ID: 928260414

View in Genome Browser
Species Human (GRCh38)
Location 2:29761621-29761643
Sequence TTCCCAGCAGACAGCAGAAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 372
Summary {0: 1, 1: 1, 2: 1, 3: 31, 4: 338}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
928260414_928260420 16 Left 928260414 2:29761621-29761643 CCTCTTCTGCTGTCTGCTGGGAA 0: 1
1: 1
2: 1
3: 31
4: 338
Right 928260420 2:29761660-29761682 TCAGTGTCCACCCATTAAAGAGG 0: 1
1: 0
2: 1
3: 9
4: 113

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
928260414 Original CRISPR TTCCCAGCAGACAGCAGAAG AGG (reversed) Intronic
900915770 1:5637365-5637387 CTGCCAGCAGATGGCAGAAGTGG + Intergenic
902948431 1:19861128-19861150 TTCCTAGCAGAGAAGAGAAGTGG + Intergenic
903735209 1:25525645-25525667 TTCCAAGCTGACCACAGAAGAGG + Intergenic
904031489 1:27536203-27536225 TGCCCAGCAGACAGCAGCCGAGG - Intronic
905708236 1:40078690-40078712 TTACCATCAGACACCAGCAGAGG + Intronic
905989716 1:42325516-42325538 TGCCCAGGACACAGCAAAAGAGG + Intronic
906987134 1:50695447-50695469 TTTCCAGCAGAGAACAAAAGGGG + Intronic
909677216 1:78252065-78252087 TTGCCAGCAGAAAGGAGCAGCGG - Intergenic
910420485 1:87056301-87056323 TTACCAGAAGACAACAGATGTGG + Intronic
910641998 1:89473537-89473559 ATCCAAGCAGACAGGAGCAGAGG + Intergenic
911480032 1:98427155-98427177 ATCCCAGAAGGCAGCAGCAGAGG - Intergenic
912557778 1:110528649-110528671 TTGGCTGCAGACAGCAGATGAGG - Intergenic
913175937 1:116273365-116273387 CTGCCAGCAGTCATCAGAAGAGG - Intergenic
914343521 1:146779425-146779447 TTGCCAGGAGACAGAAGCAGAGG + Intergenic
915160263 1:153914501-153914523 TTCCCAGAACATAACAGAAGGGG + Intronic
916515229 1:165510429-165510451 TACCCAGGACACAGCATAAGAGG - Intergenic
917707253 1:177647100-177647122 CTCCCAGCAGTCAGCAGAGGGGG + Intergenic
919131781 1:193460133-193460155 TTCCCAGCAGACAGGATCACAGG - Intergenic
919753506 1:201052874-201052896 TTCCCAGCAGCAAGCAGACCCGG + Intronic
920505031 1:206509285-206509307 TTCCCTGCAGCCAGCTGCAGCGG - Intronic
922322544 1:224501475-224501497 TGCTCAGCAGACAGCAGCATAGG + Intronic
923039699 1:230310748-230310770 TGCCCAGCAGAGGGCAGCAGAGG - Intergenic
923059951 1:230462755-230462777 TTCCCAGAAGTCAGCGTAAGGGG - Intergenic
923719689 1:236456291-236456313 TTCCCAGCAGTCTGCAGAGCTGG + Intronic
924406468 1:243752919-243752941 TCCCAAGCAGACATCTGAAGTGG + Intronic
1067454763 10:46411413-46411435 TTCCAAGCACACAGCTGCAGAGG - Intergenic
1067632441 10:47973226-47973248 TTCCAAGCACACAGCTGCAGAGG + Intergenic
1067715094 10:48684823-48684845 TTTCCTGGAGAAAGCAGAAGTGG - Intergenic
1067759859 10:49036751-49036773 TTCCCAACACCCAGCAGATGTGG + Intronic
1067787956 10:49264608-49264630 TTCACAGCAGCCAACAGCAGTGG + Intergenic
1069022942 10:63509443-63509465 TTTCCAGAAGACAGAAGTAGGGG - Intergenic
1069818791 10:71214917-71214939 TTCTCACCAGCGAGCAGAAGCGG + Intronic
1071265047 10:83957628-83957650 TTCCCAGCAGGCACCTGAGGGGG - Intergenic
1071437252 10:85658880-85658902 TTACTAGGAGACAGCAGAAATGG + Intronic
1072793094 10:98333194-98333216 TTTGCAGCAGTCAGCAGAAGAGG + Intergenic
1073077665 10:100834883-100834905 CTCTCAGCAGACAGCAGCTGTGG - Intergenic
1073288694 10:102402874-102402896 GTCTCAGCAGAAAGCAGAAACGG + Exonic
1074478842 10:113799773-113799795 CTACCAGCAGATGGCAGAAGAGG + Intergenic
1075086895 10:119419705-119419727 TTCTCAGCAGATGGGAGAAGGGG - Intronic
