ID: 928254152

View in Genome Browser
Species Human (GRCh38)
Location 2:29707430-29707452
Sequence CAGGGAAAACAGAACAAGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 745
Summary {0: 1, 1: 0, 2: 2, 3: 47, 4: 695}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
928254142_928254152 21 Left 928254142 2:29707386-29707408 CCAGTTGGGGGATGAACTTGCCC 0: 1
1: 0
2: 0
3: 4
4: 63
Right 928254152 2:29707430-29707452 CAGGGAAAACAGAACAAGGGAGG 0: 1
1: 0
2: 2
3: 47
4: 695
928254144_928254152 1 Left 928254144 2:29707406-29707428 CCCATACCTAACTCTAAGAGGCC 0: 1
1: 0
2: 0
3: 5
4: 59
Right 928254152 2:29707430-29707452 CAGGGAAAACAGAACAAGGGAGG 0: 1
1: 0
2: 2
3: 47
4: 695
928254147_928254152 -5 Left 928254147 2:29707412-29707434 CCTAACTCTAAGAGGCCTCAGGG 0: 1
1: 0
2: 1
3: 15
4: 177
Right 928254152 2:29707430-29707452 CAGGGAAAACAGAACAAGGGAGG 0: 1
1: 0
2: 2
3: 47
4: 695
928254141_928254152 26 Left 928254141 2:29707381-29707403 CCAGTCCAGTTGGGGGATGAACT 0: 1
1: 0
2: 1
3: 5
4: 66
Right 928254152 2:29707430-29707452 CAGGGAAAACAGAACAAGGGAGG 0: 1
1: 0
2: 2
3: 47
4: 695
928254140_928254152 27 Left 928254140 2:29707380-29707402 CCCAGTCCAGTTGGGGGATGAAC 0: 1
1: 0
2: 0
3: 8
4: 59
Right 928254152 2:29707430-29707452 CAGGGAAAACAGAACAAGGGAGG 0: 1
1: 0
2: 2
3: 47
4: 695
928254145_928254152 0 Left 928254145 2:29707407-29707429 CCATACCTAACTCTAAGAGGCCT 0: 1
1: 0
2: 0
3: 8
4: 134
Right 928254152 2:29707430-29707452 CAGGGAAAACAGAACAAGGGAGG 0: 1
1: 0
2: 2
3: 47
4: 695

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
928254152 Original CRISPR CAGGGAAAACAGAACAAGGG AGG Intronic
901002816 1:6157096-6157118 CAGGGAAGGAAGAAGAAGGGTGG - Intronic
901031517 1:6309906-6309928 CAGGGAAGGCAGCACATGGGAGG - Intronic
901101284 1:6721025-6721047 CTGGGAAAACAGAACTAAGGTGG - Intergenic
901598208 1:10401629-10401651 CAGAGAAAACTGAAAAATGGTGG + Intronic
901826973 1:11868445-11868467 CAGGGTCAACAGGGCAAGGGAGG - Intergenic
901827747 1:11873538-11873560 CAGGGTCAACAGGTCAAGGGAGG - Intergenic
903561852 1:24233950-24233972 CAGGAAAAAGAGAGCAAGGGGGG + Intergenic
903642696 1:24870826-24870848 CAGGGACAGGATAACAAGGGAGG + Intergenic
903803872 1:25990289-25990311 AGGGGAAAACAGATCAAGGCAGG + Intronic
903918145 1:26779564-26779586 CAGGGACAACAGACCAGGAGGGG + Exonic
903918544 1:26782645-26782667 CAGGCAAAGCAGAAGCAGGGAGG - Intergenic
904324565 1:29719943-29719965 AAGGGAAAGCAGCACGAGGGTGG - Intergenic
904706565 1:32395201-32395223 GAGGGAAAAGAGATGAAGGGGGG - Intergenic
905324244 1:37139261-37139283 CAGGGAAACCAGAAGATGTGGGG + Intergenic
905394401 1:37657770-37657792 AAGGGAAGACAGAGCAAGGGAGG - Intergenic
905618617 1:39420567-39420589 CAGGGAACACTGAAAAAGGAAGG - Intronic
905809587 1:40902412-40902434 TAGGGAAGGGAGAACAAGGGAGG + Intergenic
905937476 1:41836301-41836323 CAGAGAGAGAAGAACAAGGGAGG + Intronic
907318574 1:53588492-53588514 CAGGGAAGACAGACCCAGAGAGG - Intronic
907323497 1:53620357-53620379 CAGGGTGAACAGAAAATGGGCGG + Intronic
907355725 1:53871935-53871957 CAGGGCAAACAGAACACATGAGG + Intronic
907886809 1:58599480-58599502 TAGGGAAAAAGGAACAGGGGAGG - Intergenic
908030210 1:59991043-59991065 CAGGGGAAAGAGAACAAGATGGG + Intronic
908294805 1:62703222-62703244 AATGGAAAACAGAAAAAGGCAGG - Intergenic
908450960 1:64254081-64254103 AATGGAAAACAGAAAAAGGCAGG + Intronic
908478512 1:64512970-64512992 ATGGAAAAACAGAACAAGGATGG - Intronic
908836296 1:68232308-68232330 CAAGGAGAAAAGAAAAAGGGGGG - Exonic
909170808 1:72292462-72292484 CAGGAAAAAAAAAGCAAGGGTGG - Intergenic
909178508 1:72390204-72390226 AATGGAAAACAAAAAAAGGGAGG + Intergenic
909285516 1:73811778-73811800 CAGGGAGAACAACACAAGGTGGG + Intergenic
909302597 1:74032257-74032279 TTGGGAAAACAGAACAAAGTTGG + Intronic
909659064 1:78062372-78062394 CAGAGAACACAGAAGAAGGAAGG - Intronic
910855519 1:91691210-91691232 GAGAGAAAACAGAAAAAAGGGGG + Intronic
910881907 1:91929437-91929459 CAGGGAAAACAGGGCAGGGCTGG + Intergenic
910922173 1:92359889-92359911 CAGAGAAAGCAGAAAAGGGGAGG + Intronic
911062075 1:93757333-93757355 CAGAGAAAAGAGAAAATGGGGGG - Intronic
911823089 1:102444383-102444405 AATGGAAAACAGAAAAAGGCAGG + Intergenic
911929712 1:103886370-103886392 AATGGAAAACAGAAAAAGGCAGG + Intergenic
912155344 1:106911845-106911867 AAGGGAAAAGAGAAGAAGGCAGG - Intergenic
912639186 1:111328671-111328693 AATGGAAAACAGAAAAAAGGAGG - Intergenic
912745388 1:112241553-112241575 CAAGGAAAATAAAACAAGGAAGG + Intergenic
912877188 1:113371734-113371756 AAGGGAAAACAGATCACGGAGGG + Intergenic
913518758 1:119626102-119626124 CAGGAAGAAAAGAGCAAGGGAGG + Exonic
913527466 1:119707778-119707800 AAGGAAAAACAGAACAAGTGTGG - Intronic
914896481 1:151679505-151679527 AAGGACAAAGAGAACAAGGGAGG + Intronic
915744199 1:158143508-158143530 AAGGGAAAACAGAAGAAGAATGG + Intergenic
915770059 1:158411709-158411731 CAGGGAAAATAGAAATAGAGTGG + Intergenic
915785044 1:158601352-158601374 CAGGGCAAAAAGAACAAAGCTGG + Intergenic
917055356 1:170975974-170975996 AATGGAAAACAGAAAAAGGCTGG - Intronic
918079128 1:181192213-181192235 CAGGGAACACAGAAGATGTGAGG - Intergenic
918187469 1:182141078-182141100 CAGGGAAAACAGCACAGAGAAGG + Intergenic
918203630 1:182290098-182290120 CAGGGAAAAAAGAGCAAATGAGG - Intergenic
919365917 1:196660591-196660613 AAGGGAAAATAGAACAGGGGCGG + Intronic
919544496 1:198897581-198897603 CAGGGAAATCATCACAAAGGAGG - Intergenic
919721327 1:200839695-200839717 CAGGGAAAAAAGCAGGAGGGAGG + Intronic
919825499 1:201500406-201500428 CAGGGAATCAAGAACATGGGCGG + Intronic
920011188 1:202868911-202868933 CAGGGAAAACAAAAAAAAGCTGG - Intergenic
920384044 1:205555174-205555196 CAGGAAAAAGAGAGCAAAGGAGG + Intergenic
920461831 1:206146407-206146429 CAGGGAAAAGAGAACTAGACAGG - Intergenic
921160184 1:212466918-212466940 CAGGGGAAGTGGAACAAGGGTGG + Intergenic
921626101 1:217379514-217379536 GAGGGCAAACAGAAGCAGGGTGG + Intergenic
922058050 1:222060619-222060641 CACTGAAAACAGCACAAAGGAGG + Intergenic
924643525 1:245856379-245856401 CAGGGAAGAGAAACCAAGGGAGG + Intronic
1062776433 10:152383-152405 AATGGAAAACAGAAAAAGGCAGG + Intronic
1063245110 10:4209556-4209578 AAGAGAAACCAGAATAAGGGTGG - Intergenic
1063362376 10:5469001-5469023 CAGGGGAAACAGACCCAGGAGGG + Intergenic
1064764206 10:18654287-18654309 CTGGAAGAACAGAAAAAGGGAGG - Intronic
1064844670 10:19638310-19638332 CAGGGAAAACAAAAGGAGGTGGG + Intronic
1064973407 10:21089047-21089069 CAGAGGAGACAGAAAAAGGGAGG + Intronic
1065241927 10:23714361-23714383 GAGGGAAAGTAGAACAGGGGAGG + Intronic
1065427666 10:25621844-25621866 AAGGGAAAACAAAAAAAGGCAGG + Intergenic
1065983989 10:30931036-30931058 CTGGGAAAACATACCAAGGGTGG + Intronic
1066647749 10:37627048-37627070 CAGAAAAAGCAGAGCAAGGGAGG - Intergenic
1067700944 10:48571516-48571538 CATAGAAATTAGAACAAGGGAGG - Intronic
