ID: 928260191

View in Genome Browser
Species Human (GRCh38)
Location 2:29759687-29759709
Sequence CACAAGATCATGCAACCCAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 117
Summary {0: 1, 1: 0, 2: 2, 3: 7, 4: 107}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
928260191_928260196 27 Left 928260191 2:29759687-29759709 CCTTTGGGTTGCATGATCTTGTG 0: 1
1: 0
2: 2
3: 7
4: 107
Right 928260196 2:29759737-29759759 TGATAGGCACCATGATGAACAGG 0: 1
1: 0
2: 1
3: 11
4: 236
928260191_928260193 11 Left 928260191 2:29759687-29759709 CCTTTGGGTTGCATGATCTTGTG 0: 1
1: 0
2: 2
3: 7
4: 107
Right 928260193 2:29759721-29759743 CAGCGAAACCCAGTAGTGATAGG 0: 1
1: 0
2: 0
3: 3
4: 51

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
928260191 Original CRISPR CACAAGATCATGCAACCCAA AGG (reversed) Intronic
902370101 1:16000998-16001020 CTCAAGATCATGAAAAACAATGG - Intergenic
903270030 1:22182338-22182360 CACAATCTCTTGCAACCCATCGG + Intergenic
905226000 1:36479687-36479709 CACAAAATGATGCAAGTCAAGGG + Intronic
907034711 1:51206147-51206169 CAAAAGATAATGCAACACAAAGG - Intergenic
908010350 1:59769845-59769867 CACAAGATCCTTCAACCACAAGG - Intergenic
908837540 1:68243018-68243040 GCCAAGATCGTGAAACCCAACGG - Intergenic
909675710 1:78237144-78237166 CACAATGGCTTGCAACCCAATGG + Intergenic
910737196 1:90472952-90472974 CACAAGATCAAGGTACCCACAGG + Intergenic
910792926 1:91069700-91069722 CACATCTTCATGCAACACAATGG - Intergenic
915483048 1:156200253-156200275 CACCTGATGATGCAACGCAAGGG + Exonic
916724170 1:167508110-167508132 CACAAGCTCTTGCAGTCCAAAGG - Intronic
919823620 1:201488698-201488720 CACAGGTACATGCAACCCACAGG + Intronic
924039969 1:239974812-239974834 CACAAGCACATGCCACCCATCGG - Intergenic
1064319721 10:14293305-14293327 CACAGGATGATGCAACACAAAGG + Intronic
1064894562 10:20220109-20220131 TACAAAATGATGCAACACAATGG - Intronic
1067560132 10:47299814-47299836 CCAAAGCTCATGCCACCCAAGGG - Intergenic
1067925832 10:50507090-50507112 CACAAGATCACACAGCCCATTGG + Intronic
1068242455 10:54320891-54320913 CACTGGATGATGCAACACAAAGG - Intronic
1070989261 10:80717031-80717053 ACCAAGATCATGAAGCCCAATGG - Intergenic
1071872562 10:89811340-89811362 CCCAAGATCATGCCACCTGAGGG - Intergenic
1072191133 10:93076937-93076959 CAAAAGATTATGAAACCCCAAGG - Intronic
1074537456 10:114338960-114338982 CCCAATATTATACAACCCAAGGG - Intronic
1075355376 10:121767954-121767976 CAAAAGGTGAAGCAACCCAATGG + Intronic
1090553564 11:127849488-127849510 CAAAAGAACATGCACCACAAGGG + Intergenic
1091200319 11:133774877-133774899 GTCAAGATCATGCAAGACAATGG - Intergenic
1102184275 12:110935416-110935438 CACAATATCCTGCAACAAAATGG + Intergenic
1105732645 13:23233893-23233915 CACAGCATCATGGAAACCAAAGG + Intronic
1110326456 13:74221760-74221782 CCCAAGATCATGCACCCCTCAGG - Intergenic
1112115407 13:96346772-96346794 CACAAGATCATTAACCCCAGGGG - Intronic
1116140253 14:40984288-40984310 CACAAGAACAGGAAACCAAAGGG - Intergenic
1119027353 14:71164589-71164611 CAGAAGCTCATGCGACCCACTGG - Intergenic
