAAGGTGGGAAGG + Intronic
985090897 4:186361682-186361704 TGGTCCTGGCCAAGGTGACATGG + Intergenic
985370559 4:189281507-189281529 GGAATTTAGCCAAAGTGGCAGGG + Intergenic
985680360 5:1252824-1252846 AGGGCCTGGCCAGGGTGGCAGGG - Intergenic
986105837 5:4658562-4658584 GTGGCTTGGCCAAGGTGCAATGG + Intergenic
986381432 5:7190189-7190211 GTGACTTGCCCAAGGTCACATGG + Intergenic
986389830 5:7274395-7274417 GGCACATCGCCAAGATGGCACGG + Intergenic
989339105 5:40354424-40354446 CGGAGTGGGCCAAGGTGGCAGGG - Intergenic
989601477 5:43204508-43204530 GGGATTTTGCCAAGTTGGCCAGG - Intronic
990951949 5:61307084-61307106 GGGACTTGGAGGAAGTGGCATGG - Intergenic
991238821 5:64432241-64432263 GGGACTTTGCCATGTTGGCCAGG - Intergenic
993661134 5:90636245-90636267 GGGACTTGGAGAAGGTCTCAGGG - Intronic
993879705 5:93348022-93348044 GGGACGTGGCCAAGGTCACGCGG + Intergenic
996435406 5:123428585-123428607 GGGGTTTGGCCATGGTGGCCAGG - Intergenic
996691678 5:126347105-126347127 GGGACTTTGCCATGTTGGCCAGG + Intergenic
997469440 5:134108696-134108718 AGGAATTGTCCTAGGTGGCAGGG + Intergenic
998141819 5:139704155-139704177 GGGACTTCTCCAGGGTGTCAAGG - Intergenic
999255887 5:150209898-150209920 GGGACTTGCCCCAGGTCGCATGG + Exonic
999681817 5:154067772-154067794 GGGGCTTGTCCAAGGTCACATGG - Intronic
1000556279 5:162730048-162730070 GGGATTTTGCCAAGTTGCCAAGG + Intergenic
1000690901 5:164319681-164319703 GGAATTTGCCCAAGGTGGTAAGG - Intergenic
1001422886 5:171600531-171600553 GGGGCATGGCTGAGGTGGCATGG + Intergenic
1002585884 5:180247812-180247834 GGTACTTGGCCATGGAGGCTGGG - Intronic
1002590908 5:180291505-180291527 GTGCCTTGGCCAAGGTCGCGGGG + Intronic
1005280436 6:24268293-24268315 GGGACTTCGCCATGTTGGCTAGG - Intronic
1005672259 6:28118627-28118649 GGCATTTGGCCTACGTGGCATGG - Intergenic
1007072591 6:39048383-39048405 GGGACTTGTCCAAGGTCACACGG - Intergenic
1007394477 6:41569805-41569827 GGGATTTGGCCCAGTTGCCACGG - Intronic
1007415455 6:41688855-41688877 GGGACTTTCCCTTGGTGGCATGG + Intronic
1008003091 6:46381296-46381318 GTGACTTGCCCAAGGTTGCATGG - Intronic
1008895531 6:56549925-56549947 GTGACTTGTCCAAGGTCACACGG - Intronic
1010846825 6:80720017-80720039 CAGAGTGGGCCAAGGTGGCAAGG - Intergenic
1011158073 6:84355926-84355948 GGGGCTGGGCCAAGGTGTCCAGG - Intergenic
1011529265 6:88302270-88302292 GTGACTTGCCCAAGGTCACAGGG - Intergenic
1012534801 6:100282570-100282592 GGGGCTGAGCCAAGGTGGCTTGG - Intergenic
1012709499 6:102581749-102581771 GGGAGTGGGCCAAGGCAGCAGGG - Intergenic
1012982439 6:105844377-105844399 GGGTCTTGGCCTAGATGCCAGGG - Intergenic
1014384499 6:120784213-120784235 GGGACCTTGCTAAGGTAGCAAGG + Intergenic
1014871667 6:126603673-126603695 TGGACTGGGCCACTGTGGCAGGG + Intergenic
1016076810 6:139805358-139805380 TGGAGGTGGCCAAGGTGGCAGGG + Intergenic
1016842312 6:148536748-148536770 GGGTCTCAGCCAAAGTGGCATGG - Intronic
1018943001 6:168322137-168322159 GGGGCTTGGCCATGTTGGCCAGG + Intergenic
1019145293 6:169972033-169972055 GAGACTTGGCGTATGTGGCATGG - Intergenic
1019717730 7:2547889-2547911 GGGACTTCGCCATGTTGGCCAGG - Intronic
1021097195 7:16547715-16547737 TGGAGGGGGCCAAGGTGGCAGGG - Intronic
1021957472 7:25840363-25840385 GTGACCTGGACAAGGTGGCCTGG - Intergenic