1068790900 10:61030108-61030130 CAGAGATAACATGACAAGGGAGG - Intergenic
1070270359 10:74948140-74948162 CAGGGAAAACAAAAGAAGTCAGG + Intronic
1070521078 10:77254177-77254199 CAAGAAAAACAGAAGATGGGAGG + Intronic
1071067045 10:81648116-81648138 GGGCAAAAACAGAACAAGGGAGG - Intergenic
1071191959 10:83111105-83111127 AATGGAAAACAGAAAAAAGGGGG + Intergenic
1071953328 10:90729338-90729360 CAGGGAAAAAAGTGAAAGGGTGG + Intergenic
1072009146 10:91288268-91288290 GAGGGAAAACAGAAGAAGAGAGG - Intergenic
1072253190 10:93597951-93597973 CATGTAAAACAGAACAAGGTAGG + Intronic
1072287504 10:93929961-93929983 AATGGAAAACAAAACAAAGGAGG + Intronic
1072436168 10:95416218-95416240 CAGGGAAAAAAGAAAGAGGAGGG + Intronic
1072715570 10:97750303-97750325 CAGGGAATGGAGAACAAGGTAGG - Intronic
1072777481 10:98213520-98213542 CAGGGGAAAAAGAACAAAAGGGG + Intronic
1073208454 10:101780799-101780821 CAGGGAAACCAGAATCCGGGTGG - Intergenic
1073381918 10:103084528-103084550 CAGGAAAAACAAACCAAGGCAGG - Exonic
1073687496 10:105771350-105771372 CAGGAAAAACAGAACAAAAGAGG + Intergenic
1074066410 10:110018578-110018600 ATGGGAAAGAAGAACAAGGGTGG + Intronic
1075984003 10:126767338-126767360 GAGGGCAAGCAGAACCAGGGTGG - Intergenic
1076327652 10:129639849-129639871 CATGGAAAACAGAAAAACAGTGG + Intronic
1077432537 11:2522911-2522933 CAGGGAAGACTGCACATGGGTGG - Intronic
1078328887 11:10402402-10402424 CAGGGAAAAAAAAAGATGGGAGG + Intronic
1078987346 11:16608409-16608431 CAGGGAGAAGACAAGAAGGGTGG + Intronic
1079628949 11:22650742-22650764 AATGGAAAACAGAAAAAGGCAGG - Intronic
1079736700 11:24006329-24006351 CAGGAAAGAGAGAACAAGGAAGG + Intergenic
1080904295 11:36525037-36525059 AAGGGAAAAAAGAACAAGGAAGG - Intronic
1082028091 11:47587192-47587214 CAGGGAGGACAGAGCAGGGGAGG - Intronic
1082028110 11:47587254-47587276 CAGGGAGGACAGAGCAGGGGAGG - Intronic
1082102970 11:48189569-48189591 AATGGAAAACAGAAAAAGGCAGG - Intergenic
1082118053 11:48348297-48348319 AATGGAAAACAGAAAAAGGCAGG + Intergenic
1082279544 11:50256981-50257003 AATGGAAAACAAAAAAAGGGAGG - Intergenic
1082718673 11:56646561-56646583 CAGGGGAGACAGAAGAAGGATGG - Intergenic
1084567978 11:69942407-69942429 CAGGGAAAACCGGCGAAGGGGGG + Intergenic
1085658284 11:78337533-78337555 CAGGGAAAAGAGAAAGAAGGTGG + Intronic
1086000757 11:81983383-81983405 CAGAGAAGACAGAAAAAAGGAGG - Intergenic
1086279984 11:85173791-85173813 AATGGAAAACAGAAAAAAGGGGG + Intronic
1086599580 11:88616466-88616488 CATGGAAAATAGAACAACAGTGG + Intronic
1086800465 11:91168374-91168396 CAGAGAATATAGAGCAAGGGAGG + Intergenic
1086955972 11:92934776-92934798 CAGGGAGAAGAGACCAGGGGCGG + Intergenic
1087187241 11:95213537-95213559 GATGCAAAAGAGAACAAGGGAGG + Intronic
1087583989 11:100094734-100094756 CAGGGAAAGAAGAAGGAGGGAGG + Intronic
1087805305 11:102548866-102548888 AAGGGAGAACAGAACAAGTTGGG + Intergenic
1088414449 11:109573221-109573243 AATGGAAAACAAAAAAAGGGAGG + Intergenic
1088506505 11:110532640-110532662 CAAGGAAAAGAGAACGAGAGTGG - Intergenic
1088791000 11:113226248-113226270 AATGGAAAACAAAACAAGGCAGG + Intronic
1089012198 11:115140396-115140418 CATGGAAAAAAGAGGAAGGGTGG - Intergenic
1089198901 11:116711478-116711500 CAGGGGGAAGAGACCAAGGGTGG - Intergenic
1089959089 11:122599835-122599857 CAGGGAAAGCAGAATGAGGAAGG - Intergenic
1090715415 11:129426344-129426366 CATGGAAAACAGATACAGGGTGG - Intronic
1091011527 11:132005754-132005776 CAGGTGAAACAGAAAATGGGAGG - Intronic
1091185491 11:133642978-133643000 AAGGGAAAACAAAAAAAGGCAGG + Intergenic
1091861761 12:3791761-3791783 AAGGGAAAAATGAACAAGGAAGG - Intronic
1092629031 12:10358826-10358848 GAGGGCAAACAGAAGCAGGGTGG - Intergenic
1092678338 12:10947453-10947475 AATGGAAAACAGAAAAAAGGGGG - Intronic
1093115219 12:15201210-15201232 CATGGAAGAGAGGACAAGGGAGG + Intronic
1093662802 12:21776026-21776048 AAGGTAAAATAGAACAATGGCGG - Intergenic
1093929210 12:24938048-24938070 ATGGGAAAACAGCACATGGGAGG + Intronic
1094039831 12:26111059-26111081 GGGGGAAAACAGGACAAGGAAGG + Intergenic
1094069942 12:26402093-26402115 CAAGGAAGCCAGACCAAGGGTGG + Intronic
1094210576 12:27885756-27885778 CTGGGAACAAAGAAGAAGGGTGG - Intergenic
1094635913 12:32227117-32227139 GAGCAAAAATAGAACAAGGGGGG + Intronic
1094694826 12:32808121-32808143 CAGGGAGAACAGAACCAAGTTGG - Intronic
1094846675 12:34364401-34364423 GAAGGAAAACAGAAACAGGGAGG - Intergenic
1095066941 12:37789209-37789231 AATGGAAAACAGAAAAAGGCAGG + Intergenic
1095089853 12:38093632-38093654 AATGGAAAACAGAAAAAGGCAGG + Intergenic
1095534565 12:43229905-43229927 AAGGGAAAACAAAAAAAGGCAGG + Intergenic
1095639617 12:44472813-44472835 AATGGAAAACAGAAAAAGGCAGG - Intergenic
1095718382 12:45373029-45373051 AATGGAAAACAGAAAAAGGCAGG + Intronic
1096705036 12:53415405-53415427 CAGGGAAAGGAAAAGAAGGGGGG + Intronic
1096760010 12:53833570-53833592 CAAGGAAAAGAGAACAAGGTTGG + Intergenic
1096787288 12:54024481-54024503 CAGGGAGAACACAACTAAGGAGG + Intronic
1097282643 12:57854200-57854222 CAGGGAAAACAGAGGAGGAGGGG + Intergenic
1097357992 12:58623446-58623468 TAGGGGAAACAGAACAATGAAGG - Intronic
1097583208 12:61483381-61483403 AATGGAAAACAGAAAAAAGGAGG + Intergenic
1098004322 12:65979527-65979549 AATGGAAAACAGAAAAAGGCAGG + Intergenic
1098524587 12:71471995-71472017 CAGGGAAAAGGGTAGAAGGGCGG + Intronic
1098738873 12:74144892-74144914 CAGTTAAAACAGAAGAAAGGAGG - Intergenic
1098839760 12:75464934-75464956 AATGGAAAACAGAACAAAGCAGG - Intergenic
1099107809 12:78518769-78518791 GAGGGCAAACAGAAGCAGGGTGG + Intergenic
1099223119 12:79937083-79937105 CAGGGAAAAAACAACCAAGGAGG + Intergenic
1099357922 12:81661366-81661388 AATGGAAAACAGAAAAAGGCAGG + Intronic
1099538369 12:83873264-83873286 AATGGAAAACAGAAAAAGGCAGG + Intergenic
1100482921 12:94996517-94996539 AAGGGAGAACAGAAGAAAGGAGG + Intronic
1100564443 12:95781791-95781813 GAGAGAAAACAAAACAGGGGAGG - Intronic
1100653174 12:96612707-96612729 CATGGAAAACATAAAAAGGAAGG + Intronic
1100902765 12:99261672-99261694 CAGGGAGAAAAGGACAAGTGAGG - Intronic
1101145728 12:101838867-101838889 CAGAGCAAACAGAATAAGGGGGG - Intergenic
1101157114 12:101938358-101938380 AATGGAAAACAGATAAAGGGAGG - Intronic
1101205642 12:102484324-102484346 TAGGGAAAACAGAAATAGGGAGG + Intergenic
1101524654 12:105517687-105517709 AATGGAAAACAGAAAAAGGCAGG - Intergenic
1101622278 12:106400151-106400173 AATGGAAAACAGAAAAAGGCAGG + Intronic
1101625321 12:106434955-106434977 CAGGTAAAATAAATCAAGGGAGG + Intronic
1102487440 12:113267850-113267872 CAGGGCAAACAGCTCCAGGGTGG - Exonic
1102542735 12:113634461-113634483 CAGGAAAAACTGGAAAAGGGGGG - Intergenic
1104332136 12:127856818-127856840 CTGGGAAAACACAAGGAGGGAGG + Intergenic
1104352901 12:128060097-128060119 CAGAGAAAACAAAACAGAGGAGG - Intergenic
1104472467 12:129041373-129041395 AATGGAAAACAGAAAAAGGCAGG - Intergenic
