ID: 928262286

View in Genome Browser
Species Human (GRCh38)
Location 2:29778811-29778833
Sequence CCCCCCGTGCGTCCTGCCAC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 122
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 111}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
928262286 Original CRISPR CCCCCCGTGCGTCCTGCCAC GGG Intronic
900227655 1:1540492-1540514 CCCCCCGCGCCTCCTCCCCCCGG - Intergenic
900412672 1:2520026-2520048 CCGCGCGTGCCTCCTGCCATGGG - Intronic
901098522 1:6701700-6701722 CCCCCAGAGCGTCCAGCCGCTGG + Intronic
901681362 1:10914675-10914697 CCCTCCGGGGGTCCTACCACGGG + Intergenic
904294151 1:29506943-29506965 CCCCCAGTGCGTGCTGAGACAGG + Intergenic
907409977 1:54276950-54276972 CCTCTCCTGTGTCCTGCCACAGG + Intronic
919318369 1:196002627-196002649 CCCCCCATGCGTCCTTTTACAGG + Intergenic
919756574 1:201069747-201069769 CCCCCTGTGTGTCCAGCCAGAGG - Intronic
920281519 1:204847118-204847140 CCACCCATGTGTCCTCCCACTGG - Intronic
922739598 1:228007731-228007753 CCCCCAGTGCGCCCCGCCGCCGG - Intronic
1065288750 10:24209582-24209604 CCCCCCGGGGCTCCAGCCACGGG + Intronic
1067469971 10:46528894-46528916 CCCTCCGTGGGGCCTGCCATGGG + Intergenic
1068030374 10:51698444-51698466 CCCCCCATGCATCATGCCTCTGG - Exonic
1073268269 10:102241328-102241350 CTCACAGTGCGTCCTGCAACAGG + Exonic
1077464584 11:2727611-2727633 CCCTCCTTGCCTCCTGCCAGGGG + Intronic
1083393304 11:62371350-62371372 CCCACCTTGCCTGCTGCCACAGG - Intronic
1083952057 11:65962001-65962023 CCGCCCGTGCGTGCTGCTCCGGG - Exonic
1083970500 11:66070981-66071003 CCTCCCGGGACTCCTGCCACGGG + Intronic
1084532682 11:69738058-69738080 CCTCCCCTGCATCCTGTCACCGG - Intergenic
1086415254 11:86582775-86582797 CCCCACGGGAGTCCTGCTACTGG + Intronic
1090561905 11:127941697-127941719 CCTCCCCTGCGTCCCGCCACCGG - Intergenic
1092660515 12:10733455-10733477 CCCCCCGGCCCCCCTGCCACTGG + Intergenic
1095655896 12:44668638-44668660 CCCGCCATGCCTGCTGCCACTGG + Intronic
1099224038 12:79948107-79948129 CCCACAGTGCGTCTTGCCTCGGG + Intergenic
1103860712 12:124010953-124010975 CTCCCTGTGCTTCCTGCCTCTGG - Intronic
1103969402 12:124660658-124660680 CTCCCCGCCCCTCCTGCCACTGG + Intergenic
1105512460 13:21061684-21061706 CCGGCCGTGCTTCCTGCCTCCGG + Intergenic
1113574990 13:111389056-111389078 CACCCCCTGCGTCCTTCCCCTGG - Intergenic
1121830572 14:97048144-97048166 CCCCCAGTGCGGCCTGCAAAAGG - Intergenic
1122607019 14:102953507-102953529 CTGCCTGTGCTTCCTGCCACAGG - Intronic
1122711761 14:103663676-103663698 CCCCCGGGGCGTCCTTCAACAGG - Intronic
1122774505 14:104111345-104111367 CCCCCAGTGACTCCTGCCCCAGG + Intronic
1124221891 15:27856452-27856474 CCCCCACAGCTTCCTGCCACAGG - Intronic
1129686536 15:77689276-77689298 CCCCCGGTGCCTCCTACCATAGG - Intronic
1129747857 15:78037496-78037518 GAGCCCGTGAGTCCTGCCACAGG - Intronic
1131054531 15:89367777-89367799 CGTTCCGTGCGTCCTGGCACCGG - Intergenic
1132206462 15:99989229-99989251 ACCCCTGTGCGTCATGTCACTGG - Intronic