1075105709 10:119538755-119538777 GCCCCAGCAGGCAGCAGCAGTGG - Intronic
1075296496 10:121281051-121281073 GTCTCAGCAGACAAAAGAAGGGG - Intergenic
1076023746 10:127095148-127095170 TCCAGAGCAGAGAGCAGAAGAGG + Intronic
1076360009 10:129881540-129881562 TTCTCAGGAACCAGCAGAAGGGG + Intronic
1076772551 10:132674318-132674340 TTCCAAGCAGAGTGCACAAGCGG + Intronic
1077249360 11:1554228-1554250 TTCCCAGCAAATAACAGGAGGGG + Exonic
1077320610 11:1939237-1939259 CTCCCAGCAGACAGCAGGCAGGG + Intergenic
1078140634 11:8690154-8690176 CTCACGGCAGAAAGCAGAAGGGG - Intronic
1080119400 11:28659328-28659350 TATCCAGCAAACAGCAGAACAGG + Intergenic
1081681327 11:45006850-45006872 TAACCACCAGACAGCAGAAACGG - Intergenic
1081761379 11:45578463-45578485 TTCCCAGCTGAGTCCAGAAGAGG - Intergenic
1082945015 11:58749251-58749273 GCCCCAGCAGACAGCAGAATGGG + Intergenic
1083097404 11:60265853-60265875 TTCCCAGAAGACACCAGATTAGG - Intergenic
1084082701 11:66839145-66839167 TTCCCAGCCCACAGCAGCAGGGG + Intronic
1084482016 11:69427485-69427507 TTCCCTGCAGCCAGGGGAAGTGG + Intergenic
1084544504 11:69807924-69807946 TTCCCCTCATCCAGCAGAAGCGG + Intergenic
1084862215 11:72026754-72026776 TTCTCAGCAGAAGGCAGCAGAGG - Intronic
1089503277 11:118945557-118945579 TTCCAAGCAGAGAGAAGAATGGG - Intronic
1089536060 11:119161418-119161440 TCCCAGGCAGACAGCAGAGGAGG - Exonic
1090832037 11:130426910-130426932 ATGCCAGCAGCCAGCACAAGAGG - Intronic
1091619217 12:2073522-2073544 TTGCCAGGAGACAGCACAGGTGG + Intronic
1092623335 12:10298465-10298487 TTCCCAACAGTGAGCACAAGTGG - Intergenic
1096596367 12:52698391-52698413 ATCCCGGCAGACAGCAGAGGTGG - Intronic
1098092185 12:66915518-66915540 TTCTCAGCAGGCATCAGACGTGG + Intergenic
1098898119 12:76085045-76085067 TTCCCAGCACAACGCCGAAGGGG - Intergenic
1099918106 12:88921619-88921641 TTACCAGCTAGCAGCAGAAGAGG + Intergenic
1100374095 12:93996363-93996385 TTGGCAGGAGACAGGAGAAGAGG + Intergenic
1100826538 12:98479826-98479848 TTCACAGCAGACAGCAGTGGAGG + Intergenic
1101062646 12:100988013-100988035 TAGCCAGCAGACAGGAGGAGTGG + Intronic
1101318854 12:103654811-103654833 TCCCGAGCAGAGAGAAGAAGAGG + Intronic
1101328120 12:103734848-103734870 TTTCCAGAAGCCACCAGAAGCGG - Intronic
1102614778 12:114144126-114144148 TTCCCAGCTGACAGCACAAGTGG + Intergenic
1103239289 12:119399542-119399564 TCCCAAGCAGACACCAGATGAGG - Intronic
1103573242 12:121858594-121858616 GTTTCAGCAGAGAGCAGAAGAGG - Intronic
1104286070 12:127426147-127426169 GTGCCAGCAGACAGAAGAGGAGG + Intergenic
1104430567 12:128712748-128712770 TTAACACCAGACTGCAGAAGAGG - Intergenic
1104963515 12:132499033-132499055 GTCCCAGGGGACAGCAGAGGTGG - Intronic
1105063319 12:133173489-133173511 TTCACAGCAGAAAGTAAAAGGGG - Intronic
1106043517 13:26116518-26116540 TTCCAAAAAGACAGCAGAAGTGG - Intergenic
1106364369 13:29063939-29063961 TGCCCTTCAGACAGCAGGAGGGG + Intronic
1106449473 13:29866972-29866994 TTTTCATCAGGCAGCAGAAGGGG + Intergenic
1108447640 13:50525718-50525740 GTCCAAGCAGCCACCAGAAGTGG + Intronic
1109725946 13:66342003-66342025 CACCCAGCCCACAGCAGAAGAGG - Intronic
1110002678 13:70224664-70224686 TTGTCAGCAAACAGCAAAAGTGG + Intergenic
1111671880 13:91341608-91341630 TGCCCAGCAGTCAGAAGAGGTGG - Intergenic
1113372843 13:109738453-109738475 TTCCCAGCAGACAGCTTCTGAGG + Intergenic
1114168134 14:20242992-20243014 TTCCCAGCAGAAAGTACATGGGG - Exonic