1123869076 15:24553255-24553277 CACAGGATGATGAAACCCCAAGG - Intergenic
1135528465 16:23232156-23232178 CACAAAAGCATCCAACCAAATGG + Intergenic
1138431664 16:56972896-56972918 CACTAGATCATCCAGCCCATGGG - Intronic
1138965794 16:62082606-62082628 CACAAGATGATGCACCACCAAGG - Intergenic
1140318323 16:73921599-73921621 CATGAGCTCATGCAAACCAATGG + Intergenic
1146426541 17:32744976-32744998 CAGAAGCTGAGGCAACCCAAGGG + Intronic
1149433582 17:56615058-56615080 CACAATATCAAACAAGCCAAGGG + Intergenic
1149489906 17:57077098-57077120 CACACGGGCATCCAACCCAAGGG + Intergenic
1149538233 17:57448928-57448950 CACAAGATCATGCATGCTGAGGG + Intronic
1151156361 17:72125877-72125899 CACAATATAAGGCAGCCCAAAGG - Exonic
1151170348 17:72240569-72240591 CCCAAGATCATGCAACTGACAGG - Intergenic
1157094399 18:44674317-44674339 CACAGGATCATATAACCGAAAGG + Intergenic
1157452011 18:47795818-47795840 AACAAGATCATGCAACCAACTGG + Intergenic
1157827284 18:50823609-50823631 CACAAAATCATGCAAACCAAGGG + Intronic
1163412676 19:17165910-17165932 CAGATGATAATGCAAACCAAAGG - Intronic
1168634086 19:57981707-57981729 CACAAGATCCACCAACCCAAAGG + Intronic
928260191 2:29759687-29759709 CACAAGATCATGCAACCCAAAGG - Intronic
931659176 2:64542270-64542292 CACAGTATCATGCACCCTAAAGG - Intronic
933298056 2:80513100-80513122 CACAGGATCTTGCAAAGCAAAGG - Intronic
934591375 2:95553097-95553119 CACAAGCTGATGAAAGCCAAAGG - Intergenic
935089975 2:99885704-99885726 GACAAGTTCATGGAACCCCAAGG - Intronic
935925296 2:108061887-108061909 CAGAAGATCATTCCACCCAGTGG + Intergenic
937384584 2:121416787-121416809 CTCAAGATCATGCAGCTAAATGG - Intronic
939450161 2:142363664-142363686 CACAAGACAAGGCAACCCTAAGG + Intergenic
942472259 2:176273047-176273069 CACAGGATAATGCAGCACAAAGG - Intronic
943811705 2:192195572-192195594 CACAAGAGCGTGCAACCCCAAGG + Exonic
946600149 2:221350838-221350860 CACAATATCATTCATGCCAAAGG - Intergenic
946992640 2:225352483-225352505 CCCAAGATAAAGCAAACCAATGG - Intergenic
947047647 2:226006153-226006175 AACTATATCATGCAACCAAATGG - Intergenic
1170913173 20:20595411-20595433 CACAAGATCAAACTTCCCAAGGG + Intronic
1171371432 20:24664815-24664837 CATAAGATCATGAAAACCACTGG - Intronic
1173899519 20:46576995-46577017 CACAGGTGCATGCAACCCACAGG + Intronic
1181018736 22:20087018-20087040 CAGATGATCATGCACCCTAAGGG + Intronic
951539829 3:23772026-23772048 CACAAGAGCAGGCAGCCCAGAGG + Intergenic
957482002 3:80810202-80810224 CCCAAGATCATGCAACCAATAGG - Intergenic
958448366 3:94242686-94242708 CACAAGTTCAAGCAAGGCAAGGG - Intergenic
960076642 3:113493382-113493404 CATATGATGATGCAAACCAATGG - Intronic
960161853 3:114358573-114358595 CATAAAATCAGGCAAGCCAAAGG - Intronic
961341761 3:126227860-126227882 CACAGGATCATGCCAGCCAGAGG + Intergenic
961455068 3:127019979-127020001 CACAGGATCAAGCAAGACAAGGG - Intronic
967599488 3:191368307-191368329 CACAAAATGATGCAACTCAGAGG - Intronic
971588201 4:28432483-28432505 CACCCGAGCATGCCACCCAAGGG - Intergenic
974887753 4:67841382-67841404 TACAAGGCCATGCAAACCAAGGG + Intronic