1132612174 16:822636-822658 CACCCTGTGGGACCTGCCACTGG - Intergenic
1132614216 16:832269-832291 CCTCCCCTGCGTCATACCACTGG - Intergenic
1134089747 16:11385133-11385155 CCCCCCAGGCGACCTGCCATGGG + Intronic
1136557984 16:31019903-31019925 CTCCCCGTGCCACCTGGCACAGG - Intergenic
1136612106 16:31372504-31372526 GCCTCCGTGAGTCCTGGCACTGG + Exonic
1137629310 16:49931020-49931042 ACCCCCCTGCTGCCTGCCACAGG - Intergenic
1138188174 16:54992810-54992832 CCCACCGTGGGTCCTGCCCATGG + Intergenic
1142682052 17:1555797-1555819 CCACCAGTGCTTCCTGGCACAGG - Intronic
1144875886 17:18396961-18396983 CCTCCCGTGGGTCCTACCATGGG - Intergenic
1145156343 17:20547459-20547481 CCTCCCGTGGGTCCTACCATGGG + Intergenic
1145798511 17:27669345-27669367 CCTCCCGTGGGTCCTACCATGGG + Intergenic
1146843828 17:36171546-36171568 CCTCCCGTGGGTCCTACCATGGG + Intronic
1146856134 17:36259481-36259503 CCTCCCGTGGGTCCTACCATGGG + Intronic
1146864485 17:36328894-36328916 CCTCCCGTGGGTCCTACCATGGG - Intronic
1146872041 17:36383392-36383414 CCTCCCGTGGGTCCTACCATGGG + Intronic
1146883329 17:36455620-36455642 CCTCCCGTGGGTCCTACCATGGG + Intergenic
1147067343 17:37929482-37929504 CCTCCCGTGGGTCCTACCATGGG - Intronic
1147074927 17:37984016-37984038 CCTCCCGTGGGTCCTACCATGGG + Intronic
1147078876 17:38009043-38009065 CCTCCCGTGGGTCCTACCATGGG - Intronic
1147086452 17:38063562-38063584 CCTCCCGTGGGTCCTACCATGGG + Intronic
1147102395 17:38187525-38187547 CCTCCCGTGGGTCCTACCATGGG + Intergenic
1149599796 17:57885839-57885861 CCCCCGGTGCATCCTGGCACCGG + Exonic
1160734898 19:658005-658027 CCCCCAGTGCGTGCTGCCCCCGG - Intronic
1160844515 19:1160473-1160495 CCCTCTGTGCGTCCTCCCCCGGG - Intronic
1161014769 19:1978214-1978236 CCCCTCCTGCCTCCTGCCTCGGG + Intronic
1161102777 19:2429502-2429524 CCCCCATTCCTTCCTGCCACAGG + Exonic
1162291883 19:9786204-9786226 CCCCCCATACGTCCTCCCGCCGG - Intronic
1162951597 19:14074517-14074539 CCCACCAAGCGTCCTGGCACCGG - Intronic
1163111022 19:15161060-15161082 CCCCTCGTTCCTGCTGCCACTGG - Exonic
1163325407 19:16600165-16600187 CCCCCGGGCCCTCCTGCCACAGG + Intronic
1163830902 19:19546757-19546779 CCGCCCGTGCTTCTTGCCCCCGG - Intergenic
1166836659 19:45671348-45671370 CTGCCCGTGCGTCCTGCCCCTGG + Exonic
1167167068 19:47805496-47805518 ACCCACGTGGGTCCTGCCATGGG - Intronic
926271658 2:11371447-11371469 CCTCTCCTGCGTCCTGTCACCGG - Intergenic
927218688 2:20686216-20686238 CCAACTGTGCCTCCTGCCACAGG - Exonic
928262286 2:29778811-29778833 CCCCCCGTGCGTCCTGCCACGGG + Intronic
940962155 2:159797965-159797987 TCCCCCGTGGGTCCTGGCTCCGG - Intronic
941470306 2:165876871-165876893 CTCCCTGTGTGTCCTACCACTGG - Intronic
946388161 2:219398756-219398778 CCCCCCTGGCATCCTGCCACAGG - Intronic
947741227 2:232485836-232485858 CCCCCTGAGCGCCCTGCCAGCGG - Intronic
947742464 2:232490899-232490921 CCCCCCGACCGCCCTGCCAGAGG - Intergenic
1169197218 20:3689744-3689766 CCCCCAGTGCTTCCTTCCAAGGG + Intronic
1172193833 20:33078424-33078446 CCCCCTGTGCTCCCTGCCTCTGG - Intergenic
