ID: 928260439

View in Genome Browser
Species Human (GRCh38)
Location 2:29761797-29761819
Sequence GGGTGAGCAATCTCTCCCTT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 126
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 116}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
928260433_928260439 6 Left 928260433 2:29761768-29761790 CCTCCTAGACAAAAACAGACTTC 0: 1
1: 0
2: 1
3: 6
4: 163
Right 928260439 2:29761797-29761819 GGGTGAGCAATCTCTCCCTTTGG 0: 1
1: 0
2: 0
3: 9
4: 116
928260434_928260439 3 Left 928260434 2:29761771-29761793 CCTAGACAAAAACAGACTTCTGG 0: 1
1: 0
2: 2
3: 19
4: 242
Right 928260439 2:29761797-29761819 GGGTGAGCAATCTCTCCCTTTGG 0: 1
1: 0
2: 0
3: 9
4: 116
928260432_928260439 25 Left 928260432 2:29761749-29761771 CCTCTGTGAACAAGAGTCACCTC 0: 1
1: 0
2: 0
3: 13
4: 142
Right 928260439 2:29761797-29761819 GGGTGAGCAATCTCTCCCTTTGG 0: 1
1: 0
2: 0
3: 9
4: 116

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
928260439 Original CRISPR GGGTGAGCAATCTCTCCCTT TGG Intronic
900330672 1:2133035-2133057 GGGTGAACAAACTCTCCCACAGG - Intronic
901481819 1:9530407-9530429 AGGTCAGCACACTCTCCCTTAGG - Intergenic
913029823 1:114890251-114890273 GGGTGAGCAAAATTTCCTTTAGG + Intronic
915038730 1:152949814-152949836 GGGTGAGCACTGTCTCCCCGTGG - Intergenic
916680211 1:167096917-167096939 GGGTGTGCATTCTGTCCCTCAGG + Intronic
919325373 1:196100220-196100242 GGGTGAGCCTCCTCTGCCTTTGG + Intergenic
920438965 1:205965859-205965881 GGGATTGCAATTTCTCCCTTGGG - Intergenic
921014654 1:211177511-211177533 GAGGGAGCATTCTCTCCTTTGGG + Intergenic
921165938 1:212507253-212507275 GGGTCAGCACTCTCAGCCTTAGG + Intergenic
921634644 1:217477621-217477643 GGGTGAGGATCCTCTGCCTTTGG + Intronic
1070424608 10:76273081-76273103 GGGTGAGCATCCTCTCACTTAGG + Intronic
1071046644 10:81387316-81387338 GGGTGAGGATCCTCTGCCTTTGG - Intergenic
1075412275 10:122237389-122237411 GGGTGAGCAGCCTCTCTCTGTGG - Exonic
1078441315 11:11371255-11371277 GGGTGTCCAATCTCCCCTTTAGG + Intronic
1086123434 11:83325904-83325926 GGCTGAGCATTCTCGTCCTTGGG + Intergenic
1088045812 11:105449308-105449330 GGGTGAGCCTCCTCTGCCTTTGG + Intergenic
1089426407 11:118379749-118379771 AGGTAAGCAGGCTCTCCCTTGGG + Exonic
1091734859 12:2912412-2912434 GGGTGTGCACTGTATCCCTTGGG - Intronic
1091776032 12:3185539-3185561 GGATGACCAGTCTCCCCCTTCGG + Intronic
1096158535 12:49356935-49356957 GGGTGAGCCACCTTTCCATTAGG + Intronic
1097907343 12:64933668-64933690 TGGTGAGCAATCTATCAGTTTGG + Intergenic
1099100706 12:78436899-78436921 TGGGGACCTATCTCTCCCTTTGG + Intergenic
1104463409 12:128972061-128972083 GAATGAGCAAGCTGTCCCTTGGG + Intronic
1108673017 13:52710891-52710913 GGATGAGTAATTTCTCACTTGGG - Intronic
1111408134 13:87836743-87836765 GGGCAAGTAATCTTTCCCTTAGG + Intergenic
1111803565 13:93009709-93009731 GGGTGAGCAAACTTTTCCTAAGG - Intergenic
1112424213 13:99282021-99282043 GGGTGAGGAAACTCTAGCTTAGG - Intronic
1115988032 14:39122608-39122630 GGGTCAGCAAACTCTACCCTGGG + Intronic
1116504788 14:45665131-45665153 GGGTGAGGCTTCTCTGCCTTTGG - Intergenic
1126709395 15:51440877-51440899 GGGTGAGGCTCCTCTCCCTTTGG - Intergenic
1127703828 15:61527865-61527887 GGGAGAGCCATCTGTCACTTGGG + Intergenic
1128079584 15:64848434-64848456 GGGTTAGGAATATCTGCCTTGGG + Intronic