1117192474 14:53306370-53306392 TGCCCAGCAGATGGCAGAAGCGG - Intergenic
1118035089 14:61857935-61857957 TTTCCAGCAGACAGCATCAGTGG + Intergenic
1118037017 14:61878737-61878759 TTCCTAGTCCACAGCAGAAGAGG - Intergenic
1118254315 14:64191954-64191976 CTCACAGCAGACAGCACCAGCGG - Intronic
1119933084 14:78566738-78566760 TTCCCAGCAGAGGGCAGCAACGG - Intronic
1120863962 14:89279593-89279615 TTCCCTTCAGATAGTAGAAGTGG - Intronic
1121820769 14:96964312-96964334 CTCCCAGCACACAGCCGAGGGGG - Intergenic
1122354883 14:101116949-101116971 TTCCCACCAGACTGCACAAAAGG + Intergenic
1122577022 14:102749199-102749221 TTCCCAGCTGCCAGCAGAACTGG + Intergenic
1122647094 14:103202056-103202078 TTCCCAGCAGTCACCAGATGAGG - Intergenic
1122789680 14:104178996-104179018 ATTCCAGCGGACAGCAGCAGTGG - Intronic
1122878664 14:104680185-104680207 TTCCCTGCACACAGCTGAAGTGG + Intergenic
1123035827 14:105471562-105471584 CTCCTGGGAGACAGCAGAAGTGG - Intergenic
1125729160 15:41883090-41883112 TGCTCAGCAGACAGCAGAGCTGG - Exonic
1127191153 15:56532029-56532051 TTTCCACCAGGCACCAGAAGTGG + Intergenic
1127358253 15:58222466-58222488 TTCCCAGGAGAAAGGAAAAGAGG - Intronic
1127494056 15:59493052-59493074 GGCCCAGCAGAGGGCAGAAGAGG - Intronic
1128753341 15:70164441-70164463 AGCCCAGCAGAAAGCAGCAGAGG - Intergenic
1128835592 15:70806792-70806814 TTTCCAGCATCCAGCAGAAGAGG + Intergenic
1129388955 15:75210984-75211006 TCTCCAGCAGACTGCGGAAGCGG - Exonic
1131219660 15:90571763-90571785 TTCCCAGAAAACTGCAGAAAGGG - Intronic
1132382108 15:101373198-101373220 CTCCCTGCAGGCAGCAGCAGCGG - Intronic
1132563398 16:609264-609286 TTCCCAGCAGGGAGCACAGGAGG + Intronic
1133009148 16:2900718-2900740 TTCCCAGGCAACAGCAGGAGGGG - Intergenic
1135179866 16:20263338-20263360 TTGTCAGGAGACAGCAGGAGCGG + Intergenic
1136072599 16:27796987-27797009 TTCCTGGCACACAGCAGGAGTGG - Intronic
1136248740 16:28989943-28989965 TTCCCAGGAGGCAGAGGAAGTGG + Exonic
1136711078 16:32237797-32237819 CTCCCAGGCCACAGCAGAAGCGG + Intergenic
1136756829 16:32691613-32691635 CTCCCAGGCCACAGCAGAAGCGG - Intergenic
1136811280 16:33178762-33178784 CTCCCAGGCCACAGCAGAAGCGG + Intergenic
1136817756 16:33288842-33288864 CTCCCAGGCCACAGCAGAAGCGG + Intronic
1136824320 16:33345371-33345393 CTCCCAGGCCACAGCAGAAGCGG + Intergenic
1136829386 16:33444142-33444164 CTCCCAGGCCACAGCAGAAGCGG + Intergenic
1137736595 16:50729072-50729094 ATGGCAGCAGACAGGAGAAGAGG + Intronic
1138512267 16:57515520-57515542 TTCCCAGGGAACAGCAGGAGTGG - Intronic
1139507283 16:67405286-67405308 TTCCCATCAGACAGAGGAGGAGG + Intronic
1139990470 16:70935909-70935931 TTGCCAGGAGACAGAAGCAGAGG - Intronic
1140871726 16:79112929-79112951 ATGCCAGCAGAGAGCAAAAGTGG - Intronic
1140929832 16:79617281-79617303 TGCCTAGGAGACAGCAGCAGGGG - Intergenic
1141789945 16:86227529-86227551 TTCCCTTAAGACAGCAGAACCGG - Intergenic
1141950477 16:87336099-87336121 TCCCCAGCACACACCAGGAGAGG + Intronic
1142193983 16:88731133-88731155 TTCCCAAGAGACAGGAGAGGCGG + Intronic
1202989858 16_KI270728v1_random:1731-1753 CTCCCAGGCCACAGCAGAAGCGG + Intergenic
1203058979 16_KI270728v1_random:951965-951987 CTCCCAGGCCACAGCAGAAGCGG - Intergenic
1142629743 17:1217073-1217095 TTCCCTGCTGTCAGCAGGAGTGG + Intronic
1145277521 17:21442103-21442125 TTCCCAGGAGCCAGCTGAGGAGG - Intergenic
1145315357 17:21727997-21728019 TTCCCAGGAGCCAGCTGAGGAGG - Intergenic