1105008904 12:132741222-132741244 AAGGGATAACAGAAAAAAGGTGG + Intronic
1105232095 13:18505778-18505800 AATGGAAAACAAAAAAAGGGAGG + Intergenic
1105580604 13:21692284-21692306 CATGGAAAACGAAAGAAGGGGGG - Intronic
1105875781 13:24552233-24552255 AATGGAAAACAAAAAAAGGGAGG - Intergenic
1106044788 13:26128942-26128964 CAGGGACAACAGCACAAAGTAGG + Intergenic
1107558348 13:41538568-41538590 AATGGAAAACAGAAAAAGGCAGG - Intergenic
1107696072 13:43001611-43001633 AAGTGAAAAGAGAACAGGGGTGG + Intergenic
1108108225 13:47036611-47036633 AAGGACAAACAGAACAAGAGAGG - Intergenic
1108306128 13:49135296-49135318 AAGTGAAAAAACAACAAGGGAGG - Intronic
1108445660 13:50506860-50506882 AATGGAAAACAAAACAAGGCAGG - Intronic
1108547775 13:51513526-51513548 AATGGAAAACAAAACAAGGCAGG - Intergenic
1108553462 13:51569323-51569345 AATGGAAAACAAAACAAGGCAGG + Intergenic
1108561863 13:51652228-51652250 AATGGAAAACAAAACAAGGCAGG - Intronic
1108628536 13:52256614-52256636 AATGGAAAACAAAACAAGGCAGG + Intergenic
1108657522 13:52549835-52549857 CATGGAAAACAAAACAAGGCAGG - Intergenic
1108887095 13:55199961-55199983 CAGCTAAAACAGTGCAAGGGAGG + Intergenic
1108940719 13:55949185-55949207 CAGGGAGAACAGAACCAAGTTGG + Intergenic
1109738379 13:66518172-66518194 CAGGAAAAACAGAGGAGGGGAGG + Intronic
1110843649 13:80170216-80170238 CTGGGGAAAGAGAACAAGAGAGG + Intergenic
1110895873 13:80752103-80752125 CATGGAAACTAGAACAATGGAGG + Intergenic
1111123667 13:83884389-83884411 CAAGGAAAACAGAAAAATGCTGG + Intergenic
1111641771 13:90978607-90978629 CAGGGAGAATAGAACAAAGTTGG + Intergenic
1111856040 13:93639125-93639147 CAGGGAAAATAAAGCAAGGAGGG + Intronic
1112298035 13:98205848-98205870 CAGGAAATAAAGAATAAGGGTGG - Intronic
1113267389 13:108634482-108634504 GAGGGAAGAGAGAACAAGGGGGG - Intronic
1113296449 13:108964189-108964211 CAAGGAAAAAAGAGCAAGGGTGG - Intronic
1115131532 14:30057762-30057784 CTGAGAAAACAGAAGAAAGGGGG + Intronic
1116123737 14:40755110-40755132 AATGGAAAACAGAAAAAAGGAGG - Intergenic
1116517490 14:45818859-45818881 GAGGAAAAATATAACAAGGGGGG + Intergenic
1116671441 14:47847332-47847354 CAGGGAGAACAGAACCAAGTTGG + Intergenic
1116922315 14:50592477-50592499 CAGGGTAAACAGAAGGAGGAAGG + Intronic
1116984899 14:51208011-51208033 GAGGGAAAGGAGAAGAAGGGAGG - Intergenic
1117186992 14:53249909-53249931 CAGGCAAGAGAGAACAAGAGCGG - Intergenic
1117481375 14:56148666-56148688 CAGAGAACACAGAAGAAAGGAGG - Intronic
1117644490 14:57837321-57837343 CAGCGAAAAGAGCAGAAGGGAGG + Intronic
1118096038 14:62538008-62538030 CATGGAAAACAAAAAAAGGCAGG + Intergenic
1118104174 14:62638860-62638882 CATGGAAAACAAAAAAAGGCAGG + Intergenic
1118544869 14:66874801-66874823 CAGGGAGAACAGAACCAAGTTGG + Intronic
1119246145 14:73110179-73110201 CAGGGAAAAAAAAAAAAGGCCGG - Intronic
1120327618 14:83050508-83050530 AAAGGAAGACAGCACAAGGGAGG - Intergenic
1120349640 14:83338468-83338490 TAACGAAAATAGAACAAGGGTGG + Intergenic
1121091783 14:91187986-91188008 CAGGGAAAACATAAGAGGGAAGG - Intronic
1121216527 14:92252815-92252837 GAGAGAAAACAGAAGAAGGAGGG + Intergenic
1121299099 14:92855106-92855128 AATGGAAAACAGAAAAAGGCAGG + Intergenic
1121320861 14:92990941-92990963 CAGGGAAAACAGAGCTGGTGGGG - Intronic
1121561538 14:94879913-94879935 CACTGACATCAGAACAAGGGAGG + Intergenic
1122409105 14:101517039-101517061 AAGGGGAAACAGAAGAAGGGAGG + Intergenic
1122917935 14:104867354-104867376 CAGGGAACACAGAGGCAGGGCGG - Intronic
1123116630 14:105897775-105897797 CAGGGTAAACAGAAAATGAGAGG - Intergenic
1124078054 15:26464415-26464437 AATGGAAAACAGAAAAAGGCAGG + Intergenic
1124084119 15:26531195-26531217 CAGGGCAAGCAGAAACAGGGTGG + Intergenic
1124841495 15:33246019-33246041 CATGGAAAACAAAATAAGGCTGG - Intergenic
1125306205 15:38318577-38318599 CAGGGGAAAGAGAAGGAGGGAGG - Intronic
1125392963 15:39214858-39214880 TAGGGAAAAATAAACAAGGGAGG - Intergenic
1125614631 15:40999507-40999529 CATGGATAACAGACCACGGGTGG + Intronic
1125729022 15:41882495-41882517 CAGTGAAGGCAGAACAGGGGAGG + Intronic
1125891328 15:43269187-43269209 CAGTGAAGGCAGAGCAAGGGGGG - Intergenic
1126036502 15:44551061-44551083 CAGGGAAAACAGAATAAAGTGGG - Intronic
1126398252 15:48242320-48242342 CAGGGAAAACAGCTCCAGGCTGG + Intronic
1126740871 15:51774997-51775019 TAGGGAACACAGGACGAGGGAGG - Intronic
1127297357 15:57620467-57620489 TAGGGATACCAGAAGAAGGGAGG + Intronic
1127471147 15:59291533-59291555 CAGCAAAAAGAGAACAAAGGTGG + Intronic
1127608063 15:60609907-60609929 CAATGAAAACAGAAGCAGGGAGG + Intronic
1127689677 15:61383075-61383097 AAAGGAAAACAGAACAGGAGGGG - Intergenic
1127693607 15:61422050-61422072 CAGGGAAAGCCTAACAAAGGAGG - Intergenic
1128056029 15:64700756-64700778 TAGGGTAAAGAGAACATGGGAGG + Intronic
1128524023 15:68398319-68398341 AATGGAAAACAGAAAAAGGCAGG + Intronic
1129016225 15:72471652-72471674 CAGAGAAAGCAGATCAAGGTAGG - Intergenic
1129648416 15:77460408-77460430 TGGGGAAAACTGAACAAGTGTGG + Intronic
1130330523 15:82918656-82918678 CAGGGAGAACAGCAGCAGGGAGG - Intronic
1130397569 15:83516602-83516624 ATGGCAAAGCAGAACAAGGGTGG + Intronic
1130662832 15:85844051-85844073 CAGAGAAGACAGCATAAGGGAGG + Intergenic
1131077600 15:89505446-89505468 CAGGGCAAACGGTTCAAGGGAGG + Intergenic
1132287809 15:100678162-100678184 CAGGGAGAACAGAACCAAGTTGG - Intergenic
1132758161 16:1495998-1496020 CAGGGAAAACAGAGCGAGCATGG - Intronic
1133124026 16:3633215-3633237 CAGAGAAAGCAGAAAAAGAGTGG - Intronic
1133217875 16:4304390-4304412 CAGGGAAAGGAAAACAAGGCAGG + Intergenic
1134140125 16:11711212-11711234 CAGAGAAAACAGAGTAAGGGTGG + Intronic
1135200192 16:20430644-20430666 TAGGGAACAAAGAAGAAGGGAGG + Intronic
1135218498 16:20592965-20592987 TAGGGAACAAAGAAGAAGGGAGG - Intergenic
1135560750 16:23474862-23474884 CAGGGAAAAAAAAAAAAAGGTGG + Intronic
1137681089 16:50345586-50345608 AATGGAAAACAGAAAAAGGCAGG + Intronic
1137720458 16:50624776-50624798 CAGAGGCAACGGAACAAGGGAGG - Intronic
1138533887 16:57649559-57649581 GAGGGAACACAGAAAAAAGGGGG - Intronic
1139283810 16:65792794-65792816 CAGGGAAGACAGAGCAAGCAAGG + Intergenic
1141120581 16:81352242-81352264 GAGGGAAGAGAGAATAAGGGTGG - Intronic
1141202852 16:81910920-81910942 AAGGGAAAAGAGAAAAGGGGAGG - Intronic
1141433006 16:83980610-83980632 CCGAGAAAACAGAACAAGGGTGG + Intronic
1141685339 16:85566824-85566846 CAGGGAACATAAAAGAAGGGAGG + Intergenic
1141884138 16:86880238-86880260 GAGGAAAAAGAGAAGAAGGGAGG + Intergenic
1142033698 16:87851174-87851196 CATGGAAAACAAAACAAACGTGG - Intronic
1142497960 17:316392-316414 CAGGGACTACAGGACAATGGAGG - Intronic
1142935106 17:3323190-3323212 AATGGAAAACAGAAAAAGGCAGG - Intergenic
1143071576 17:4299764-4299786 CAGGTAAAATAGAAGAAGAGGGG - Intronic
1144553948 17:16265450-16265472 CAGGGAAACCAGACCAGGCGCGG + Intronic
