ID: 928256714

View in Genome Browser
Species Human (GRCh38)
Location 2:29729145-29729167
Sequence ATTACCTTCTGGAAAAGTGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 275
Summary {0: 1, 1: 0, 2: 2, 3: 20, 4: 252}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
928256707_928256714 6 Left 928256707 2:29729116-29729138 CCTCAGCCTCCCCTCGCTCTGAA 0: 1
1: 0
2: 6
3: 34
4: 447
Right 928256714 2:29729145-29729167 ATTACCTTCTGGAAAAGTGAAGG 0: 1
1: 0
2: 2
3: 20
4: 252
928256710_928256714 -4 Left 928256710 2:29729126-29729148 CCCTCGCTCTGAAACCTGAATTA 0: 1
1: 0
2: 0
3: 9
4: 102
Right 928256714 2:29729145-29729167 ATTACCTTCTGGAAAAGTGAAGG 0: 1
1: 0
2: 2
3: 20
4: 252
928256704_928256714 19 Left 928256704 2:29729103-29729125 CCCAGCCACTAAACCTCAGCCTC 0: 1
1: 2
2: 1
3: 33
4: 226
Right 928256714 2:29729145-29729167 ATTACCTTCTGGAAAAGTGAAGG 0: 1
1: 0
2: 2
3: 20
4: 252
928256711_928256714 -5 Left 928256711 2:29729127-29729149 CCTCGCTCTGAAACCTGAATTAC 0: 1
1: 0
2: 0
3: 0
4: 74
Right 928256714 2:29729145-29729167 ATTACCTTCTGGAAAAGTGAAGG 0: 1
1: 0
2: 2
3: 20
4: 252
928256709_928256714 -3 Left 928256709 2:29729125-29729147 CCCCTCGCTCTGAAACCTGAATT 0: 1
1: 0
2: 0
3: 5
4: 123
Right 928256714 2:29729145-29729167 ATTACCTTCTGGAAAAGTGAAGG 0: 1
1: 0
2: 2
3: 20
4: 252
928256703_928256714 26 Left 928256703 2:29729096-29729118 CCTGGAACCCAGCCACTAAACCT 0: 1
1: 1
2: 0
3: 16
4: 210
Right 928256714 2:29729145-29729167 ATTACCTTCTGGAAAAGTGAAGG 0: 1
1: 0
2: 2
3: 20
4: 252
928256708_928256714 0 Left 928256708 2:29729122-29729144 CCTCCCCTCGCTCTGAAACCTGA 0: 1
1: 0
2: 0
3: 10
4: 171
Right 928256714 2:29729145-29729167 ATTACCTTCTGGAAAAGTGAAGG 0: 1
1: 0
2: 2
3: 20
4: 252
928256705_928256714 18 Left 928256705 2:29729104-29729126 CCAGCCACTAAACCTCAGCCTCC 0: 1
1: 1
2: 1
3: 38
4: 366
Right 928256714 2:29729145-29729167 ATTACCTTCTGGAAAAGTGAAGG 0: 1
1: 0
2: 2
3: 20
4: 252
928256706_928256714 14 Left 928256706 2:29729108-29729130 CCACTAAACCTCAGCCTCCCCTC 0: 1
1: 0
2: 2
3: 46
4: 596
Right 928256714 2:29729145-29729167 ATTACCTTCTGGAAAAGTGAAGG 0: 1
1: 0
2: 2
3: 20
4: 252

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
928256714 Original CRISPR ATTACCTTCTGGAAAAGTGA AGG Intronic
902435677 1:16396924-16396946 ATTACCTTCAGGAGAAGGCAAGG + Exonic
907594823 1:55710019-55710041 ATTTCCTACTGGAAAGATGAAGG + Intergenic
908269771 1:62411532-62411554 ATTTCCTTCTGCCAAAGTGCTGG + Intergenic
909144845 1:71917256-71917278 ATCACCTTCTGAAAAAATAAGGG - Intronic
909825012 1:80116807-80116829 ATGCTCTTCTGGAAGAGTGAAGG + Intergenic
910034480 1:82774785-82774807 GTGACCTTCTGGAAAAGAGCTGG + Intergenic
910116397 1:83736708-83736730 ATCACATTCTGGAAAGTTGAAGG + Intergenic