979625379 4:122839168-122839190 CACATGATCATGTAACACAGTGG + Intronic
979869382 4:125799005-125799027 CAGAAGATCATGCCTCGCAAGGG + Intergenic
985915851 5:2918689-2918711 GACAAGCCCATGAAACCCAAAGG + Intergenic
987043219 5:14082692-14082714 CACAAGATTATGTGACTCAAGGG + Intergenic
991007558 5:61844769-61844791 CACAAGATGATGCAACAAGAAGG + Intergenic
991203970 5:64028261-64028283 AACAATATCAGGCAAACCAAGGG + Intergenic
996176180 5:120361584-120361606 CAAAAGATCATGCTGCACAAAGG - Intergenic
999687109 5:154112911-154112933 GACCAGATGATCCAACCCAAAGG - Intronic
1000802172 5:165741194-165741216 CACAAGACAAAGCAGCCCAAAGG - Intergenic
1001017093 5:168151608-168151630 CCCAAGATCATGCAGCCAAAGGG + Intronic
1003924206 6:10861628-10861650 CAAAAGGACATGCAATCCAATGG - Intronic
1005169314 6:22964197-22964219 CACAAGAGAATGCAACCCAAAGG + Intergenic
1007906290 6:45464531-45464553 AAGCAGCTCATGCAACCCAAGGG - Intronic
1008536008 6:52506675-52506697 CACATGACCATCCAACACAAGGG + Intronic
1009563184 6:65275091-65275113 TACTGGATCATACAACCCAAGGG - Intronic
1009726705 6:67544086-67544108 CACAAGACCATCCACCCCACAGG + Intergenic
1012834935 6:104252815-104252837 CATAAGATGATGCAGCACAAAGG + Intergenic
1017183859 6:151580373-151580395 CACAAGATGCTGCCTCCCAAGGG - Intronic
1021782658 7:24121030-24121052 GACAAGATCATGAAACCAAGGGG + Intergenic
1022147750 7:27563203-27563225 CACAATAACAGGTAACCCAAAGG - Intronic
1024446660 7:49487826-49487848 CCTAAGATCATGCAAGGCAAGGG - Intergenic
1026157326 7:67838029-67838051 CACAGGAAGATGCAACCCAGTGG - Intergenic
1029520976 7:101062102-101062124 CCCAAGATCATGAAACCAATGGG + Intergenic
1029773716 7:102671726-102671748 CGCAAGATCCTCCAGCCCAACGG - Intergenic
1033775453 7:144604928-144604950 CACAAGTTGAAGCAACCCCAAGG + Intronic
1042513197 8:69632601-69632623 CACAAGATCCTCCAATGCAATGG + Intronic
1045872705 8:106944677-106944699 CACAAGGTCATACAACCTACTGG + Intergenic
1047048308 8:121079850-121079872 CATAACATCATGCAACTCCAAGG + Intergenic
1048031699 8:130639376-130639398 CACACGTACATGAAACCCAAAGG - Intergenic
1049862603 8:144910269-144910291 CACAAAAACATACACCCCAAGGG + Intergenic
1050579932 9:7043045-7043067 CCTAAAATCATCCAACCCAATGG - Intronic
1051751452 9:20346319-20346341 CTCAAAATGATGCAACCAAAAGG - Exonic
1056816221 9:89803181-89803203 CAAAACATGATGCAACCCATGGG - Intergenic
1057098864 9:92338813-92338835 TACAAGATCATCCAGCCCCAAGG - Intronic
1058676290 9:107403043-107403065 CACAGGATCATGCAGCCTACTGG - Intergenic
1059602725 9:115798296-115798318 CACAAGACCATGAAAACCACTGG + Intergenic
1060520157 9:124289864-124289886 CCCAAGACCATGCAGCCCTATGG + Intronic
1061675172 9:132211538-132211560 CCCAAGATCAGCCACCCCAAAGG + Intronic
1203380695 Un_KI270435v1:35669-35691 CACATGATCATTCTACACAAAGG - Intergenic
1187243479 X:17533743-17533765 CCCAAGGTCATGGGACCCAAAGG - Intronic
1189148848 X:38684071-38684093 CACAAGAGCAAGCAAAGCAAAGG - Intronic
1191024923 X:55903974-55903996 TACAAGTTAATGCAACACAATGG - Intergenic
1192012399 X:67289037-67289059 CACCAGATCATGCCTCTCAAGGG - Intergenic