1145284867 17:21497929-21497951 GAGGGAGAACTGAAGAAGGGTGG + Intergenic
1145396559 17:22500773-22500795 AATGGAAAACAGAAAAAGGCGGG - Intergenic
1145823275 17:27857086-27857108 CAGGAAAAGCAGAACAAAGCGGG + Intronic
1146438290 17:32871936-32871958 CAGAGAAAGCAGAACATGGTAGG + Intronic
1147039186 17:37704374-37704396 CAGTGAAAATACACCAAGGGAGG - Intronic
1147586466 17:41656193-41656215 CAGGGAGGACAAAACAAAGGAGG - Intergenic
1148688687 17:49514493-49514515 CAGGCAAAACAGAACAGGCCAGG - Exonic
1148746501 17:49921087-49921109 CAGGGAAAGGAGATCAAGGTGGG + Intergenic
1148748240 17:49930332-49930354 TAGGGAAAGCAGCACAGGGGCGG + Intergenic
1149268545 17:54953394-54953416 CAGGTTACACAGAAGAAGGGGGG - Intronic
1149456045 17:56789446-56789468 CAGGGTACATGGAACAAGGGTGG - Intergenic
1149513638 17:57263278-57263300 AAGGGAGAAGAGAACAAGGAGGG - Intronic
1153439408 18:5100297-5100319 CTGGCAAAACAGATTAAGGGAGG + Intergenic
1154180891 18:12138867-12138889 AATGGAAAACAAAAAAAGGGAGG - Intergenic
1154204806 18:12327394-12327416 CTGGGATCACAGACCAAGGGTGG - Intronic
1157251147 18:46097409-46097431 CAAGTAAAAGAGAACAAGGTTGG - Intronic
1157422303 18:47557303-47557325 CAGGGAACACAGGATAAGGTGGG - Intergenic
1157938709 18:51902141-51902163 GTGGGGAAAGAGAACAAGGGAGG - Intergenic
1157990340 18:52488160-52488182 CTGGGAAAACAAAACAGTGGTGG - Intronic
1158151929 18:54383236-54383258 CAGGGGAAACAGAACATATGTGG - Intronic
1158153873 18:54403558-54403580 AATGGAAAACAGAAAAAGGAAGG - Intergenic
1158295862 18:55996345-55996367 CAGGGAAGACAGACCAGAGGAGG - Intergenic
1158980663 18:62757752-62757774 ACTGGAAAACAGCACAAGGGTGG - Intronic
1159048642 18:63395818-63395840 CAGACAAAACAGAACACAGGAGG + Intronic
1159060631 18:63510522-63510544 CAGGAAAATGAGAACAAGTGAGG + Intergenic
1159855027 18:73576244-73576266 CAGAGCAAACAGAACAAGGCTGG - Intergenic
1163189771 19:15669246-15669268 CAGGGACAAAAGAAGAAGGAAGG + Intergenic
1163246723 19:16100179-16100201 CGGGGAAAACAGACCTAGGAAGG + Intronic
1163265349 19:16217451-16217473 CAGGCAAAACTGCACAGGGGAGG + Intronic
1164743578 19:30594731-30594753 CAGGGGAAACAGGAGAAGAGTGG - Intronic
1165281600 19:34802877-34802899 AAGGAAAAACTGAAGAAGGGAGG + Intergenic
1165499762 19:36179194-36179216 CAGGGAAAACAGATCACGTGAGG - Intergenic
1165986015 19:39769598-39769620 CAGGAAATCCAGAAAAAGGGTGG + Intergenic
1166178814 19:41092809-41092831 CAGGGAGAAAGGATCAAGGGAGG + Intronic
1166365939 19:42278554-42278576 CAGCCAAAACAGAAAGAGGGTGG - Intronic
1167123390 19:47532468-47532490 GAAGGAAAACAGAGGAAGGGAGG - Intronic
1167303615 19:48694600-48694622 CAAGGAAAAAAGAAACAGGGTGG - Intergenic
925257348 2:2501425-2501447 CAGGGAAAAAAGAACATTGCTGG - Intergenic
925442086 2:3897277-3897299 AATGGAAAACAGAAAAAAGGAGG - Intergenic
925442167 2:3898045-3898067 CAGGGAGAACAGAACCAAGTTGG - Intergenic
925790093 2:7475861-7475883 AAGGGAAAACAGAATAACAGAGG + Intergenic
926607643 2:14913691-14913713 CAGGGGAAACAGAACCAGCTTGG + Intergenic
926935388 2:18082618-18082640 CAGGGAACAAGGAACAAGGAAGG - Intronic
926975052 2:18506429-18506451 GAGGGAAAAAAGAAAAAGAGGGG - Intergenic
928064649 2:28151270-28151292 CTAGGAAAAAAGAACAAAGGAGG + Intronic
928254152 2:29707430-29707452 CAGGGAAAACAGAACAAGGGAGG + Intronic
929861260 2:45679790-45679812 GAGGGAACACAGAAGAAGGAAGG - Intronic
930326458 2:49925845-49925867 CAAGTAAAAGAGAATAAGGGAGG + Intronic
930801213 2:55444407-55444429 AATGGAAAACAGAAAAAGGCAGG + Intergenic
930860422 2:56065844-56065866 GAGGGAAAACAGAAGCAGAGTGG - Intergenic
931130361 2:59328611-59328633 AATGGAAAACAGAAAAAGGCAGG + Intergenic
931194414 2:60037166-60037188 AATGGAAAACAGAAAAAGGCAGG + Intergenic
931784987 2:65610562-65610584 CAGGGAAGACAGACAAATGGAGG - Intergenic
931942956 2:67273241-67273263 AATGGAAAAGAGGACAAGGGAGG - Intergenic
932935186 2:76094472-76094494 AATGGAAAACAAAAAAAGGGAGG - Intergenic
933555805 2:83829018-83829040 AAGGAAAAACAAAACAATGGAGG - Intergenic
933768243 2:85725708-85725730 CAGGGAAAGGAAAACAAGGAAGG + Intergenic
933919487 2:87030320-87030342 CAGGTAAATCAGCACGAGGGAGG + Intergenic
934003507 2:87739587-87739609 CAGGTAAATCAGCACGAGGGAGG - Intergenic
935400320 2:102653601-102653623 CAGGGAAAAGAGAGAAAGGAAGG - Intronic
935566091 2:104608860-104608882 CAGGGAAAATAGAACCAAGTTGG + Intergenic
935937914 2:108206959-108206981 AATGGAAAACAGAAAAAGGCAGG - Intergenic
936068368 2:109348977-109348999 CAGGCAAGACAGAACGAGTGAGG - Intronic
936553785 2:113475313-113475335 AATGGAAAACAAAACAAGGCAGG - Intronic
936873239 2:117158204-117158226 AATGGAAAACAAAAAAAGGGAGG + Intergenic
936942338 2:117898284-117898306 AAGGGAAAACAAAAAAAGGCAGG + Intergenic
937489406 2:122350113-122350135 AATGGAAAACAGAAGAAGGCAGG - Intergenic
937507459 2:122552983-122553005 AATGGAAAACAGAAAAAGGCAGG + Intergenic
940272526 2:151907168-151907190 TAGGGAAAACAGAACAAGCAAGG + Intronic
940492799 2:154386287-154386309 GTGGGAAAACAGAATAAGGGAGG + Intronic
940819103 2:158331830-158331852 AATGGAAAACAGAAAAAGGCAGG - Intronic
941404026 2:165066689-165066711 TAGAGAAAACAGAAAAAGGAAGG + Intergenic
941730239 2:168909222-168909244 CAGGGACAACAGAACAGGCCAGG + Intronic
942377562 2:175353070-175353092 CAGTCAAAACAGAACAGGGAGGG - Intergenic
942527922 2:176875320-176875342 CAGGGACACCAAAGCAAGGGAGG + Intergenic
942755491 2:179336698-179336720 CCAGGAAAACAGAACAAAGTTGG - Intergenic
942790494 2:179755756-179755778 AATGGAAAACAGAAAAAGGCAGG - Intronic
942976854 2:182029036-182029058 AAGGGAAAACAAAAAAAGGCAGG - Intronic
943852891 2:192750258-192750280 CAGGGAAAACATATAAAGGCTGG - Intergenic
945024180 2:205604804-205604826 CAGCGAAAACAGAACCACGTTGG - Intronic
945482287 2:210357986-210358008 GAGGGCAAACAGAAGCAGGGTGG - Intergenic
945521929 2:210838435-210838457 CAGGAAAAAAAAAAAAAGGGAGG - Intergenic
945870653 2:215222553-215222575 AAAGGAAAACAGAAAAAGGCAGG + Intergenic
945965751 2:216184881-216184903 CAGGGCATACAGAAGAAGGGAGG - Intronic
945991683 2:216400838-216400860 CAGGGAATACAGAATCAGGAAGG - Intergenic
946157436 2:217816252-217816274 CAAAGAAAACACAAAAAGGGAGG + Intronic
946185245 2:217977225-217977247 CTGGATAAACAGAACAAGGAGGG + Intronic
946252380 2:218421521-218421543 CAGGGAAGACAGGAGAAGTGAGG + Intronic
946431704 2:219629866-219629888 CAAGGAGGAGAGAACAAGGGGGG + Intronic
946488040 2:220119844-220119866 CAGAAAAAACAGAACAAGATGGG - Intergenic
947771460 2:232673601-232673623 CAGGGAAAGCAGCCCAGGGGAGG - Intronic
947776426 2:232714700-232714722 CACAGAAAACAGAACAGTGGTGG - Intronic
947880909 2:233510937-233510959 GAGGGAAAACATGACAAGTGAGG - Intronic
948738647 2:240027454-240027476 GAGGGAAAACGGAAAAAGGGGGG - Intergenic
1169391197 20:5192669-5192691 CAGGGAATTCACGACAAGGGAGG - Exonic
1169595291 20:7191637-7191659 CAGGTAAACCAGAACAAGGCAGG + Intergenic