910496653 1:87836812-87836834 TTTACCTTTTAGAAAAGTCAAGG + Intergenic
911313535 1:96327508-96327530 AAAACCTTATGGAAAACTGATGG + Intergenic
911977756 1:104522719-104522741 ATAAACTTCTGGGAAAGTCAAGG + Intergenic
913427053 1:118744794-118744816 ATAACCTTGTAGAAAAGTAAAGG - Intergenic
915772600 1:158444127-158444149 ATTTGCTTCTGGAAAAATGAGGG - Intergenic
915873332 1:159585520-159585542 ATTAACATCTGGAAATGTTAGGG + Intergenic
916177279 1:162053017-162053039 ATTTCTTTCTGGACCAGTGAAGG + Intergenic
917186457 1:172362001-172362023 CTTGCCTACAGGAAAAGTGAGGG - Intronic
917367528 1:174249042-174249064 AATAACTTCTGGAGAAGTGTTGG + Intronic
918465314 1:184815818-184815840 ATGTCCTTCTAGAAGAGTGAAGG - Intronic
918686200 1:187418819-187418841 ATTAGCTAGTGGAAAAGTGCTGG + Intergenic
920180784 1:204130613-204130635 CTGGCCTTCTGAAAAAGTGACGG + Intergenic
922158347 1:223058325-223058347 ATGCCCTTCTAGAAGAGTGAAGG + Intergenic
922374632 1:224949582-224949604 ATTACTGTTTGGGAAAGTGAAGG + Intronic
922759018 1:228113558-228113580 ATGTCCTTTTAGAAAAGTGAAGG + Intergenic
923647894 1:235842719-235842741 TTTACCTTCTGGAAATGAAATGG + Intronic
923935527 1:238755573-238755595 ATAACCTCCAGGACAAGTGAAGG - Intergenic
1063043815 10:2371820-2371842 ATGACCATCTGGAGAACTGATGG - Intergenic
1065567303 10:27026138-27026160 AGAACCTTCTGGAAAAGTTAGGG + Intronic
1065807216 10:29405324-29405346 ATGTCCTTCTGTAAGAGTGAAGG + Intergenic
1065820013 10:29516803-29516825 ATTCCCTGCTGGAACAGTGTGGG - Intronic
1065952905 10:30668082-30668104 ATTCCCTGCTGGAACAGTGTGGG + Intergenic
1066300794 10:34093843-34093865 AACACATTCTGGAAAAGTGGTGG + Intergenic
1067465398 10:46494558-46494580 ATTTCCATCTGGAAAAGATATGG + Intergenic
1067621789 10:47890043-47890065 ATTTCCATCTGGAAAAGATATGG - Intergenic
1068095183 10:52482630-52482652 ATTACCTTGTATGAAAGTGATGG - Intergenic
1069032876 10:63616498-63616520 TATAGCTTCAGGAAAAGTGATGG - Intronic
1070772826 10:79092266-79092288 ATCCCCTTCTGGAAAACTGGTGG + Intronic
1071907873 10:90194861-90194883 ATTAACTTGTAGAAAATTGATGG + Intergenic
1073974491 10:109085690-109085712 ATTACCTTCAGGAGTAGTCAAGG + Intergenic
1074339671 10:112615291-112615313 ATTTCCATCTGGAAAACAGATGG + Intronic
1074388561 10:113037158-113037180 TTAACCTTCTCCAAAAGTGATGG - Intronic
1077274534 11:1697742-1697764 ATCACCTTCTGCAAAATTCAGGG - Exonic
1078247268 11:9585374-9585396 ATTACCTTCAGATAAAGAGAAGG + Intronic
1078311813 11:10251260-10251282 ATGTCCTTCTAGAAGAGTGAAGG - Intronic
1078580571 11:12536592-12536614 CTTATCTTCTGGAAAATTAAAGG - Intergenic
1081003074 11:37698452-37698474 GCTACCTTCTGGAAAATTAAGGG - Intergenic
1082642660 11:55684121-55684143 TTTATCTTCTGGAAAAGTTATGG - Intergenic