1022171454 7:27836028-27836050 GTGACTTGGCCAAGATCACATGG + Intronic
1022496350 7:30855423-30855445 GGGATCTGGCCAGGGTGGCCAGG + Intronic
1022627818 7:32056163-32056185 GGGACCTGGCAAATTTGGCAGGG + Intronic
1022847606 7:34226723-34226745 GGGATTTGGCAATGGTGGAATGG - Intergenic
1023817507 7:43961945-43961967 GGGACCTGGGCAGGGTGGGAGGG - Intergenic
1025183536 7:56838043-56838065 AGGACTTGGCCAAGGTGCCGAGG - Intergenic
1026137227 7:67674169-67674191 GTGACTTGCCCAAGGTCACAAGG + Intergenic
1027744644 7:82057808-82057830 AGGAGTTGGCCAAGGCTGCAGGG + Intronic
1029607471 7:101607865-101607887 GGGATTGGGCAAAGGGGGCAGGG + Intergenic
1029718950 7:102350449-102350471 GGGATTTGGCCATGTTGGCCAGG + Intergenic
1029753665 7:102558809-102558831 GGGATTTGGCCATGTTGGCCAGG - Intronic
1029771613 7:102657893-102657915 GGGATTTGGCCATGTTGGCCAGG - Intronic
1030012354 7:105182657-105182679 GGGATTTGGCCATGTTGGCCAGG + Intronic
1030039047 7:105433683-105433705 GGGATTTGGCCATGTTGGCCAGG - Intergenic
1030542322 7:110846238-110846260 GTGCCTTGGCCAAGGTAACATGG + Intronic
1030721881 7:112881194-112881216 TGGAGGGGGCCAAGGTGGCAGGG - Intronic
1030924667 7:115437419-115437441 GTGAGTTGCCCAAGGTGCCATGG - Intergenic
1033279891 7:139998503-139998525 GTGACTTGTCCCAGGTCGCACGG - Intronic
1033681252 7:143598660-143598682 GGAACTCGGCCAAGGTGGAGCGG - Intergenic
1033703639 7:143863153-143863175 GGAACTCGGCCAAGGTGGAGCGG + Exonic
1034450002 7:151132200-151132222 GGGGCCTTGCCAAGGTGGCTGGG - Intronic
1035372857 7:158390547-158390569 GGGCCTCGGCCAAGGTAGGAGGG + Intronic
1036767042 8:11555884-11555906 GTGACTTGGCCAAAGTCCCACGG - Intronic
1037736399 8:21570279-21570301 GGTACTTGGCCTGGGGGGCAGGG + Intergenic
1037758848 8:21728718-21728740 GGGACTTGCCCAAGGTCACATGG - Intronic
1038143811 8:24875285-24875307 GGGACTTGGAAAGGGTGGGAGGG + Intergenic
1039514175 8:38117864-38117886 GGGGCTTTGCCATGGTGGCCAGG - Intronic
1039897547 8:41726878-41726900 GAGACTTGTCCAAGGGTGCATGG + Intronic
1040011376 8:42663875-42663897 GGGACTTGGCTCTGGGGGCAGGG + Intergenic
1040798527 8:51315133-51315155 GGGACTTTGCCATGTTGGCCAGG + Intergenic
1040930948 8:52734687-52734709 GGGACTTCGCCATGTTGGCCAGG + Intronic
1041313303 8:56537964-56537986 GGGCCTTGTCAAAGGGGGCATGG + Intergenic
1041744856 8:61197709-61197731 GGGATTTGGCCATGTTGGCCAGG + Intronic
1042357766 8:67847845-67847867 GGGATTTCGCCATGTTGGCAAGG + Intergenic
1042568288 8:70134832-70134854 GGGCCTTGACCAAAGTGGGACGG - Intronic
1044759710 8:95505316-95505338 GCAACTTGGCCAAGGTCACATGG + Intergenic
1045527516 8:102953988-102954010 GGGGCTTTGCCATGTTGGCAAGG + Intronic
1046857522 8:119050024-119050046 GTGACTTGTCCAAGGTTTCATGG - Intronic
1048006675 8:130425138-130425160 GGGATTTGGCCATGTTGGCCAGG - Intronic
1049061322 8:140278295-140278317 GGGATTTGGCCATGTTGGCCAGG + Intronic
1049640400 8:143712612-143712634 GGTACCTGGCCATGGGGGCAGGG - Intronic
1050549477 9:6736857-6736879 GGGGTTTGGCCATGGTGGCCCGG - Intronic
1051841693 9:21405063-21405085 GGGACTGGGCCAAGATGCCAGGG + Intergenic
1052338383 9:27341772-27341794 GTGACTTGCCCAAGGTTACATGG + Intronic
1053166334 9:35846416-35846438 GGGACTTGGCGGGGGTGGCCCGG + Intronic
1053308039 9:36997538-36997560 GAGACTTGGCAAAGCAGGCAGGG - Intronic