1169714329 20:8598924-8598946 CATGGAAAACAAAAAAAGGCAGG - Intronic
1169720249 20:8668162-8668184 CAGGGAAACCAGATTAAGTGAGG + Intronic
1169913367 20:10665182-10665204 AAGGAAAAAGAGAAAAAGGGAGG + Intronic
1170378460 20:15729712-15729734 AATGGAAAACAGAAAAAAGGAGG - Intronic
1170505841 20:17024959-17024981 CAGAGAAAGCAGAAGAAGGTGGG + Intergenic
1170597202 20:17815041-17815063 AGGGGAAAAAAGAACACGGGTGG + Intergenic
1172047406 20:32090252-32090274 AGGGGAAAACAAACCAAGGGAGG + Intronic
1172431131 20:34892799-34892821 CAGGGAACACAGTAACAGGGTGG - Intronic
1172477800 20:35252059-35252081 CAGGAAAAACAGAGTGAGGGTGG - Intronic
1172782913 20:37447783-37447805 CAGAGGAAACAGGAGAAGGGTGG - Intergenic
1173015446 20:39221104-39221126 TAGGGAAAGAAGAACAGGGGAGG + Intergenic
1173219653 20:41121562-41121584 CAGATAAAAAAAAACAAGGGTGG - Intronic
1173522619 20:43711009-43711031 CAGGCAACAGAGAACAGGGGAGG - Intronic
1174104919 20:48155287-48155309 CAGGGAAAACAAGAAGAGGGGGG - Intergenic
1174495028 20:50933525-50933547 TAAGGGAAACAGAACAAGAGTGG + Intergenic
1175474000 20:59256346-59256368 CAAGAAAAACATAAGAAGGGAGG + Exonic
1175778872 20:61669564-61669586 GAAGGAAAACTGAAGAAGGGTGG + Intronic
1176350208 21:5787438-5787460 AATGGAAAACAGAAAAAGGCAGG + Intergenic
1176357022 21:5908022-5908044 AATGGAAAACAGAAAAAGGCAGG + Intergenic
1176544529 21:8185508-8185530 AATGGAAAACAGAAAAAGGCAGG + Intergenic
1176563480 21:8368553-8368575 AATGGAAAACAGAAAAAGGCAGG + Intergenic
1176776068 21:13134076-13134098 AATGGAAAACAAAAAAAGGGAGG + Intergenic
1176970013 21:15254103-15254125 CAGGGAAAACAGAGGAAAGGAGG + Intergenic
1177025584 21:15918405-15918427 AATGGAAAACAGAAAAAGGCAGG - Intergenic
1177282821 21:19006694-19006716 CATGGGAAACAGTACCAGGGCGG + Intergenic
1178209964 21:30518778-30518800 AAGGGAGAATAGAAAAAGGGAGG - Intergenic
1178294240 21:31395446-31395468 CAGGGAAAATTGGACAAGAGGGG + Intronic
1180575290 22:16767500-16767522 CAGGGAGAACAGAACCAAGTTGG + Intergenic
1182083206 22:27543604-27543626 CAGGGAAGAAAGAGGAAGGGAGG - Intergenic
1182173410 22:28256623-28256645 CAGGGTAAAAAGAACAAGGCTGG + Intronic
1183354829 22:37352548-37352570 CAGGGAAGACACCACAGGGGAGG + Intergenic
1183503265 22:38193977-38193999 AAGGGAAGAAAAAACAAGGGTGG + Intronic
1184080815 22:42218780-42218802 CAGGGAAAACAGATACAGGAAGG + Intronic
1184301748 22:43564970-43564992 CAGGGTGAACAGAAGCAGGGGGG - Intronic
1184304621 22:43588618-43588640 CAGAAAAAATAGAACAGGGGAGG + Intronic
1184478306 22:44733476-44733498 CAGGGCAACCAGAGCAAGGAAGG + Intronic
1184763081 22:46556338-46556360 CAGGAAAAAAAGAAAAAGGAAGG + Intergenic
1184847073 22:47094944-47094966 CTGGCAAAAGAGAACATGGGTGG + Intronic
1185006820 22:48282870-48282892 GAGGGAAAAAAGAAGGAGGGAGG + Intergenic
1185039141 22:48495557-48495579 CAGGGAAGGGAGAACAAGGATGG - Intronic
1185345161 22:50307715-50307737 CGGGGAGAACAGGAGAAGGGGGG + Intergenic
1203249399 22_KI270733v1_random:101746-101768 AATGGAAAACAGAAAAAGGCAGG + Intergenic
949131686 3:509940-509962 AAGGGAAAACAGAAAAAGCAGGG - Intergenic
949205480 3:1433175-1433197 CAGGAAAAACAGAGAGAGGGAGG - Intergenic
949609731 3:5692073-5692095 AAGGGATAACAGAACAACTGGGG - Intergenic
950485588 3:13272196-13272218 GAGGCAAAACAAAGCAAGGGTGG - Intergenic
951042481 3:18003515-18003537 AATGGAAAACAAAAAAAGGGAGG - Intronic
951499076 3:23363466-23363488 AATGGAAAACAGAAAAAAGGAGG + Intronic
951642075 3:24847435-24847457 TAAGGAAAGTAGAACAAGGGTGG - Intergenic
951861804 3:27262047-27262069 AATGGAAAACAAAAAAAGGGAGG - Intronic
952202421 3:31144828-31144850 CAGGGAAAACAGAACTAAGAGGG - Intergenic
952505317 3:34001987-34002009 CAGTGAACACAGAACTAGGCTGG - Intergenic
952546023 3:34420091-34420113 CAGGCATAACAGCAGAAGGGTGG + Intergenic
952655073 3:35776420-35776442 CAGGGAAAGCAGAGGAAGGGTGG + Intronic
952932283 3:38369543-38369565 CAGGGAACCCAGAGCATGGGTGG - Intronic
953053080 3:39363406-39363428 CAGGGAGAACAGAACCAAGTTGG + Intergenic
953081151 3:39619579-39619601 CAGGGAAAATAGAACCAAGTTGG - Intergenic
953262805 3:41356734-41356756 CAGGGAAGACAGAATCAGAGTGG + Intronic
954181598 3:48885507-48885529 CAAGAAAAACAGAACAAGGCTGG + Intronic
955329999 3:58039517-58039539 CTGGGAAAACAAGGCAAGGGGGG - Intronic
955483576 3:59413679-59413701 GAGGGAAAAGAAAAGAAGGGAGG - Intergenic
956170615 3:66430926-66430948 CAGGGAAAGGAAAACAAAGGGGG - Intronic
956201764 3:66713809-66713831 CAGGGATAACAGGACAGGAGGGG - Intergenic
956215592 3:66845101-66845123 AATGGAAAACAGAAAAAGGCAGG + Intergenic
956265900 3:67395340-67395362 AATGGAAAACAGAAAAAGGCAGG + Intronic
957427302 3:80054382-80054404 CAGGAAAAATACAACAATGGAGG - Intergenic
957776415 3:84760854-84760876 CAGGGCAAGCAGAAGCAGGGTGG + Intergenic
958569649 3:95862691-95862713 AATGGAAAACAGAAAAAGGCAGG + Intergenic
959883378 3:111472492-111472514 CAGGGAGAACAGAACCAAGATGG - Intronic
959934107 3:112012093-112012115 CAGGAGAAACAGAACCTGGGTGG - Intronic
960318557 3:116207228-116207250 AATGGAAAACAGAAAAAGGCAGG - Intronic
960339516 3:116457497-116457519 AATGGAAAACAGAAAAAGGCAGG + Intronic
961329413 3:126129888-126129910 CAGGAAATATAGAACAAAGGAGG - Intronic
962397410 3:135029049-135029071 AAGGGAAAACAAAAAAAGGCAGG - Intronic
962522754 3:136212386-136212408 AAGAGAAAACAGGACAAGGGCGG + Intergenic
962836536 3:139194469-139194491 AATGGAAAACAGAAAAAGGCAGG - Intronic
963154895 3:142086037-142086059 CAGGTGAAAAAGAACAAGGGCGG - Intronic
964178754 3:153857640-153857662 AAGGGAACACAAGACAAGGGAGG + Intergenic
964564675 3:158036444-158036466 AATGGAAAACAGAAAAAGGCAGG + Intergenic
964754376 3:160080628-160080650 CAGGGAAATAAGCCCAAGGGAGG - Intergenic
965271290 3:166619736-166619758 AATGGAAAACAGAAAAAGGCAGG + Intergenic
965456744 3:168910871-168910893 AATGGAAAACAGGAGAAGGGTGG - Intergenic
965806647 3:172548932-172548954 CAGTGAATACAGAAAAAGTGGGG + Intergenic
965910788 3:173772788-173772810 CAGTGAATACAGAAAAAGGATGG - Intronic
966774731 3:183533839-183533861 GAGGGAAAAGAGAAGAGGGGAGG - Intronic
967018828 3:185504835-185504857 CATGGAAAAGCAAACAAGGGAGG + Intergenic
967418764 3:189250836-189250858 AAGGTCAAACAGCACAAGGGAGG - Intronic
967877042 3:194274582-194274604 CAGGGAAAAGAGGACAAAAGTGG + Intergenic
967900135 3:194441613-194441635 CAGGGAAAAGAAAACCAGAGGGG + Intronic
969188151 4:5495174-5495196 CAGGGAAAACGGAACCAAGTTGG - Intronic
969481395 4:7448820-7448842 GAGGGAAAAGAGAGAAAGGGAGG - Intronic
970017189 4:11525314-11525336 CAGGGCAAAGAGGACAAGGCTGG - Intergenic
970022093 4:11581203-11581225 AAGGGAAAACAAAAAAAGGCAGG - Intergenic
970187050 4:13467697-13467719 CAGAGAAAGCAGAAAAAGAGGGG + Intronic
971867002 4:32185313-32185335 CAGGGCAAACAGAACTATGCAGG - Intergenic
972047229 4:34681702-34681724 AAAGAAAAACAGAACAAGGGTGG - Intergenic
972294248 4:37721445-37721467 CTGGGAAATGAGAATAAGGGAGG + Intergenic