1082698362 11:56398723-56398745 ATGTCCTTCTAGAAGAGTGAAGG + Intergenic
1083011851 11:59408939-59408961 ATGCCCTTCTAGAAGAGTGAAGG - Intergenic
1083376656 11:62228828-62228850 ATACCCTTCTGGAAGTGTGAAGG - Intergenic
1084511020 11:69603961-69603983 ATAGCCTTCTGGCAAAATGATGG + Intergenic
1085479843 11:76812207-76812229 ATGCCCTTCTAGAAGAGTGAAGG + Intergenic
1087226903 11:95611422-95611444 ATGTCCTTCTAGAAGAGTGAAGG + Intergenic
1088104394 11:106189638-106189660 ATGTCCTTATGAAAAAGTGAAGG - Intergenic
1089880549 11:121769254-121769276 AAGACCTTCTGGCAATGTGAAGG - Intergenic
1090292885 11:125561329-125561351 ATGTCCTTCTAGAAGAGTGAAGG - Intergenic
1090906027 11:131075410-131075432 TTTGCCCTCTGGAAAAGTAAGGG - Intergenic
1091498865 12:995793-995815 CTTACCTTCTAGATACGTGAGGG + Intronic
1091592180 12:1849680-1849702 GTTACCTACAGGAAGAGTGAAGG - Intronic
1092494785 12:8982374-8982396 ATTTCCTTCTGGGAAAGTCAAGG - Intronic
1092816844 12:12319708-12319730 TTGACCTTCTGCCAAAGTGATGG + Intergenic
1095747544 12:45676319-45676341 ATTACTTTCTGGAGACTTGAGGG + Intergenic
1096392701 12:51241644-51241666 ATGAACTACTGGAAAACTGAAGG - Intronic
1096829424 12:54302592-54302614 ATGATCTACTGGAAAAGGGATGG - Intronic
1097254578 12:57663910-57663932 ATGTCCTTCTAGAAGAGTGAAGG - Intergenic
1098294417 12:68989988-68990010 ATGCCCTTCTAGAAGAGTGAAGG - Intergenic
1099672251 12:85709497-85709519 ATTTCCCTCTGGAAAATTGCTGG - Intergenic
1100170141 12:91965964-91965986 GTTGCCTTCTGGAAAATTGCTGG + Intergenic
1100724993 12:97398912-97398934 ATTACCTTCTGAAAAAAAGTGGG - Intergenic
1101189409 12:102315861-102315883 ATGTCCTTCTAGAAGAGTGAAGG - Intergenic
1101375973 12:104172019-104172041 CTTACCTTCTGAGAAAGGGACGG - Intergenic
1102417651 12:112778580-112778602 TTTACATTATGGAAAAGTGTGGG + Intronic
1102616049 12:114155156-114155178 ATTACCTTTTGGAGAAGGGTGGG - Intergenic
1103832626 12:123792226-123792248 ATTAACTCCAGGAAAACTGAAGG - Intronic
1104790555 12:131479226-131479248 AGTAACTTCTGGCAAAATGATGG - Intergenic
1105917305 13:24928361-24928383 TTTACCTGCAGGAAGAGTGAAGG + Intergenic
1110341087 13:74390891-74390913 ATGAACTACTGGAAAACTGATGG - Intergenic
1110960105 13:81610618-81610640 ATGCCCTTCTAAAAAAGTGAAGG - Intergenic
1112977335 13:105336697-105336719 ATTAGCTTCTGTTAAACTGAGGG + Intergenic
1113808277 13:113122469-113122491 TTTCTCTTCTGGAAAAATGATGG + Intergenic
1115964520 14:38872742-38872764 GGTACCTCATGGAAAAGTGAGGG - Intergenic
1116234949 14:42268088-42268110 ATGCCCTTCTAGAAAAGTGAAGG + Intergenic
1116774187 14:49161164-49161186 ATTACCTTATTGCAAAGTTAAGG - Intergenic
1118453777 14:65927420-65927442 AGTACCTTCTGTAAAACTGAGGG + Intergenic