1145713790 17:26999934-26999956 TTCCCAGGAGCCAGCTGAGGAGG - Intergenic
1146009231 17:29180327-29180349 CGCCCGGCAGGCAGCAGAAGCGG + Exonic
1146063895 17:29620964-29620986 TTCCCAGCAGGGACCAGGAGGGG - Intronic
1146724797 17:35148254-35148276 GTCCCAGCAGATGGCAGAGGTGG + Exonic
1146891677 17:36510430-36510452 TTGCCAGCAGACAGCTGAGCAGG + Intronic
1146934606 17:36804985-36805007 TTCCCTGCAGATAGTAGAGGAGG - Intergenic
1147506374 17:41021601-41021623 TTCCCAGCTGACAGCAGAAGAGG + Intergenic
1148867770 17:50637881-50637903 TCCCCAGCAAACAGCTGAAATGG - Intronic
1149738503 17:59019763-59019785 TTACCAGAAGATAGTAGAAGGGG + Intronic
1150557935 17:66270153-66270175 TTACCAGCAGCCGGGAGAAGGGG - Intergenic
1151935005 17:77256164-77256186 GTCCCAGCAGAGAGCTGCAGTGG + Intergenic
1151983349 17:77527127-77527149 TTACCTGCAGGCAGCAGATGTGG - Intergenic
1152096195 17:78273084-78273106 TGCCCTTCAGACAGCAGGAGGGG + Intergenic
1152616622 17:81340945-81340967 GTCCCCGCAGAAAGCAGAGGAGG + Intergenic
1152930043 17:83104774-83104796 GGCCCAGCAGACATCAGATGTGG + Intergenic
1153006946 18:505314-505336 ATCCCAGCAGGCAGCACAAATGG - Intergenic
1153050839 18:901836-901858 TACCCAATAGAAAGCAGAAGGGG + Intergenic
1156341891 18:36217086-36217108 TTCGATGCAGACAGCAGAGGTGG + Intronic
1157713271 18:49864455-49864477 TTCCCAGTGGACAAAAGAAGGGG - Intronic
1158033710 18:52999119-52999141 TTCACTGCACAAAGCAGAAGTGG - Intronic
1158825332 18:61212284-61212306 TCCCTTGTAGACAGCAGAAGAGG - Intergenic
1159395262 18:67847162-67847184 TTCCCACACGCCAGCAGAAGTGG - Intergenic
1159885122 18:73896411-73896433 TTCCCAGCTGAAAGGTGAAGAGG + Intergenic
1160903446 19:1440674-1440696 GTCCCTGCAGACAGGAGCAGGGG - Exonic
1160955866 19:1691495-1691517 TTCCCAGCAGCCTGGAGCAGGGG - Intergenic
1162708553 19:12574258-12574280 TTTGCGGCAGAAAGCAGAAGGGG - Intronic
1162849592 19:13420572-13420594 TTGCCAGGAGCCACCAGAAGAGG + Intronic
1163798238 19:19349406-19349428 TTCCCAGCACATAGAAGATGTGG - Exonic
1164748775 19:30635859-30635881 TTTCCAGCAGGCAGGAGAGGAGG - Intronic
1164917537 19:32063976-32063998 TTCCCAGTGGACATCAGAGGGGG - Intergenic
1165168424 19:33872926-33872948 GTCCCAGCAGGCAGATGAAGGGG + Intergenic
1165797949 19:38529684-38529706 TTTCCAACAGACAGAAGTAGTGG + Intronic
1166625312 19:44346663-44346685 TTTCCAGCAGGCAGCAGGAATGG - Intronic
1166953508 19:46446327-46446349 AATCCAGGAGACAGCAGAAGAGG + Intergenic
1167601060 19:50455078-50455100 CTCCAAGCAGAGAGGAGAAGAGG - Intronic
1167940377 19:52941850-52941872 TTGCCAAGAGACAGCAAAAGTGG - Intronic
925197293 2:1936622-1936644 TTCACTGCAGTCAGCAGAAAAGG - Intronic
925512413 2:4642478-4642500 TTCCTAGCAGTGAGAAGAAGTGG - Intergenic
925569381 2:5292731-5292753 TTGGCAGCAGACAAGAGAAGAGG - Intergenic
926007836 2:9386556-9386578 TTCTCAGCAGACAGCAGCCGTGG + Intronic
926583991 2:14665205-14665227 TCCCTAGCATACAGCAGTAGTGG - Intergenic
927146958 2:20172491-20172513 TGCCCAGGAGCCAGCAGAAGTGG + Intergenic
928260414 2:29761621-29761643 TTCCCAGCAGACAGCAGAAGAGG - Intronic
928367194 2:30711940-30711962 TCCCCAGCATCCAGCAGAGGAGG + Intergenic
928371857 2:30745671-30745693 CCACCAGCAGACAGCAGCAGAGG + Intronic
929544665 2:42847850-42847872 TTCCCAGCCTACAGTAGACGAGG - Intergenic
929773190 2:44910051-44910073 GAGCCAGCAGACAGCAGAATTGG + Intergenic
930031078 2:47058432-47058454 GTCCCAGTAGGCAGCAGGAGAGG - Intronic