973544966 4:51972323-51972345 CAGGGAGAACAGAACCAAGTTGG - Intergenic
973620450 4:52721292-52721314 CAGGGAAAACAGACTCAGGCTGG + Intergenic
973689741 4:53414543-53414565 AAAAAAAAACAGAACAAGGGGGG + Intronic
973761375 4:54119078-54119100 AAGAGAAAAAAGAACAAGTGAGG + Intronic
974192489 4:58524364-58524386 CAGGGATACCTGAAAAAGGGTGG + Intergenic
974427360 4:61758503-61758525 AATGGAAAACAGAAAAAGGCAGG - Intronic
974780576 4:66547380-66547402 AATGGAAAACAGAAAAAGGCAGG + Intergenic
974840916 4:67298802-67298824 AATGGAAAACAAAACAAGGCAGG - Intergenic
974899578 4:67980939-67980961 CAGGGAGAACAGAACCAAGTGGG - Intergenic
974978927 4:68928080-68928102 CAGGGAAGACAGAACAAACCTGG + Intergenic
976048335 4:80980328-80980350 GAGGGAATAGAGAACAAGAGAGG + Intergenic
976306137 4:83561129-83561151 TAGAGAAAACAGCACAATGGGGG + Intronic
976681818 4:87765660-87765682 TTAGGAAAACAGAACAAGAGGGG - Intergenic
976727159 4:88225880-88225902 CAGGGAAGACAGAAAATGAGAGG + Intronic
977040028 4:92003969-92003991 AATGGAAAGCAGAAAAAGGGAGG + Intergenic
977082929 4:92556062-92556084 CAGGGAAAACTGAACCACTGGGG + Intronic
977097309 4:92762619-92762641 GAGGGAAAATCGAACAAGTGGGG - Intronic
978216885 4:106215533-106215555 AAGGGAAAACAAAAAAAGGCAGG + Intronic
978244990 4:106561915-106561937 AATGGAAAACAAAAAAAGGGAGG - Intergenic
978339304 4:107705402-107705424 CAGGAGAGAGAGAACAAGGGGGG - Intronic
978957989 4:114638520-114638542 CAAGGAAAACAGATGGAGGGAGG - Intronic
979421310 4:120508953-120508975 GAGGGAAAGCAGAAGCAGGGTGG + Intergenic
979987585 4:127333983-127334005 CAGTGCAAACAGAGGAAGGGAGG - Intergenic
980141134 4:128918745-128918767 AATGGAAAACAGAACAAAGCAGG + Intronic
980512730 4:133814394-133814416 AATGGAAAACAGAAAAAAGGAGG + Intergenic
980563931 4:134512602-134512624 CAGGGAGAACAAACCAAGAGAGG + Intergenic
981273991 4:142876153-142876175 CAGGGAGAACAGAACCAAGTTGG + Intergenic
981549247 4:145926499-145926521 TATGGAATTCAGAACAAGGGTGG - Intronic
981556544 4:146001578-146001600 AATGGAAAACAGAAAAAGGCAGG - Intergenic
981607587 4:146556759-146556781 AATGGAAAACAGAAAAAGGCAGG - Intergenic
981761732 4:148202263-148202285 CCTGGAAAAAAGATCAAGGGTGG - Intronic
982106478 4:152015909-152015931 GAGGGAAAGCAGAACAGGTGGGG - Intergenic
982316386 4:154036132-154036154 AAGGGAAGAGAGAACAAAGGGGG + Intergenic
982605902 4:157515613-157515635 CAGGTAAAAACGAAGAAGGGAGG - Intergenic
982902680 4:161027106-161027128 AATGGAAAACAAAACAAGGCAGG + Intergenic
984405311 4:179321548-179321570 CAGAGAAAAAAGAAAAAGGAAGG - Intergenic
984521241 4:180803701-180803723 CATGTAAAACAGCACAAGTGTGG + Intergenic
984944878 4:184963025-184963047 CAGGGAAAACTGAAGGAGGATGG - Intergenic
986915231 5:12611741-12611763 AATGGAAAACAAAAAAAGGGAGG - Intergenic
987343145 5:16956056-16956078 CAGGGAAAAAAAAAGAGGGGGGG + Intergenic
987793077 5:22593408-22593430 CAGGGAAAACAGGAGAAAGAAGG - Intronic
988674830 5:33421635-33421657 CAGGGAAAGCAGAACAAAGATGG + Intergenic
989358568 5:40573074-40573096 CAAGAAAAACAGAACGTGGGAGG - Intergenic
989528543 5:42480711-42480733 AATGGAAAACAGAAAAAGGCAGG - Intronic
989608007 5:43264445-43264467 AATGGAAAACAGAAAAAGGCAGG - Intronic
989662177 5:43811998-43812020 CATGGAAAACAAAAAAAGGCAGG - Intergenic
989825260 5:45847646-45847668 GAGGGAGAACAGAAGCAGGGTGG + Intergenic
990239796 5:53805089-53805111 AACGGAAAACAAAAAAAGGGAGG + Intergenic
990244066 5:53845469-53845491 AAAGGAAAAAAGAACAAGGGTGG + Intergenic
990648254 5:57869186-57869208 AATGGAAAACAGAAAAAGGCAGG - Intergenic
990807941 5:59687886-59687908 CATGGAAAACAAAAAAAAGGTGG + Intronic
991037455 5:62142272-62142294 CAGAGAAAAGAAAACAAGGCAGG + Intergenic
991535397 5:67664658-67664680 CATGGAAAACAAAAAAAGGCAGG - Intergenic
992167379 5:74068005-74068027 CAGGAAAAACAGGAAAACGGGGG - Intergenic
992589333 5:78277383-78277405 CAGGAAAAAAAGGAGAAGGGAGG + Intronic
993048364 5:82895027-82895049 TAGGGAAAACAACTCAAGGGAGG - Intergenic
993839394 5:92858363-92858385 CAGATAAATCAGAACTAGGGAGG + Intergenic
994057456 5:95434348-95434370 CATGGAAAACACAAGAAGGAAGG - Intronic
994350837 5:98743852-98743874 CAGGGAGAACAGAACAAATTTGG + Intergenic
994368831 5:98946612-98946634 CTGGGAAAACAGAAAAAAGCTGG - Intergenic
994679882 5:102873266-102873288 GAGGGGAAACAGAAAAATGGTGG - Intronic
995337912 5:111023668-111023690 CAGAGGAAACAGCACACGGGTGG + Intergenic
995399212 5:111721443-111721465 CAGGGAAAAGAGAAAACAGGAGG + Intronic
996514206 5:124351556-124351578 CAGGAAAAACAGAGTAAGAGTGG + Intergenic
996673947 5:126153620-126153642 AATGGAAAACAAAAAAAGGGAGG - Intergenic
996778391 5:127157926-127157948 AATGGAAAACAGAAAAAGGAAGG - Intergenic
997065938 5:130558664-130558686 AATGGAAAACAGAAAAAGGCAGG + Intergenic
997187952 5:131900897-131900919 CAGGCAAAGCCGCACAAGGGAGG - Intronic
997283576 5:132663230-132663252 AAAGGAAGACAGAACAAGGTAGG + Intergenic
997381527 5:133441542-133441564 CACGGAGCACAGGACAAGGGAGG + Intronic
998179762 5:139928348-139928370 CTGGGAGAAGAGGACAAGGGAGG - Intronic
998241939 5:140454031-140454053 AATGGAAAACAGAAAAAGGCAGG + Intronic
999035419 5:148343500-148343522 CAGCCAAAACAGAAGTAGGGTGG - Intergenic
999410098 5:151343050-151343072 CAGGAGACACAGAACAAGGCAGG + Intronic
1000967241 5:167672790-167672812 CAAGGACAAAAGAACAAGAGTGG + Intronic
1001965910 5:175909751-175909773 CAGGAAAAAAAAAACAAGGTGGG + Intergenic
1002276588 5:178107953-178107975 CAGGGGAGAGAGGACAAGGGAGG + Intergenic
1002985823 6:2190167-2190189 CAGGGAAAAAAGAGCAAATGTGG + Intronic
1003424920 6:5992660-5992682 CAGCAACCACAGAACAAGGGCGG - Intergenic
1003726744 6:8774316-8774338 CATGGAAAACAAAAAAAGGCAGG - Intergenic
1003790704 6:9544201-9544223 CAGAGGAAACAGAAATAGGGTGG + Intergenic
1003819269 6:9877787-9877809 CTGGAAACAAAGAACAAGGGTGG + Intronic
1004049139 6:12057551-12057573 AACAGAAAACAGAACAATGGAGG - Intronic
1004242697 6:13940501-13940523 CAGGCAAGACTGATCAAGGGGGG - Intronic
1005712534 6:28515699-28515721 CAGGAAAAACAGGACAAGACAGG + Exonic
1005778437 6:29162307-29162329 GAGGGCAAGCAGAAGAAGGGTGG - Intergenic
1005779975 6:29180415-29180437 AATGGAAAACAAAAAAAGGGAGG - Intergenic
1006091373 6:31631079-31631101 CAGGAAAACCAGAACTAGGTGGG - Intronic
1007804615 6:44431350-44431372 CAGGGAAAATAGAACATCAGTGG + Intronic
1007982804 6:46176333-46176355 AAGTGAAAACAGAAAAAGGAAGG + Intergenic
1008193760 6:48493132-48493154 AATGGAAAACAGAAAAAGGCAGG - Intergenic
1008212280 6:48739526-48739548 AAGGGAAAACAAAAAAAGGCAGG + Intergenic
1008412025 6:51191487-51191509 AATGGAAAACAGAAAAAGGCAGG - Intergenic
1008624295 6:53302396-53302418 CAAGGACAACAGAACATGAGGGG + Intronic
1009695532 6:67097712-67097734 AATGGAAAACAAAAAAAGGGAGG + Intergenic
1009703655 6:67216613-67216635 AATGGAAAACAAAAAAAGGGAGG + Intergenic
1010463596 6:76141553-76141575 AATGGAAAACAGAAAAAGGCAGG - Intergenic