1118539636 14:66807634-66807656 ATTACCTTTGGGAGAAGGGAAGG - Intronic
1120375554 14:83701593-83701615 ATTATCTTCTAGAAATGTTACGG - Intergenic
1121268139 14:92617970-92617992 ATGCCCTTCTAGAAGAGTGAAGG + Intronic
1121382124 14:93481601-93481623 CTTACCTTCAGGAAAAATAAAGG + Intronic
1122201701 14:100126695-100126717 ATTACTTTCCAGACAAGTGATGG + Exonic
1125909462 15:43423027-43423049 ATTACCATTTGGAAAAATGAAGG + Intronic
1131249713 15:90822289-90822311 TTTCCCATCTGCAAAAGTGAGGG + Intergenic
1131900651 15:97084235-97084257 ATTACTTTCTCCAACAGTGAAGG - Intergenic
1132920277 16:2385968-2385990 ATTACCTTCAGGGAAAGGGATGG - Intergenic
1133405092 16:5517394-5517416 GCTACCATCTGGAAAAGTCAAGG - Intergenic
1133551806 16:6863188-6863210 ATTACTTTTTGGAATAGAGAAGG + Intronic
1135949727 16:26902908-26902930 TTCACCGTCTGGAAGAGTGATGG + Intergenic
1137066037 16:35844371-35844393 ATGACTTTCTGGAAAAGAAATGG - Intergenic
1137424806 16:48369227-48369249 ATTATCTTCAGGAAAAATGGAGG - Intronic
1149002119 17:51768092-51768114 ATTTCCTTCGGGAAAAGTTCGGG + Intronic
1149158356 17:53661392-53661414 ATTGCCTTCTGAAATAGTGGTGG - Intergenic
1153149501 18:2074842-2074864 ATTACCTTCTGAGTAAGTGAAGG - Intergenic
1155104400 18:22647535-22647557 ATTACCTTTTTGAAAAGGGGAGG - Intergenic
1155914981 18:31548176-31548198 ATTAACTTGTAGAAAAGGGAAGG - Exonic
1156900431 18:42294765-42294787 ATTAACTTCTTTTAAAGTGAAGG + Intergenic
1158448179 18:57539471-57539493 ATTATTTTCTAGAACAGTGATGG - Intergenic
1159013311 18:63080231-63080253 ACTGCCTTCTGGAAGAGGGAGGG - Intergenic
1159305643 18:66638724-66638746 TTCACCTTCTGGAAAACTTAAGG + Intergenic
1163072190 19:14853388-14853410 ATTAACTTCTTGTAAAATGAAGG - Intergenic
1164461337 19:28451388-28451410 ATGCCCTTTTAGAAAAGTGAAGG - Intergenic
1165599518 19:37041843-37041865 ATTTCTTTCTGTAAAAATGAAGG + Intronic
1166320545 19:42015883-42015905 ATTACGTGCTGGGAATGTGAGGG - Intronic
1168456525 19:56514759-56514781 AGTACAGTATGGAAAAGTGAGGG - Intronic
926044494 2:9699743-9699765 AGAACCATCTGGAAAAGTGCAGG - Intergenic
926748432 2:16179481-16179503 ATTACCATCTAGAAAAAAGAAGG - Intergenic
928256714 2:29729145-29729167 ATTACCTTCTGGAAAAGTGAAGG + Intronic
928392636 2:30921109-30921131 ATTACCTTCTGGTCAAATAAAGG + Intronic
928406450 2:31018686-31018708 AATGACATCTGGAAAAGTGAGGG + Intronic
929442404 2:41974240-41974262 ATGACCAACTGGAAGAGTGAGGG + Intergenic
930740518 2:54827758-54827780 ATTACCTTGTGGAAATCTGTGGG + Intronic
931191892 2:60009615-60009637 ATTTCCTTTTGGAAATGTCAAGG - Intergenic
931762047 2:65426710-65426732 GTCACCTACTGGAGAAGTGAAGG + Intronic
931851259 2:66252614-66252636 AGAACCTTCTGGAGAACTGAAGG + Intergenic
932915017 2:75847791-75847813 AATACCTTCTGGAAAGGAGGGGG + Intergenic