1053384689 9:37677577-37677599 GGAACTTGTCCAAGGATGCAAGG + Intronic
1054924478 9:70575739-70575761 GTAACTTGCCCAAGGTCGCAGGG + Intronic
1055657378 9:78464866-78464888 GTGACTTGACCAAGGTCACAGGG + Intergenic
1055924432 9:81495310-81495332 GGAACTTGGCTCATGTGGCAAGG - Intergenic
1056091218 9:83207797-83207819 GGGATTTCGCCATGTTGGCAAGG + Intergenic
1056626841 9:88260734-88260756 GGGAATGGCCCCAGGTGGCACGG + Intergenic
1056642344 9:88382326-88382348 GGAACTTGCCCAAGCTGGTATGG + Intergenic
1056808274 9:89745140-89745162 GGGGATTGGCCAAGGTAGAAAGG - Intergenic
1057589603 9:96360932-96360954 GGGATTTTGCCATGGTGGCCAGG + Intronic
1057802600 9:98199259-98199281 GGGACATGTCCAAGGTCACATGG + Exonic
1057910990 9:99020644-99020666 GGGACTTGGCCACGGTCACCAGG - Intronic
1058270707 9:102968191-102968213 TGGAGGGGGCCAAGGTGGCAGGG + Intergenic
1059459210 9:114419186-114419208 GCAACTTGCCCAAGGTTGCATGG - Intronic
1059495523 9:114705993-114706015 GTGACTTGGCCAAGCTCGCATGG + Intergenic
1059522458 9:114956530-114956552 GGGACTTTGCCATGTTGGCCAGG + Intergenic
1060025424 9:120166668-120166690 GTGACTTGGCCAAGGTCACAGGG - Intergenic
1060107905 9:120885719-120885741 GGGACCTGACAAAAGTGGCATGG - Intronic
1060440021 9:123629621-123629643 GTGACTTGCCCAAGATGGTAGGG + Intronic
1060992220 9:127855743-127855765 GGGCCTTGTCCAAGGTCTCATGG - Intergenic
1061245477 9:129399350-129399372 GGGATTTTGCCAAGGTGACGGGG - Intergenic
1061268725 9:129524110-129524132 GGGACTTGCTCAAGGTCACAAGG - Intergenic
1061600742 9:131668523-131668545 GGACCTTGGCCAAGGTCACAGGG + Intronic
1061710949 9:132487245-132487267 GGGACTTACCCAAGGTCACACGG + Intronic
1062101934 9:134733025-134733047 GGCACTTGGACAACATGGCAGGG - Intronic
1062335199 9:136061926-136061948 GGGATTTCGCCATGGTGGCCAGG - Intronic
1062373796 9:136253101-136253123 GGGTCTTGGCCAAGCAGGCTCGG + Intergenic
1186551496 X:10510637-10510659 GGGATTTCGCCAAGTTGGCCAGG - Intronic
1187670794 X:21664431-21664453 GGAACTTGTCCAAGGTGCCATGG + Intergenic
1187958294 X:24542419-24542441 AGGAGTTTGCCAAGGTGGCATGG + Intergenic
1188970306 X:36607222-36607244 GAGAATTGGCCAAGGTGGGGTGG - Intergenic
1188974384 X:36655831-36655853 GGGATTTTGCCATGTTGGCAAGG - Intergenic
1189234107 X:39474576-39474598 GGAACTGGGACAAGGTGGTAGGG + Intergenic
1189947132 X:46190957-46190979 TTTTCTTGGCCAAGGTGGCATGG - Intergenic
1190145653 X:47889531-47889553 GGGGCAGGGCCAAGGTTGCAGGG + Intronic
1195129749 X:101840573-101840595 GGGAGTTGGGCAAGGTGAAAGGG - Exonic
1195176487 X:102319250-102319272 GGGAGTTGGGCAAGGTGAAAGGG + Exonic
1195182377 X:102367843-102367865 GGGAGTTGGGCAAGGTGAAAGGG - Exonic
1195202358 X:102563950-102563972 GGGAGTTGGGCAAGGTGAAAGGG + Intergenic
1195725828 X:107915363-107915385 GGGATTTTGCCAAGTTGGCCAGG - Intronic
1195782237 X:108479050-108479072 GGGCCCTGGCCATGGTGGCAGGG - Intronic
1196814088 X:119651342-119651364 GGGACTTGGCGAAAGTGCCAAGG - Intronic
1196908348 X:120460757-120460779 GGGATTTGGCCATGGTGGCCAGG - Intronic
1198379160 X:136068105-136068127 GGGAGATGGCCAAACTGGCATGG + Intergenic
1199716051 X:150508046-150508068 ATGACTTGCCCAAGGTGACACGG - Intronic
1199815381 X:151392511-151392533 GGGACTTGCCCATGGAGTCAAGG - Intergenic