1010717176 6:79243208-79243230 CAGGGAAAACAGAACTGCTGGGG + Intergenic
1011012480 6:82717515-82717537 AATGGAAAACAGAAAAAGGGAGG + Intergenic
1011020784 6:82809787-82809809 GAGGGCAAACAGAAGCAGGGTGG - Intergenic
1011244654 6:85309347-85309369 AATGGAAAACAAAACAAGGCAGG + Intergenic
1011251802 6:85379502-85379524 AATGGAAAACAAAACAAGGCAGG + Intergenic
1011761810 6:90575485-90575507 CAAGGAAGACAGACCAAGGGAGG + Intronic
1012140007 6:95614874-95614896 CAGGGAAAAGAGAAGGAGGAGGG - Intergenic
1012589841 6:100967835-100967857 CATGGAAAACAGAAAAAAGCGGG + Intergenic
1012931957 6:105326785-105326807 CAGAGAAAAGAGAAAAATGGAGG + Intronic
1012969966 6:105718433-105718455 AATGGAAAACAGAAAAAGGCAGG + Intergenic
1013209379 6:107973145-107973167 GAGAGAAAAGAGAAAAAGGGGGG + Intergenic
1013697142 6:112716748-112716770 AAGGGAAAAAAGAGAAAGGGAGG - Intergenic
1015329568 6:131961772-131961794 CAGGAAGAAAAGAACAAAGGGGG - Intergenic
1016116977 6:140299102-140299124 CAGGGAAAGAAGAGCAAGAGAGG + Intergenic
1016487596 6:144559373-144559395 CAGGGAAAACAGAGCAAAACTGG + Intronic
1017461568 6:154655884-154655906 CAGGGAGAGCAGAACAAGAGAGG + Intergenic
1019648563 7:2143970-2143992 CAGGCAAAACAGCACCAGGCAGG + Intronic
1020830432 7:13088359-13088381 AATGGAAAACAAAAAAAGGGAGG - Intergenic
1021301777 7:18982007-18982029 CAGGGAGAAGAGAATCAGGGTGG + Intronic
1021594057 7:22296002-22296024 CAGGGTAAGGAGAACAAAGGAGG + Intronic
1021812422 7:24415786-24415808 CAGGAAAAATAGAAAAAGTGAGG + Intergenic
1021972939 7:25983320-25983342 GAGAGAAAACAGAAAAAGTGTGG + Intergenic
1022166478 7:27768915-27768937 CAGGGAAGACTTAACAAAGGTGG - Intronic
1022232116 7:28424066-28424088 CAGAGAAGACAGAAGAAGGAGGG - Intronic
1022352881 7:29582113-29582135 AAGGGAAAACAAAAAAAGGCAGG + Intergenic
1022536179 7:31100038-31100060 CAGGGAAAGCAGAAAAGAGGAGG - Intronic
1022880176 7:34578101-34578123 AATGGAAAACAAAACAAGGCAGG + Intergenic
1023167187 7:37354610-37354632 CCAGAAAACCAGAACAAGGGAGG - Intronic
1023488680 7:40714031-40714053 CATTGAAAACAAAACAAGGCCGG + Intronic
1023886139 7:44358157-44358179 CATGGAAAACAGAAAAAAGCAGG - Intergenic
1024290242 7:47798135-47798157 CAGTCAAAACAGAACAAAGCTGG + Intronic
1024797015 7:53032756-53032778 CAGGCAAAACAGAGCAACAGAGG + Intergenic
1024951073 7:54860846-54860868 CAGAGAGAACAGAGGAAGGGAGG + Intergenic
1027407581 7:77878135-77878157 CCAGGCAAACAGAACAAGAGAGG + Intronic
1028027810 7:85867982-85868004 CAGGGAGAACAGAACCAAGTTGG + Intergenic
1028523158 7:91753987-91754009 CAGGGAAAACAAAACCAAGATGG + Intronic
1029254312 7:99259001-99259023 CAGGAGAAAGAGAGCAAGGGGGG + Intergenic
1029493181 7:100883379-100883401 GAGGGAAAACAGAAGAAATGAGG - Intronic
1029504012 7:100951293-100951315 CAGGGAAAGCTGAACAAAGAGGG - Intronic
1029806909 7:103007839-103007861 CAGGTATATCAGAACAAGTGTGG + Intronic
1029916211 7:104212049-104212071 AATGGAAAACAGAAAAAGGCAGG + Intergenic
1030541002 7:110830759-110830781 TGGGGAAAAGAGAGCAAGGGAGG - Intronic
1030880992 7:114879487-114879509 CAGGGAAAACAGTACTAAGAGGG - Intergenic
1030997258 7:116373554-116373576 AATGGAAAACAAAAAAAGGGAGG + Intronic
1031323436 7:120362871-120362893 CAGGGTGAACAGAACCAGGAAGG + Intronic
1031932426 7:127699479-127699501 CTCTGAAAACAGAACAAGTGAGG - Intronic
1033127332 7:138717609-138717631 CAGAGATAACAAAACAAGGCCGG + Intronic
1033128615 7:138726377-138726399 AAGGGGAAACAGAACGTGGGGGG + Intronic
1034680478 7:152924546-152924568 GAGGGAAAGCAGAACTTGGGGGG + Intergenic
1035639353 8:1172482-1172504 CAGGGAGAACAGAACCAAGTTGG - Intergenic
1035840016 8:2801174-2801196 AATGGAAAACAGAAAAAGGCAGG + Intergenic
1035998403 8:4574419-4574441 GAGGGTAAGCAGAAGAAGGGTGG - Intronic
1036022431 8:4860436-4860458 CAGGGCCAAGAGAGCAAGGGTGG - Intronic
1037232240 8:16672293-16672315 AATGGAAAACAGAAAAAGGCAGG + Intergenic
1037421811 8:18710388-18710410 CAGGGGGAACAGAACCAGGTTGG + Intronic
1037501925 8:19494866-19494888 CAGTAAAAACAGAAAATGGGCGG + Intronic
1037546902 8:19932462-19932484 AATGGAAAACAGAAAAAGGCAGG + Intronic
1038044026 8:23750819-23750841 CAGGGAAAGGAGAACAAGGAAGG - Intergenic
1038800307 8:30743589-30743611 CAGGCAAAACTGAAAAGGGGCGG + Intronic
1039680151 8:39726005-39726027 AAGGGAAAAGAGAGCAAGGTTGG - Intronic
1040034733 8:42859251-42859273 CAGGGAAAAAAGTAGAAGTGAGG + Intronic
1040458499 8:47623555-47623577 AATGGAAAACAGAAAAAGGCAGG + Intronic
1040727082 8:50394294-50394316 CAGGGAAAACAGAATATAAGCGG + Intronic
1041614001 8:59884160-59884182 AATGGAAAACAGAAAAAGGCAGG + Intergenic
1041729862 8:61052513-61052535 CTGGGAAAAGAGGACTAGGGAGG + Intergenic
1041731708 8:61069420-61069442 AAGGGAAAACAGAGGAAGGAAGG - Intronic
1041940528 8:63382274-63382296 CAGGAATGACAGAGCAAGGGTGG - Intergenic
1043102593 8:76064774-76064796 AATGGAAAACAAAAAAAGGGAGG + Intergenic
1043740726 8:83808277-83808299 CAGGAGAAAAAGATCAAGGGTGG - Intergenic
1043870081 8:85422670-85422692 AATGGAAAACAGAAAAAGGCAGG - Intronic
1044284618 8:90397206-90397228 AATGGAAAACAGAAAAAGGCAGG - Intergenic
1044353646 8:91195668-91195690 AATGGAAAACAGAAAAAGGCAGG - Intronic
1044943347 8:97365927-97365949 AAGGGAAAAAAAAAAAAGGGTGG - Intergenic
1045293648 8:100854621-100854643 AATGGAAAACAGAAAAAGGCAGG + Intergenic
1046220108 8:111202464-111202486 CAGGGAGAACAGAACCAAGTTGG + Intergenic
1046295781 8:112217972-112217994 GAGGGTGAACAGAACCAGGGTGG + Intergenic
1046731262 8:117728785-117728807 CAGGAAAAGGAGAACAAGGATGG - Intergenic
1046987011 8:120399037-120399059 CAAGGAAAACAGAACCAAGTTGG + Intronic
1047077510 8:121420192-121420214 AATGGAAAACAAAAAAAGGGAGG + Intergenic
1047116215 8:121844239-121844261 CAGGGAAAAAGGGAAAAGGGAGG + Intergenic
1048073828 8:131047072-131047094 AAGGAAAAACAGAAGAAGGCAGG - Intergenic
1048357034 8:133661982-133662004 ATGGGAAAAAAGAACGAGGGTGG + Intergenic
1048502112 8:134987814-134987836 CAGGGCAAACAGTACAGAGGTGG + Intergenic
1048519970 8:135144416-135144438 TATGGAAAACAGAACAAGAGAGG - Intergenic
1048682413 8:136858192-136858214 AATGGAAAACAGAAAAAGGCAGG - Intergenic
1049153795 8:141055042-141055064 CAGGGTAATCAGAACAGAGGGGG - Intergenic
1049233623 8:141496932-141496954 CAGTGAGAGCAGAGCAAGGGAGG + Intergenic
1049899217 9:141859-141881 AATGGAAAACAAAACAAGGCAGG + Intronic
1050047341 9:1560734-1560756 AATGGAAAACAGAAAAAGGCAGG + Intergenic
1050048333 9:1572845-1572867 AAGGGAAAACATAAAAAGGCAGG - Intergenic
1050080785 9:1913689-1913711 CAGGGAAATCAGATAAAAGGTGG - Intergenic
1050244868 9:3678307-3678329 CAGATAAAAAAGATCAAGGGAGG - Intergenic
1050960721 9:11726903-11726925 CAGGAAAGACAGAACAAGGCTGG - Intergenic
1051108763 9:13610864-13610886 CAAGGACAGCAGAACAAAGGAGG + Intergenic
1051232104 9:14964974-14964996 TAGGGAAAACATCACAAGGGCGG + Intergenic
1051480534 9:17555379-17555401 CAGAGAAAAGATAACAAAGGAGG + Intergenic