933650830 2:84848943-84848965 ATTTCCTTCAGAAACAGTGAAGG - Intronic
935833700 2:107026663-107026685 ATTTCATTCAGGCAAAGTGAAGG + Intergenic
936125578 2:109787009-109787031 ATGCCCTTCTGGAAAGGTGAAGG + Intergenic
936219115 2:110584459-110584481 ATGCCCTTCTGGAAAGGTGAAGG - Intergenic
940473823 2:154134451-154134473 AATACCTTCTGAAAAAGTAGTGG - Intronic
942229941 2:173851393-173851415 AGTCCAGTCTGGAAAAGTGATGG - Intergenic
942371482 2:175290457-175290479 ATAACCTTCTGGAAATGTTCAGG - Intergenic
943932334 2:193869372-193869394 AATACTTTCTGGAAATGAGAAGG - Intergenic
944002862 2:194862755-194862777 ATTATGTTCTGGATAGGTGAAGG - Intergenic
944050525 2:195463363-195463385 AATACCAACTGGATAAGTGATGG + Intergenic
944934026 2:204548675-204548697 TTTTGCTTCTGGAATAGTGATGG + Intronic
945228129 2:207554397-207554419 AATATATTCTGGAAAAGTCATGG + Intronic
947076236 2:226349030-226349052 ATCACATTCTGGAATACTGAGGG - Intergenic
1169692545 20:8348140-8348162 ATGACCCTCTGGAAAAGTCTAGG + Intronic
1169923824 20:10762101-10762123 ATGACCTTCAGGAGAAGTGGAGG + Intergenic
1170179245 20:13510951-13510973 ATTTCATTCTGGAAAGGAGAAGG - Intronic
1171105907 20:22432114-22432136 CTTAGCTGCTGCAAAAGTGAGGG + Intergenic
1173158733 20:40636860-40636882 GTAACCTGCTGGAGAAGTGATGG - Intergenic
1173710528 20:45151664-45151686 AGCACCATCTGGAAAAGTGAAGG - Intergenic
1173713525 20:45181077-45181099 AACACCATCTGGAAAAGAGAAGG + Intergenic
1174910835 20:54605820-54605842 CTTACATTCTGGTAAAGTAATGG + Intronic
1177326858 21:19601857-19601879 ATGCCCTTCTAGAATAGTGAAGG + Intergenic
1177425682 21:20920461-20920483 ATTTCCTTTTGGAAAAGCTAGGG + Intergenic
1177968710 21:27761042-27761064 ATTAGCTGATGCAAAAGTGAGGG - Intergenic
1181731524 22:24850411-24850433 ATTACCTTGTGGAAAACAGCAGG + Exonic
1182831248 22:33306283-33306305 TTTACCTTCTGCAAATGTGGGGG + Intronic
950910666 3:16586964-16586986 ATGACCTTAAGGAAAAGTAAGGG - Exonic
951187212 3:19727649-19727671 ATGTCCTTGTGGAAGAGTGAAGG - Intergenic
951250336 3:20386953-20386975 ATGTCCTTCTAGAAGAGTGAAGG - Intergenic
952551522 3:34484191-34484213 ATTCTTTCCTGGAAAAGTGAGGG + Intergenic
954734836 3:52698093-52698115 ATAAGCTTTTGGAAAAGTGGAGG + Intronic
956055981 3:65299540-65299562 ATTGCCTCCAGGAAAAATGAAGG - Intergenic
956064513 3:65383173-65383195 ACTACCTGCTGGCAGAGTGAAGG + Intronic
957659187 3:83124673-83124695 ATCACCATCTGTAAAAGTGAAGG + Intergenic
957750863 3:84413533-84413555 ATGCCCTTCTAGAATAGTGAAGG - Intergenic
958647718 3:96893871-96893893 ATTACATGATGGAAAAGTGATGG + Intronic
960442509 3:117706458-117706480 ATAACCACATGGAAAAGTGATGG + Intergenic
960521586 3:118661465-118661487 AATACTTTCTGGAAAAGTGAAGG + Intergenic
962485169 3:135835398-135835420 ATGACTTTCTGGAAAAGGAAAGG - Intergenic