930410177 2:51015522-51015544 CTCCCAGCTAACAGCAGGAGAGG + Intronic
932446076 2:71782431-71782453 ATCCCAGCAGAGAGCAGAAATGG + Intergenic
932731018 2:74222034-74222056 TTCTCAGCAGACAGCTGAGAGGG - Intronic
933286886 2:80394300-80394322 TCCCCAGCAGTCATCAGAAGTGG - Intronic
934929861 2:98413027-98413049 TTTCCAGCAGATGGCAGTAGAGG + Intergenic
936439899 2:112542386-112542408 TTCCCAGCAGGCTGCGGAAACGG + Exonic
936559811 2:113527479-113527501 TTCCGTGCAGACAGGAGCAGAGG + Intergenic
938654537 2:133417511-133417533 TTCCCAGCAGAGAGCTGTCGAGG + Intronic
938958414 2:136319637-136319659 TGCCCAGCACACAGCAGACCCGG - Intergenic
939634564 2:144565613-144565635 GTCCCAGGGGACAGAAGAAGTGG + Intergenic
939856108 2:147360470-147360492 ATCCCAGCTGACACCAGGAGTGG + Intergenic
940672501 2:156687946-156687968 TCCCCAGCAGTCAGCAGGTGGGG - Intergenic
942120188 2:172769205-172769227 TTGACAGTAGACAGCAGAAAAGG + Intronic
942525677 2:176850283-176850305 TTCCCAGCAGGTAGCAGAGTTGG - Intergenic
943568183 2:189541692-189541714 TTCCCAGGACAAAGCTGAAGCGG - Intergenic
946185844 2:217979934-217979956 TTCTCAGCAGACTGCAGAAAGGG + Intronic
948208328 2:236174489-236174511 TTCCCAGGAGAGAACAGGAGGGG + Intergenic
948799629 2:240426214-240426236 GTCCCAGGAAACAGCAGCAGGGG + Intergenic
1170455478 20:16528922-16528944 TTCTCAGAAAACAGCAGAACAGG + Intronic
1171495153 20:25549558-25549580 TTCCTAGCACAGAGCAGGAGAGG - Intronic
1171880154 20:30612732-30612754 ATCCCAGGAAACACCAGAAGAGG + Intergenic
1173613832 20:44390003-44390025 TACCCACCAGCCAGCACAAGAGG + Intronic
1174120998 20:48265451-48265473 CTTCTAGCTGACAGCAGAAGGGG + Intergenic
1174174419 20:48635993-48636015 TCCCCACCAGCCAGCAGCAGGGG + Intronic
1174787256 20:53444463-53444485 TTCCCAGCACACTGCAGTACCGG - Intronic
1174891331 20:54398332-54398354 TTCTCAGCAGACAGAAGAGCTGG - Intergenic
1175096475 20:56545166-56545188 TCCCCAGCAGACACCAGCTGGGG - Intergenic
1175598589 20:60254965-60254987 TTCAGAGCAAACAGCAAAAGAGG - Intergenic
1175608979 20:60334455-60334477 TGCCCAGCTGACAGTGGAAGAGG + Intergenic
1176119186 20:63446394-63446416 TCCCCAGCAGACGGCAGACGTGG - Intronic
1176410389 21:6446655-6446677 TTGCCAGGAGAAAGCAGGAGGGG - Intergenic
1177498835 21:21924186-21924208 TTGCCAGCAACCACCAGAAGAGG + Intergenic
1178280079 21:31274557-31274579 CTCCTAGCAGACAGCAGGACAGG + Intronic
1178985378 21:37298647-37298669 TTCCCAGGGGACAGCAGAACAGG - Intergenic
1179685882 21:43054977-43054999 TTGCCAGGAGAAAGCAGGAGGGG - Intronic
1180113739 21:45681786-45681808 TTTCCAGAAGACAAAAGAAGAGG - Intronic
1181849198 22:25737708-25737730 TCCCCCGCAGACAGCACCAGTGG + Intergenic
1183630671 22:39030702-39030724 TTCCCAGCAGAAGGCAGACAGGG + Intronic
1183634127 22:39050794-39050816 TTCCCAGCAGAAGGCAGACAGGG + Intronic
1184145687 22:42608985-42609007 ATCCCAGCAGGCAGCAGTACTGG + Intronic
1184252355 22:43268017-43268039 TTCCAAGCTCACAGCAGAGGGGG - Intronic
951357443 3:21685403-21685425 TTCATAAAAGACAGCAGAAGTGG + Intronic
952179662 3:30904462-30904484 CTGTCAGGAGACAGCAGAAGAGG - Intergenic
953930104 3:47001649-47001671 TTCCCAACAGACATCACCAGGGG - Intronic
955146253 3:56323054-56323076 CTCACAGCAGAAAACAGAAGGGG - Intronic
955592240 3:60550302-60550324 TCCACAGGAGACAGTAGAAGAGG + Intronic
956091750 3:65674956-65674978 TTCCCAACAGACAGGAGAGAGGG + Intronic
958645080 3:96859730-96859752 ATCCCAGTAGACAACAGAAAGGG - Intronic