1051603665 9:18898563-18898585 CAGGGAGAACAGAACCAAGTTGG + Intronic
1051800581 9:20928901-20928923 CAGGGAAGAAAGGAAAAGGGAGG - Intronic
1052328411 9:27241675-27241697 AATGGAAAACAAAACAAGGCAGG + Intergenic
1052394620 9:27923927-27923949 TAGAGAACAGAGAACAAGGGTGG + Intergenic
1052743377 9:32415691-32415713 CCGGGATAGCAGAACAAGGCAGG - Intronic
1052829332 9:33202356-33202378 CAGGGCAGACAGAGCAAGGGTGG + Intergenic
1053216106 9:36271971-36271993 CAGAGAGAAAAGAACAAGGATGG - Intronic
1053521239 9:38781668-38781690 AATGGAAAACAGAAAAAGGCAGG + Intergenic
1054193402 9:62005661-62005683 AATGGAAAACAGAAAAAGGCAGG + Intergenic
1054645006 9:67583030-67583052 AATGGAAAACAGAAAAAGGCAGG - Intergenic
1054860007 9:69941471-69941493 CAGGGAACATAAAACAAGGTGGG - Intergenic
1055556744 9:77481873-77481895 AATGGAAAACAGAAAAAGGCAGG - Intronic
1055729830 9:79268982-79269004 CAGGGAACACAGAGCATGGCAGG - Intergenic
1056302713 9:85258445-85258467 CATGGCAAACAGAAGCAGGGTGG - Intergenic
1056345760 9:85693265-85693287 CAGGGAAGAAAGAACATAGGTGG - Intronic
1057061985 9:92012272-92012294 CAAGGAAAAGAGAATAAGGTGGG + Intergenic
1057453869 9:95190171-95190193 GAGGGAAGACAGGACATGGGGGG - Intronic
1057980154 9:99652440-99652462 AATGGAAAACAGAAAAAGGAGGG + Intergenic
1058941343 9:109815524-109815546 CAGGGTAGACAGAAACAGGGGGG + Intronic
1059308326 9:113371881-113371903 CAAGGAAAACAGACCAAAAGGGG + Intergenic
1060483192 9:124029980-124030002 CAGGGAAAGCATGTCAAGGGTGG + Intronic
1061147900 9:128810472-128810494 CAGGGAAAAATGAACAGGGATGG + Intergenic
1061628255 9:131855197-131855219 CAGGGAAGAAGGGACAAGGGAGG - Intergenic
1203440854 Un_GL000219v1:7203-7225 AATGGAAAACAGAATAAGGCAGG - Intergenic
1203465795 Un_GL000220v1:85006-85028 AATGGAAAACAGAAAAAGGCAGG + Intergenic
1203511732 Un_KI270741v1:125586-125608 AATGGAAAACAGAATAAGGCAGG - Intergenic
1203511861 Un_KI270741v1:127214-127236 AATGGAAAACAGAATAAGGCAGG - Intergenic
1185798192 X:2985112-2985134 CTGGGATAACAGAGCAAGGCTGG - Intergenic
1186078953 X:5909626-5909648 CAGGGAAAACAGTACGTGTGTGG + Intronic
1186188934 X:7050341-7050363 CAGGGAATTCAGCACCAGGGTGG + Exonic
1186207471 X:7215684-7215706 AAGGGAAAGGAGAACAAGGTTGG + Intergenic
1186634660 X:11389738-11389760 CATGGAAAACAAAACAGAGGTGG + Intronic
1186912263 X:14181272-14181294 CATGGAAAACAGAAATAGTGTGG + Intergenic
1186931246 X:14393134-14393156 AATGGAAAACAGAAAAAGGCAGG + Intergenic
1187439165 X:19302416-19302438 CAGGGAAAACAGAAGACAGATGG - Intergenic
1187644162 X:21328532-21328554 CAGGCAAAACAGCACTGGGGAGG - Intergenic
1187658084 X:21503887-21503909 CAGGTAAAAGAGAAGAAAGGCGG - Intronic
1187674819 X:21705608-21705630 CTGAGCAAACAGAACAAGAGAGG - Intergenic
1188034431 X:25301117-25301139 CATGGAAATCAAAACAAGTGTGG - Intergenic
1188080700 X:25836581-25836603 CAGGGAAAGCAGAATAAATGAGG + Intergenic
1188216187 X:27480362-27480384 CATGTAAACCAGAACAAGGAAGG - Intergenic
1189251794 X:39606073-39606095 CAGGGAGAACAGAACTTGGCTGG + Intergenic
1189590794 X:42508559-42508581 CAGGGAAAACAGAACCATGTTGG + Intergenic
1189939942 X:46111392-46111414 CAGGGAGAACAGAACCAAGTTGG - Intergenic
1191050528 X:56186193-56186215 AATGGAAAACAGAAAAAGGCAGG + Intergenic
1191091966 X:56633397-56633419 AATGGAAAACAAAAAAAGGGAGG - Intergenic
1191224525 X:58029402-58029424 AATGGAAAACAGAAAAAAGGAGG - Intergenic
1191751467 X:64547644-64547666 CATGGAAAACAAAAAAAGGCAGG - Intergenic
1191764453 X:64682111-64682133 GAGGGAAAACAGAACTAGGGAGG + Intergenic
1191828059 X:65387464-65387486 AATGGAAAACAGAAAAAGGCAGG - Intronic
1192038892 X:67596080-67596102 CAGGAACAAGAGAGCAAGGGGGG - Intronic
1192077224 X:68011476-68011498 AATGGAAAACAGAAAAAGGCAGG + Intergenic
1192204688 X:69088222-69088244 CAGGGAAATCAGAACCAGGCTGG - Intergenic
1193040540 X:76999266-76999288 CAGGGTAAGCAGAAGTAGGGTGG - Intergenic
1193804203 X:85973773-85973795 CTGGGAAAAAAGAACAAAGTAGG + Intronic
1193923332 X:87455980-87456002 AATGGAAAACAGAAAAAGGCAGG + Intergenic
1194231950 X:91335376-91335398 AATGGAAAACAGAAAAAGGCAGG - Intergenic
1194263780 X:91731633-91731655 CATGGAAAACAGAAAAAAGCAGG - Intergenic
1194804306 X:98308433-98308455 CTTGGAAAACAGAAAAAGGTAGG + Intergenic
1194875886 X:99187456-99187478 AAGGGAAGCAAGAACAAGGGAGG - Intergenic
1194895455 X:99433941-99433963 CAGGGGAGACAGAACGAGTGTGG + Intergenic
1194907649 X:99597813-99597835 AATGGAAAACAAAACAAGGCAGG - Intergenic
1194930558 X:99882059-99882081 CAGGGAAAACAGAACCAAGCTGG + Intergenic
1195104493 X:101591102-101591124 AATGGAAAACAGAAAAAGGCAGG - Intergenic
1195113960 X:101677094-101677116 AAGGGAAATCAGAAAGAGGGTGG - Intergenic
1195250720 X:103043549-103043571 CAGAGAAGACAGAAAAAGAGTGG - Intergenic
1195834207 X:109094456-109094478 AACGGAAAACAGAACAAAGCAGG - Intergenic
1196455987 X:115892021-115892043 CAGGGAACACAAACCAAGGAAGG + Intergenic
1197118599 X:122863642-122863664 CTAGTAAAACAGAACAAGAGGGG - Intergenic
1197543174 X:127791079-127791101 AATGGAAAACAGAAAAAGGCAGG + Intergenic
1197640347 X:128960171-128960193 CAGGAGAAAGAGAGCAAGGGGGG + Intergenic
1197889038 X:131249376-131249398 CATGGAAAACAAAAAAAGGCAGG - Intergenic
1197984818 X:132256197-132256219 CAGGGACATCAGAAAAAGGAAGG + Intergenic
1198687240 X:139239399-139239421 CAGGGAGAATAGAACCAGGTTGG + Intergenic
1198731529 X:139735518-139735540 CAAGGAATACAGAACAAAGTAGG + Intronic
1198796246 X:140398853-140398875 AATGGAAAACAGAAAAAGGCAGG + Intergenic
1198916978 X:141683452-141683474 AATGGAAAACAAAACAAGGCAGG + Intronic
1199365813 X:146981269-146981291 AAGGGAAAACAGAAAAAAGCAGG - Intergenic
1200033962 X:153316768-153316790 CAGGGAGAACAGAACACAGTGGG + Intergenic
1200388337 X:155916954-155916976 CAGGGAGAACAGAACCAAGTTGG - Intronic
1200706045 Y:6443406-6443428 CAGGCAGAACTGAACTAGGGTGG + Intergenic
1200868134 Y:8067424-8067446 TAGGGAAAACAGAATAAAGATGG + Intergenic
1200896525 Y:8381867-8381889 AAGGGAAAACAGTACCAAGGGGG - Intergenic
1201028065 Y:9721302-9721324 CAGGCAGAACTGAACTAGGGTGG - Intergenic
1201376662 Y:13330374-13330396 GAGGGCAAACAGAAGCAGGGTGG + Intronic
1201780050 Y:17710664-17710686 AATGGAAAACAAAACAAGGCAGG + Intergenic
1201821505 Y:18195328-18195350 AATGGAAAACAAAACAAGGCAGG - Intergenic
1202250536 Y:22866374-22866396 GATGGAAAACAGAAAAAAGGAGG + Intergenic
1202265550 Y:23013954-23013976 CAGGGAATACAGCACAAAGTTGG + Intergenic
1202357414 Y:24066015-24066037 CATGGAAAACAAAAAAAGGCAGG + Intergenic
1202403525 Y:24500123-24500145 GATGGAAAACAGAAAAAAGGAGG + Intergenic
1202418543 Y:24647696-24647718 CAGGGAATACAGCACAAAGTTGG + Intergenic
1202452243 Y:25022390-25022412 CAGGGAATACAGCACAAAGTTGG - Intergenic
1202467254 Y:25169959-25169981 GATGGAAAACAGAAAAAAGGAGG - Intergenic
1202513363 Y:25604099-25604121 CATGGAAAACAAAAAAAGGCAGG - Intergenic