963651377 3:147984689-147984711 GGTACTTTCTGGAAGAGTGAAGG + Intergenic
963962553 3:151325293-151325315 ATAACCTTCAAGAAAAGAGAGGG - Intronic
964913005 3:161804668-161804690 ATTAACTTAAGGAAAAGTGAGGG + Intergenic
965096069 3:164227733-164227755 ATGCCCTTCTAGAAGAGTGAAGG + Intergenic
965695539 3:171404304-171404326 ATGAGCTTCTGGAAATGTGGAGG - Intronic
965836359 3:172857398-172857420 ATTACTTTCAGGAAATATGATGG + Intergenic
966536207 3:181037152-181037174 ATGTCCTTCTAGAAGAGTGAAGG + Intergenic
966718026 3:183033288-183033310 ATTTTCTACTGGAAAAGTGGTGG + Intronic
967114975 3:186328893-186328915 ATTTCCTTCAAGAAAAGTTAGGG + Intronic
970229640 4:13896339-13896361 ATTACCTTGAGAAAGAGTGAAGG - Intergenic
970529596 4:16968432-16968454 ATTTCCTTCTGAAAATATGATGG - Intergenic
970761851 4:19498972-19498994 ATGACCATCTGGAAGACTGAAGG - Intergenic
971028901 4:22615656-22615678 ATTACCAACTGAACAAGTGAAGG + Intergenic
974429124 4:61773501-61773523 TTTACTTTTCGGAAAAGTGAGGG - Intronic
977426716 4:96875844-96875866 TATACCTTCTGGCAAAGAGAAGG + Intergenic
977860511 4:101953708-101953730 ATTGCCTTCTGGAAATCTCATGG + Intronic
978950729 4:114555918-114555940 ATGCCCTTCTAGAAGAGTGAAGG + Intergenic
980774315 4:137419773-137419795 ATTACCTGCTGATAAAGGGAAGG + Intergenic
982307567 4:153948986-153949008 TTTCCTTTTTGGAAAAGTGAGGG + Intergenic
982378018 4:154715973-154715995 ATTTCCTTCTGTAAGAGTGGAGG - Intronic
982640272 4:157950190-157950212 ATTATCTTCTTAAAAGGTGAGGG - Intergenic
983514598 4:168642732-168642754 ATTTGCTTCTGAAAAAGTGCAGG - Intronic
984183965 4:176519867-176519889 ACTTCCTTCTGAAAAAGAGAAGG - Intergenic
987521537 5:18991606-18991628 ATTATCATCTGGAAAAGAAAGGG + Intergenic
989336791 5:40327096-40327118 ATGTCCTTCTAGAAGAGTGAAGG + Intergenic
989461162 5:41699953-41699975 GTTACTTTCTGGAAGAGTGGTGG + Intergenic
990207253 5:53442596-53442618 ATTCATTTCTGGAAAAGTAAGGG + Intergenic
990290870 5:54350119-54350141 ATGTCCTTCTAGAAGAGTGAAGG - Intergenic
990950219 5:61291287-61291309 ATTCCATTCAGGAAAATTGATGG + Intergenic
991764664 5:69961967-69961989 ATTTCCTTAAGGAAGAGTGAGGG + Intergenic
991782660 5:70156186-70156208 ATTTCCTTAAGGAAGAGTGAGGG - Intergenic
991843896 5:70837038-70837060 ATTTCCTTAAGGAAGAGTGAGGG + Intergenic
991875103 5:71156500-71156522 ATTTCCTTAAGGAAGAGTGAGGG - Intergenic
992007728 5:72494988-72495010 ATTTCCTCCTGAAAATGTGAAGG - Intronic
992789744 5:80202539-80202561 ATTACCTTGTGGTGAAGTCAGGG - Intronic
993835632 5:92817006-92817028 ATTACCTTCTGGTAAAGAGTGGG - Intergenic
993897030 5:93548107-93548129 ATTTCCTTCAGGAAAACTGAAGG - Intergenic
994467662 5:100159043-100159065 ATGCCCTTCTAGAATAGTGAAGG + Intergenic