958825002 3:99019742-99019764 TCCTCAGCAGAAAGCAGAATTGG + Intergenic
961547481 3:127645348-127645370 TTCCCAGCAGATGGGACAAGAGG - Intronic
962192756 3:133328629-133328651 TTCCAGGCAGATAGCAGAGGTGG + Intronic
962350411 3:134651830-134651852 TGCCCAGCCAACAGCAGCAGGGG + Intronic
962601124 3:136991574-136991596 TTCCCAGAAGGCAGCAGGACTGG - Intronic
963403379 3:144831778-144831800 TTCCCAGTTCACAGCAGAGGTGG + Intergenic
965342956 3:167512341-167512363 CCCCCAGCAAACTGCAGAAGAGG + Intronic
965707555 3:171524363-171524385 TGCCCAGCAAGCAGCAGAAGGGG + Intergenic
966808944 3:183826689-183826711 GTCCCAGCAGGCAGCAGGCGAGG + Intergenic
966956463 3:184885297-184885319 TTCCCTGTAGTCAGCAGAAAAGG + Intronic
967068758 3:185943678-185943700 TTCCCAGCAGCAACCAGCAGAGG + Intergenic
967972437 3:195009301-195009323 TTGCAAGTATACAGCAGAAGTGG + Intergenic
968103559 3:195985247-195985269 GTCCCAGAAGACAGCAGCACAGG + Intergenic
968301861 3:197622840-197622862 GTCCCAGAAGACAGCAGCACAGG + Intergenic
968486716 4:866498-866520 TTGCCTGAAGACGGCAGAAGCGG + Exonic
969488857 4:7487340-7487362 TCCCCATCCTACAGCAGAAGGGG + Intronic
969505680 4:7585875-7585897 TTCCTTGCAGACATCTGAAGGGG + Intronic
969593112 4:8133068-8133090 TTGCCGGCTGCCAGCAGAAGCGG - Intronic
971943108 4:33240905-33240927 ATTCCAGCAGACTGCAGAAGAGG - Intergenic
972585864 4:40436632-40436654 TTACAAGCAGGCAGCATAAGAGG - Exonic
973721017 4:53723789-53723811 TTCCCGCCAGAGAGAAGAAGAGG - Intronic
978118182 4:105047504-105047526 TGCCCAGCCGTCAGCAGAATAGG + Intergenic
978638050 4:110834709-110834731 TTCCCAGCAGCCAACACAAGAGG + Intergenic
979924359 4:126542015-126542037 ATCCCAGGAGACAGCAACAGAGG + Intergenic
980178494 4:129375751-129375773 CAGCCAGCAGACAGGAGAAGTGG - Intergenic
982458602 4:155639817-155639839 GACCCAGCAGAAAGCTGAAGTGG + Intergenic
982559586 4:156913879-156913901 TTGTCAGCAGACAGCAGCAAAGG - Intronic
984048125 4:174828975-174828997 TTCTCAGCATTGAGCAGAAGTGG + Exonic
986312058 5:6558069-6558091 TGCTCAGCAGACAGAAGCAGAGG + Intergenic
986595791 5:9420503-9420525 ATACCAGCAGTCAGCAGCAGTGG - Intronic
987331601 5:16862120-16862142 TTCCCACCACTCAGCAGAAAGGG + Intronic
987857040 5:23433827-23433849 TTGCCAGCTGGTAGCAGAAGAGG - Intergenic
989311067 5:40018519-40018541 TTACCAGCTCACAGCAGGAGAGG + Intergenic
990105707 5:52256950-52256972 TTCCAAGCAGCCAGGGGAAGGGG - Intergenic
990527285 5:56640462-56640484 TTGACCACAGACAGCAGAAGAGG + Intergenic
990687546 5:58323098-58323120 TTCCAGGCAGACAGCAAAATGGG + Intergenic
991009080 5:61863423-61863445 TTCCCCGCAGTGAGTAGAAGCGG + Intergenic
991011062 5:61883544-61883566 TACCCTGCAGACAGGACAAGTGG - Intergenic
991155766 5:63433066-63433088 TTACCGGCAGACAGATGAAGAGG + Intergenic
992075727 5:73191125-73191147 TTCCCAGCAGACACCATAGGTGG - Intergenic
992275088 5:75107543-75107565 TGCCAAGCAGAAAGCAGAAAGGG - Exonic
992744790 5:79808518-79808540 TTCACAAGAGACAGCAAAAGGGG - Intergenic
993802524 5:92360267-92360289 TTCCCAGAGGACAGTAGAAAGGG - Intergenic
994079347 5:95689200-95689222 TTACCAGGAAACAGCAGAAAGGG - Intronic
995093820 5:108212570-108212592 ACTCCAGCAGACAGCAGCAGAGG - Intronic
996475307 5:123912439-123912461 TTCCTACCAGACAGCATAAAGGG - Intergenic
996712266 5:126554987-126555009 TTTCCAGCAGACAGCACAGTAGG + Intronic
997212027 5:132082492-132082514 TTCAGCACAGACAGCAGAAGAGG + Intergenic