1129312087 15:74719969-74719991 GGCTGAGCAATCTGACCCTATGG - Exonic
1132066517 15:98735452-98735474 GGGTGAGCAATCTGTTCCAGTGG + Intronic
1132407394 15:101552139-101552161 GCGGGAGCAATCTCTGCCATGGG + Intergenic
1137903523 16:52295167-52295189 GGTTGAGGAATCTCTCACTTAGG + Intergenic
1143021398 17:3918771-3918793 GGGTGAGAAATCACAGCCTTTGG - Intergenic
1143430092 17:6875433-6875455 GCATGAGCAATCTGTGCCTTAGG - Intergenic
1147360028 17:39924584-39924606 GAGTGAGAATTCTCTCCCTGGGG - Intronic
1148048314 17:44757550-44757572 GGGAGCACAATCTCTCCCTCTGG + Intergenic
1150382039 17:64728628-64728650 GGCTGAGCCATCTGTCCCTCTGG - Intergenic
1154156856 18:11950644-11950666 AGGTGTGCAATCTATCCCCTGGG + Intergenic
1156611178 18:38726521-38726543 AGGTTTGCAATCTCTTCCTTTGG + Intergenic
1159616488 18:70585917-70585939 GTGTCAGCAATATCTCCTTTGGG - Intergenic
925112892 2:1351803-1351825 GGGTGAGCATTCTCCACCATGGG - Intronic
928260439 2:29761797-29761819 GGGTGAGCAATCTCTCCCTTTGG + Intronic
930600198 2:53433789-53433811 GGGTGGGAAATTTCCCCCTTAGG + Intergenic
931171464 2:59807983-59808005 CGGTGACAAATCTCTCCTTTTGG - Intergenic
932948188 2:76262145-76262167 GGGAGAGCAATTTTTCCCTATGG + Intergenic
936858846 2:116992244-116992266 GGATGAGCAAACTCCCCCCTAGG + Intergenic
937000982 2:118467379-118467401 GGGTGAACAATCTATCCCCTGGG + Intergenic
937111975 2:119373443-119373465 TGGTGTGAAATCTGTCCCTTGGG + Intergenic
940154794 2:150644261-150644283 GGGTCAGCAATTTCTCATTTTGG - Intergenic
942430344 2:175904731-175904753 GGGTGATAAATGTTTCCCTTGGG + Intergenic
942734648 2:179096429-179096451 GGGTGAGCTTCCTCTGCCTTCGG - Intergenic
947938867 2:234031149-234031171 GGGTGATAAGACTCTCCCTTAGG - Intergenic
948505005 2:238422611-238422633 GGGCCAGCACTCTCTCCCTGGGG - Intergenic
1168832328 20:853377-853399 AGGTCAGCAATCTCTCCTTCCGG - Intronic
1170799448 20:19578976-19578998 GGGTGAGAAATGGCTCCCTTTGG + Intronic
1174585815 20:51607377-51607399 GGGTGAGCAGGGTCTCCCCTGGG + Intronic
1176289245 21:5035515-5035537 GGGGGAGCCACCTCTCACTTTGG - Intronic
1177326470 21:19596083-19596105 GGGTGAGCAGGGTCTCTCTTAGG - Intergenic
1179867990 21:44228089-44228111 GGGGGAGCCACCTCTCACTTTGG + Intronic
949155925 3:827243-827265 GGGTGAGGCAACTCTGCCTTTGG + Intergenic
951218254 3:20043834-20043856 GGTAGAGCAATCTGTCCTTTTGG - Intronic
953309473 3:41863199-41863221 AGGTGAGGATCCTCTCCCTTTGG - Intronic
953362354 3:42309247-42309269 GGCAGAGAAATCTCTCCCTGTGG + Intergenic
954491658 3:50912688-50912710 GGGTGAGGTTTCTCTGCCTTTGG - Intronic
956701324 3:71961521-71961543 GACTGACCGATCTCTCCCTTTGG - Intergenic
958078906 3:88719969-88719991 GGTTGAGCAACCTCTTGCTTAGG + Intergenic
958716324 3:97786571-97786593 AGCTGAGAAATCCCTCCCTTGGG - Intronic
959761948 3:109976596-109976618 GGGTGAGGCTTCTCTGCCTTTGG - Intergenic
962421747 3:135234969-135234991 TGATGAGCAATGTCTTCCTTGGG - Intronic
965350963 3:167610437-167610459 GGGTGAGGCTTCTCTGCCTTTGG + Intronic
967948242 3:194820902-194820924 TGGGGAGGATTCTCTCCCTTAGG - Intergenic
972851661 4:43057656-43057678 GGGTGAGGCCTCTCTGCCTTTGG + Intergenic
976451812 4:85199376-85199398 GGGTGAGGCTTCTCTGCCTTTGG - Intergenic
978030974 4:103939459-103939481 GGGTGAGGCTTCTCTGCCTTTGG + Intergenic
979878855 4:125928888-125928910 GGGTGAGGATCCTCTGCCTTTGG + Intergenic
990804344 5:59641646-59641668 GGATGAGCATTCTCTGCCTATGG - Intronic