1172775565 20:37404715-37404737 CACCATGTGTGTCCTGCCACAGG - Exonic
1175402218 20:58707264-58707286 TCCCCTGTCCGTCCCGCCACAGG + Intronic
1175892120 20:62320570-62320592 GCCGCCGTGCGTCCTGCCCGAGG + Exonic
1180141837 21:45897887-45897909 CCCCCAGTTCTTCCTGCCTCAGG + Intronic
1182260572 22:29071147-29071169 CCCCCCCCACCTCCTGCCACCGG - Intergenic
1183478562 22:38050519-38050541 CCCCCCATGTGCCCTGCCCCCGG - Intergenic
1184628154 22:45754078-45754100 CCCAGGTTGCGTCCTGCCACTGG - Intronic
1185215876 22:49599814-49599836 CCCCCCATGCGTGGTGCCAGAGG + Intronic
950188683 3:10961200-10961222 CCTCCCCTTCGCCCTGCCACAGG + Intergenic
978107814 4:104925754-104925776 CCACCCCTGCTCCCTGCCACTGG - Intergenic
978841883 4:113223983-113224005 CCCCCTGTGAGTCCTTCCATAGG + Intronic
981588266 4:146328031-146328053 CCCACCCTGCTCCCTGCCACTGG + Intronic
983461056 4:168026606-168026628 CCTCCAGTGGTTCCTGCCACAGG + Intergenic
985096409 4:186416961-186416983 CTCCCCCTGGCTCCTGCCACAGG + Intergenic
985724054 5:1506444-1506466 CCACCCCTGCGTCCAGCCTCAGG + Intronic
986065655 5:4231311-4231333 GCTTCCATGCGTCCTGCCACAGG + Intergenic
997732776 5:136192971-136192993 CCCTCCGTGCGCTCTGCCACCGG - Intergenic
1002103372 5:176868292-176868314 CCCGCCGTGCGCCCTCCCCCAGG - Intronic
1004793859 6:19059317-19059339 CCCCCTGGGCATCCTGCCATAGG - Intergenic
1006472956 6:34238255-34238277 CCCCCCGCGCGCCCTGGCCCCGG + Intronic
1006939770 6:37744025-37744047 CCCTCCGTGCATCCTCCCAGAGG - Intergenic
1009556540 6:65178102-65178124 CCCCCCGAGTATCCTGCCACAGG + Intronic
1018024234 6:159791105-159791127 CCTCCCGTGAGTTCTGGCACAGG + Exonic
1026828419 7:73597451-73597473 CCCACCGTCCCTCCTGCCCCAGG - Exonic
1035212242 7:157337107-157337129 CCTCCCCTGCGTCCCGCCACCGG + Exonic
1035221340 7:157408197-157408219 CGGCCCGCGCGTCCTGCCAGGGG - Intronic
1035663509 8:1364139-1364161 TCTCCCGTGCCTCCTCCCACTGG + Intergenic
1038583701 8:28771307-28771329 GTCCCCGTCCTTCCTGCCACTGG - Intronic
1041375531 8:57207045-57207067 CCCACCGTGCGACCTGCTAAAGG - Intergenic
1041376294 8:57211424-57211446 CCCACCGTGCGACCTGCTAAAGG - Intergenic
1044467742 8:92526376-92526398 CCCACCCTGCCTCCTGCCACTGG + Intergenic
1046849453 8:118955737-118955759 CCCACCTTGCTTCCTCCCACTGG - Intergenic
1047211896 8:122847341-122847363 CCCGCCCTGCCTCCTGCCCCAGG + Intronic
1047714844 8:127586107-127586129 TCCCTCTTGCCTCCTGCCACTGG + Intergenic
1048289188 8:133167165-133167187 CCCCTCGTACGTCCTGCCCAGGG + Intergenic
1049094892 8:140542724-140542746 CCCCCCGAGGGTCCTGCAGCTGG - Intronic
1049401317 8:142428763-142428785 CCCCCCGCCCGTCCTGCCAGTGG + Intergenic
1049573319 8:143379522-143379544 CACCCCCTGCATCCTGACACGGG - Intronic
1058285470 9:103171446-103171468 CCCCCCCTCCTTCCTGCGACAGG - Intergenic
1062035855 9:134382225-134382247 CCCCACATGCGGCCGGCCACAGG - Intronic
1062036070 9:134383137-134383159 CCCCCTGTGTGTGCTGACACTGG - Intronic
1192080225 X:68040661-68040683 CCCACTGTGTGCCCTGCCACTGG + Intergenic