998542815 5:142998940-142998962 TTACCAGCAAACAGCAAAATTGG - Intronic
1000101027 5:158016359-158016381 TTCCCAGCATACAGCATCACTGG - Intergenic
1000115129 5:158146876-158146898 TTCCGAAAAGAGAGCAGAAGGGG - Intergenic
1000287156 5:159836696-159836718 TTGCCAGCAGACAACAGAGTGGG - Intergenic
1001262999 5:170248752-170248774 TTCCCATCAATGAGCAGAAGTGG + Exonic
1001436281 5:171702170-171702192 TGCCCAGCTGACAGCAGAGAAGG - Intergenic
1004025479 6:11814255-11814277 TTCCCAGCAGAACTGAGAAGAGG + Intergenic
1004278954 6:14264253-14264275 TGCCCAGCAAACAGCAGGAGTGG - Intergenic
1005146310 6:22694113-22694135 TTCCTAACATACAGCAGAAAAGG - Intergenic
1005658469 6:27967658-27967680 TTCTCAGCAGAGACCTGAAGTGG + Intergenic
1006067671 6:31474108-31474130 CTCCCACCAGCCAGCTGAAGAGG + Intergenic
1006719760 6:36142647-36142669 AGCCCAGCAGGAAGCAGAAGTGG + Intronic
1007060698 6:38938017-38938039 TACCAAGCAGACAGCAGCTGAGG + Exonic
1007509792 6:42366115-42366137 CACCCAGCAGACTGCAGGAGAGG - Intronic
1007782695 6:44263532-44263554 TTAGCAGCAGGCAGCAGGAGAGG + Intronic
1010007192 6:71009149-71009171 TAACCAGAAGAGAGCAGAAGTGG - Intergenic
1010059874 6:71610429-71610451 TTCCCAGCACGCAGTGGAAGAGG - Intergenic
1012305863 6:97656390-97656412 TTCCTGGCTGACAGCACAAGGGG - Intergenic
1013424485 6:109998581-109998603 GGCCCAGCGGATAGCAGAAGAGG - Intergenic
1014081009 6:117286085-117286107 TTGAGAGCAGACAGCAGAACGGG + Intergenic
1016329387 6:142940887-142940909 TTCTCGGCAGAAAGCAGAGGGGG - Intronic
1020016205 7:4833665-4833687 TCCCCGGCAGACAGGGGAAGGGG - Intronic
1020140588 7:5609499-5609521 GTCACAGCAGACAGCAGTGGGGG - Intergenic
1021913102 7:25405877-25405899 TTCCCGGGAGAGAGCAGAGGAGG - Intergenic
1022959217 7:35410301-35410323 TTCCCAGGAGAAAGGAGAAGTGG - Intergenic
1024051224 7:45624631-45624653 TGCCCAGCAGAAAGATGAAGTGG - Intronic
1024177090 7:46851625-46851647 TTCACAGCAGACAGGATTAGAGG + Intergenic
1024184859 7:46939714-46939736 TCTCCAGCTGACGGCAGAAGAGG + Intergenic
1024343842 7:48292794-48292816 CTACCAGCAGACAGCTGTAGGGG - Intronic
1026386513 7:69855094-69855116 TTCCCAGCATTCAGCGTAAGGGG - Intronic
1027258375 7:76445815-76445837 TTCTCAGCAGAAAGAGGAAGTGG + Intergenic
1027280473 7:76606203-76606225 TTCTCAGCAGAAAGAGGAAGTGG - Intergenic
1027932647 7:84557939-84557961 TTGCCAAAAGATAGCAGAAGTGG + Intergenic
1029269690 7:99369761-99369783 ATCCCAACTGACAGCAGGAGGGG - Intronic
1030126130 7:106154025-106154047 ATTCCAGCAGAGAGCAGCAGAGG - Intergenic
1031195150 7:118603879-118603901 TTCCCAGAGTACAGAAGAAGAGG + Intergenic
1031749178 7:125549075-125549097 TTCCTAGCAGAAAAAAGAAGTGG + Intergenic
1031957364 7:127955998-127956020 TTCCAAGTAGAGAGCAGAAAGGG - Intronic
1032355358 7:131205866-131205888 TTCTCAGCTGGAAGCAGAAGAGG - Intronic
1032511010 7:132472511-132472533 CTCTCAACAGACAGCAGCAGGGG + Intronic
1033730434 7:144173039-144173061 TTACCAGTGGAAAGCAGAAGCGG - Intergenic
1035249286 7:157586588-157586610 TACCCAGCATCCAGCAGCAGGGG - Intronic
1037391797 8:18400672-18400694 TTCCTTGCAGACCCCAGAAGGGG + Exonic
1037953337 8:23033784-23033806 TTCCTTGCACACACCAGAAGAGG + Intronic
1038481502 8:27904964-27904986 AGCCCAGCAGGCAGGAGAAGAGG + Intronic
1040817914 8:51528178-51528200 TTCTCAGCTGCCAGGAGAAGCGG - Intronic
1041540556 8:58980312-58980334 CTCCCAGGAGACAGCTGATGAGG - Intronic