995143815 5:108763967-108763989 ATTAGCTTCTGCAAAAATGTTGG + Intronic
995304660 5:110631192-110631214 ATTACTTTCCAGAAAAGAGATGG + Intronic
996546333 5:124682727-124682749 ATTAACTTGTGGAAAAGAGTTGG + Intronic
1000114858 5:158144157-158144179 ATTACTTTTGGGGAAAGTGAAGG - Intergenic
1001538608 5:172520400-172520422 ATGACATTCTGGAAAAGACAAGG + Intergenic
1004622289 6:17341746-17341768 ACTACCTACTGTTAAAGTGAGGG + Intergenic
1005162842 6:22884348-22884370 ATTTACTTATGGAAGAGTGAAGG - Intergenic
1007749155 6:44061457-44061479 ATTTCTCTCTGGAGAAGTGAAGG + Intergenic
1010916916 6:81631464-81631486 AATACCTTTTGGAAAAGAGACGG - Intronic
1011123734 6:83983861-83983883 ATGCCCTTCTAGAAGAGTGAAGG - Intergenic
1011385311 6:86790692-86790714 ACTACCTTATAGAAAACTGAAGG - Intergenic
1011694522 6:89900010-89900032 ATGACATTCTGGAAAAGGCAAGG - Intergenic
1011772342 6:90688594-90688616 GTTATCTTCTGGACAAGGGAGGG + Intergenic
1013153267 6:107467422-107467444 ATTATATTTTTGAAAAGTGATGG - Intergenic
1014522895 6:122466874-122466896 ATTAACTGGTGGAGAAGTGAAGG + Intronic
1015730275 6:136340041-136340063 AATACCTTGTGGAAGAGTAAAGG - Intergenic
1017592025 6:155988363-155988385 ATTAACTTCTGGAACACTGCTGG - Intergenic
1020647225 7:10829519-10829541 ATGGCCTTCTAGAAGAGTGAAGG - Intergenic
1020650458 7:10868797-10868819 ATGCCCATCTGTAAAAGTGAGGG - Intergenic
1020907039 7:14076162-14076184 ATTAACTTCTAGAGAAATGATGG + Intergenic
1021813585 7:24426471-24426493 ATTACATTCTGGAACAGTGAGGG - Intergenic
1022708306 7:32827478-32827500 ATTACATTCTAGAAAAGTCATGG + Intergenic
1022914865 7:34938011-34938033 ATTACATTCTAGAAGAGTCATGG - Exonic
1023353689 7:39345920-39345942 ACTACCTTCCAGAAAATTGAGGG + Intronic
1023376942 7:39566154-39566176 GTTGCCTTCTGCAAAGGTGAAGG + Intergenic
1023481409 7:40638756-40638778 ATTGCCTTCTGGAGGTGTGATGG + Intronic
1024191254 7:47012988-47013010 ATTACATTCTTGAAAAATGCTGG - Intergenic
1024802735 7:53099780-53099802 ATGACTTTCTGGAAAAGGAAGGG - Intergenic
1025058832 7:55786839-55786861 TTCACCTTCTGGAAAAGGGCAGG - Intergenic
1026477367 7:70748629-70748651 ACCGCGTTCTGGAAAAGTGAAGG + Intronic
1027557905 7:79688525-79688547 GTCACCTACTGGAAAACTGAAGG + Intergenic
1027707634 7:81554292-81554314 ATGCCCTTCTAGAAGAGTGAAGG - Intergenic
1027800550 7:82744600-82744622 ATGATCTACTGGAAAAGTGCTGG - Intergenic
1028152705 7:87392806-87392828 ATTACCTTTTGGAAAAAAGTGGG - Exonic
1028253447 7:88563059-88563081 ATTTCATCCTGGTAAAGTGAGGG - Intergenic
1028425749 7:90686543-90686565 ATGACCTTGTTGAAAATTGAAGG + Intronic
1028548660 7:92032025-92032047 ATTAGCTCCTGGCTAAGTGAAGG + Intronic
1029810797 7:103046421-103046443 ATGTCCTTCTAGAAGAGTGAAGG + Intronic
1031356495 7:120793053-120793075 TCTACCTTATGGAAAAGGGAAGG - Intronic