991174633 5:63672924-63672946 GGCTTAGCAATCTCACCATTGGG + Intergenic
995770661 5:115665616-115665638 GGGTGAGGCATCTCTACCTGTGG + Intergenic
1000270276 5:159677431-159677453 GGGTGAGACTTCTCTGCCTTTGG + Intergenic
1007047674 6:38794133-38794155 CGGGGAGCAAATTCTCCCTTGGG - Intronic
1009923176 6:70088285-70088307 GCCTGAGCAATTTCTACCTTAGG - Intronic
1010019027 6:71138797-71138819 TGGTGACCCATCTCTCCCTCTGG - Intergenic
1010328116 6:74588324-74588346 GGGTGAGGTATCTCTGCTTTTGG + Intergenic
1013209922 6:107977630-107977652 GGGTGAGGAATCTCACTCTGTGG + Intergenic
1018832054 6:167450860-167450882 AGGTGAGCAAGCACTTCCTTGGG + Intergenic
1018834230 6:167471142-167471164 GGGTGAGCACTCTCTCCCCGAGG - Intergenic
1019196376 6:170285548-170285570 GGGTAAGCCTTCTCTCCCTGAGG - Exonic
1020814748 7:12891587-12891609 GGGTAAACAAACTCTCCCTTGGG - Intergenic
1023548699 7:41345779-41345801 GGATGAGCAATCTCTCAACTGGG - Intergenic
1026208994 7:68286248-68286270 GGGTGAGTGATATCTCACTTTGG - Intergenic
1027593229 7:80140262-80140284 GGGTGAGCCACCGCACCCTTTGG + Intronic
1031553311 7:123142186-123142208 GGGTGAGCTTTCACTGCCTTTGG - Intronic
1032269644 7:130392799-130392821 AGCTGAGTAATCTCTTCCTTTGG - Intergenic
1033833573 7:145282537-145282559 GGGTGAGGCATCTCTGCCTTTGG - Intergenic
1039724874 8:40205255-40205277 TGGTGAGTAAGCTCTGCCTTGGG + Intergenic
1045065616 8:98441443-98441465 AGGTGGGCAATATCTTCCTTTGG + Intronic
1046169460 8:110485970-110485992 GGGTGAGGCACCTCTACCTTTGG + Intergenic
1046384058 8:113486265-113486287 GGGAGAGGAACTTCTCCCTTTGG + Intergenic
1048432794 8:134385678-134385700 GGAAGAGGAAACTCTCCCTTGGG - Intergenic
1052242721 9:26293753-26293775 GGGTGAGCACATTTTCCCTTGGG + Intergenic
1052732945 9:32310925-32310947 GGGTGAGGTTTCTCTCCCTGTGG + Intergenic
1059350156 9:113658678-113658700 GCCTGAGCAATCTCTCCCGTTGG + Intergenic
1059899057 9:118902120-118902142 GAGGGAACAATCTCTCCCTTTGG + Intergenic
1061055986 9:128223131-128223153 GGGGGAGCTATCTCACCCTGGGG - Intronic
1186911623 X:14173939-14173961 GGGTGAGGCATCTCTGCCTGTGG - Intergenic
1187338698 X:18402550-18402572 GGGTGAGCCATAGCTCCCTCTGG + Intergenic
1189937187 X:46081622-46081644 GGCAGAGCTATCTCTCTCTTTGG - Intergenic
1192784055 X:74320935-74320957 GGGAGACCAATTTCTCCCTAAGG + Intergenic
1193012891 X:76697328-76697350 GGGTGAGGCGTCTCTGCCTTTGG + Intergenic
1193417126 X:81238391-81238413 GGGTGAGGCACCTCTGCCTTTGG + Intronic
1195122894 X:101774814-101774836 GGGTGAGGTTTCTCTGCCTTTGG - Intergenic
1196600877 X:117600565-117600587 GGGTGAGCCTCCTCTGCCTTAGG - Intergenic
1196922181 X:120595458-120595480 GGGTGAACCTCCTCTCCCTTTGG + Intronic
1198788235 X:140314130-140314152 GGGTGAGGCTTCTCTGCCTTTGG + Intergenic
1198818022 X:140614090-140614112 GGGTGAGGCTCCTCTCCCTTTGG - Intergenic
1199156185 X:144551422-144551444 GGGTGAGCCTCCTCTGCCTTTGG + Intergenic
1199461077 X:148085810-148085832 GGGGGAGCACTGTCTCCCTGTGG - Intergenic
1201780557 Y:17716746-17716768 GGGAGAGCCATCACACCCTTTGG - Intergenic
1201820997 Y:18189244-18189266 GGGAGAGCCATCACACCCTTTGG + Intergenic
1202256948 Y:22931601-22931623 GGGTGAGCAGCCTCTCACTGAGG + Intergenic
1202409939 Y:24565349-24565371 GGGTGAGCAGCCTCTCACTGAGG + Intergenic
1202460843 Y:25104723-25104745 GGGTGAGCAGCCTCTCACTGAGG - Intergenic