1042485921 8:69345609-69345631 TTGCCAGCACACAGCAGCTGGGG - Intergenic
1042967133 8:74365560-74365582 TACCCACCAGACACCAGAAATGG - Exonic
1043208792 8:77483950-77483972 TTCCCTGCAGACAGCCAAAAGGG + Intergenic
1043584987 8:81758484-81758506 TTCCCAGAGGGCAGAAGAAGAGG + Exonic
1044190570 8:89311659-89311681 TTCCCAGCAGTTAGTAGAACTGG + Intergenic
1044953267 8:97453962-97453984 TCCCCAGCAGACAGCAAAGAAGG - Intergenic
1045409572 8:101903726-101903748 TTACCAGCAGAGAGGAAAAGTGG + Intronic
1047542790 8:125786653-125786675 TCCCCAGGAGCCAGAAGAAGGGG - Intergenic
1048653796 8:136512352-136512374 TTCCCAGGAGACATCAGTAATGG - Intergenic
1049893057 9:88893-88915 TTCCGTGCAGACAGGAGCAGAGG - Intergenic
1050276846 9:4009490-4009512 TTCCCACCAGAGAGCAGAACTGG + Intronic
1051352659 9:16213155-16213177 TTCCCAACAGATTTCAGAAGGGG + Intronic
1052964944 9:34333129-34333151 TTCCCAGAAAAGAGCAGAGGAGG + Intronic
1053734275 9:41088946-41088968 TTCCGTGCAGACAGGAGCAGAGG - Intergenic
1054694119 9:68342626-68342648 TTCCGTGCAGACAGGAGCAGAGG + Intronic
1056283812 9:85068438-85068460 ATCTCAGCAGACAAGAGAAGAGG - Intergenic
1056706642 9:88957764-88957786 CTCCCCGCAGACACCAGCAGTGG - Intergenic
1057175357 9:92993308-92993330 TAACCAGAAGACAGCAGGAGTGG - Intronic
1057476968 9:95411365-95411387 TTCCCAGCTGAGTGCAGAAAGGG + Intergenic
1058878683 9:109267368-109267390 TAGACAGCAGACAGAAGAAGAGG + Intronic
1059465377 9:114466099-114466121 TTCACAGCTCACAGCAGCAGCGG - Intronic
1061393411 9:130330278-130330300 TTCCCCACAGACAGGAGAAGGGG - Intronic
1061404991 9:130388792-130388814 CTCCCATGAGACAGCAGACGTGG + Intronic
1061547564 9:131313500-131313522 TTCCCAGAATACAGAAGAACGGG + Intergenic
1061958061 9:133973863-133973885 TTCCCAGCAGTCAGCTGAGTGGG - Intronic
1062537884 9:137028758-137028780 TTCCGAGCAGCCAGCGGAAGGGG + Intronic
1062723887 9:138060387-138060409 TTCCCAGTAGAAACCAGCAGAGG + Intronic
1186073430 X:5849221-5849243 TTTCCAGCAGGCAGAAGAAATGG + Intronic
1186654763 X:11600778-11600800 TTCCCAGGAAACACCAGTAGGGG + Intronic
1188078631 X:25808518-25808540 GTCACAGCAGAAAGCAGAACTGG - Intergenic
1189377917 X:40480269-40480291 TTCCCAGCAGAAAGGAGATGTGG - Intergenic
1189682114 X:43527493-43527515 TTCCCAGGAGAGAGCAGTAAGGG + Intergenic
1190023882 X:46904184-46904206 CTCCCAGCAGGCATCAGCAGAGG + Intergenic
1191788659 X:64945337-64945359 ACTCCAGCAGACTGCAGAAGAGG - Intronic
1192041098 X:67622335-67622357 CTCACAGAAGACAGCAGATGTGG + Intronic
1192062899 X:67848197-67848219 TTACCAGAAGAGAGCAGGAGTGG + Intergenic
1192961687 X:76138124-76138146 GTCCAAGTAGACACCAGAAGAGG - Intergenic
1194366607 X:93020848-93020870 TTCCTAGGAGAGAGAAGAAGGGG + Intergenic
1195446374 X:104957246-104957268 TTCCAAGCTCACTGCAGAAGTGG - Intronic
1195570183 X:106391964-106391986 TTCCCAGCAGAAAGAGCAAGTGG + Intergenic
1196243188 X:113367072-113367094 ATCACAGCAGAGAGCAGAATTGG - Intergenic
1197970526 X:132110477-132110499 ATCCCAGCAGAAGGCAAAAGGGG - Intronic
1198071941 X:133157901-133157923 TAACCAGAAGAGAGCAGAAGTGG - Intergenic
1198794279 X:140379138-140379160 TTCACAGCAGAGAGTAGATGGGG - Intergenic
1199628567 X:149761216-149761238 TCTCCAGGAGACATCAGAAGAGG - Intergenic
1199659500 X:150034581-150034603 TTCCCAGAAGTCATCAGAAAGGG + Intergenic
1200674834 Y:6137109-6137131 TTCCTAGGAGAGAGAAGAAGGGG + Intergenic
1201595139 Y:15659886-15659908 TTGCCAGTAGACAGGTGAAGGGG - Intergenic