1033072369 7:138215865-138215887 ATGCCCTTCTAGAAGAGTGAAGG + Intergenic
1033907110 7:146218663-146218685 ACTACCTTCTCCAAAAGTGGAGG - Intronic
1033962884 7:146935501-146935523 ATGCCCTTCTAGAAGAGTGAAGG - Intronic
1034724502 7:153322816-153322838 ATTACTTTCTGGGTCAGTGAGGG + Intergenic
1037022428 8:13989860-13989882 ATTACCTTCTGTATTAGTCAGGG - Intergenic
1037609474 8:20464210-20464232 ATTATCTGCTGGAAAAGTTTAGG + Intergenic
1038682287 8:29679812-29679834 ATTCCCTTCTTCAACAGTGAAGG - Intergenic
1040089391 8:43381475-43381497 ATGCCCTTCTAGAAGAGTGAAGG + Intergenic
1042470152 8:69178242-69178264 ATAATCCTCTGGAAAAATGAAGG + Intergenic
1042938717 8:74086505-74086527 TTTTCCTTCTGTAAAAGTCAGGG + Intergenic
1044709855 8:95046492-95046514 ATTACCTTCTTCAAATGAGATGG - Intronic
1046487144 8:114901550-114901572 ATACCCTTCTAGAAGAGTGAAGG - Intergenic
1046825400 8:118685380-118685402 ATCACCTTCCGGACTAGTGAGGG + Intergenic
1047595834 8:126377060-126377082 ATTCTCCTCTAGAAAAGTGAGGG - Intergenic
1048102586 8:131370044-131370066 ACTACATTATGGATAAGTGAAGG - Intergenic
1048724733 8:137370234-137370256 AGGACCTTCTGGTAAAGTGTGGG + Intergenic
1048755262 8:137731292-137731314 ATTAGCTCATGGAAATGTGAAGG - Intergenic
1050658085 9:7851524-7851546 ATGTCCTTCTAGAAGAGTGAAGG - Intronic
1051209248 9:14724157-14724179 ATGGCATTCTGGTAAAGTGATGG - Intergenic
1052653626 9:31330531-31330553 AGTACCTTTTGCAAGAGTGAGGG - Intergenic
1054805287 9:69391583-69391605 ATTATCTTTGGGAAAAGAGAGGG - Exonic
1055735628 9:79326639-79326661 ATTTCCTTATGGAGAAATGAGGG + Intergenic
1055970596 9:81908193-81908215 ATGTCCTTCTAGAAGAGTGAAGG + Intergenic
1056266133 9:84898254-84898276 GTTGACTTCTGAAAAAGTGATGG - Intronic
1056445053 9:86657406-86657428 ATGACATTCTGGAAAAGGTAAGG - Intergenic
1058930698 9:109716092-109716114 ATTGCCTTCTGGAACAGTTTTGG - Intronic
1058942814 9:109829934-109829956 ATTACCTACTTGAATAGTGTGGG + Intronic
1060440855 9:123637883-123637905 ATTATCTTTTGGGAAAGGGAAGG + Intronic
1061052871 9:128206358-128206380 TTTCCCTTCTGTAAAAGGGAAGG - Intronic
1186386857 X:9118796-9118818 ATTACCTACTGGAAAAATAATGG - Intronic
1186893395 X:13982372-13982394 ATGCCCTTCTAGAAGAGTGAAGG - Intergenic
1187399179 X:18944460-18944482 ATTACATTCTGGAGGAGGGAGGG + Intronic
1192983595 X:76372700-76372722 ATGCCCTTCTAGAATAGTGAAGG + Intergenic
1199222715 X:145335914-145335936 ATTACCACCTGGAAAATAGAAGG + Intergenic
1202276768 Y:23129524-23129546 ATGACCTTAAGGAAAAGTAAAGG - Exonic
1202289260 Y:23291165-23291187 ATGACCTTAAGGAAAAGTAAAGG + Intronic
1202429760 Y:24763238-24763260 ATGACCTTAAGGAAAAGTAAAGG - Exonic
1202441032 Y:24906849-24906871 ATGACCTTAAGGAAAAGTAAAGG + Intronic