ID: 928263309

View in Genome Browser
Species Human (GRCh38)
Location 2:29787285-29787307
Sequence CAGCACCCAGCACTGTGTCT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 460
Summary {0: 1, 1: 0, 2: 15, 3: 57, 4: 387}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
928263309_928263315 7 Left 928263309 2:29787285-29787307 CCGAGACACAGTGCTGGGTGCTG 0: 1
1: 0
2: 15
3: 57
4: 387
Right 928263315 2:29787315-29787337 GATACAAAGATGAATTAATTAGG 0: 1
1: 0
2: 5
3: 53
4: 456
928263309_928263316 8 Left 928263309 2:29787285-29787307 CCGAGACACAGTGCTGGGTGCTG 0: 1
1: 0
2: 15
3: 57
4: 387
Right 928263316 2:29787316-29787338 ATACAAAGATGAATTAATTAGGG 0: 1
1: 0
2: 9
3: 87
4: 1099

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
928263309 Original CRISPR CAGCACCCAGCACTGTGTCT CGG (reversed) Intronic
900676544 1:3890741-3890763 CCGGACCCGGCACTGTGTTTTGG + Exonic
900772494 1:4556307-4556329 CCCCACCCACCACTGGGTCTAGG - Intergenic
901508296 1:9700593-9700615 CAGCTCCCCGCTCTGTGTCTAGG + Intronic
902037684 1:13469536-13469558 CAGCCACCAGCCCTGTGCCTTGG - Intergenic
902581319 1:17409529-17409551 CACCACCCCTCTCTGTGTCTTGG + Intronic
902836051 1:19047452-19047474 CAGCACCCAGAACAATGCCTTGG - Intergenic
903404259 1:23083226-23083248 GAGCACCATGCACTGTGGCTGGG - Exonic
903755410 1:25657219-25657241 CAGGACCCAGAACTGTGCCCTGG - Intronic
903767561 1:25744431-25744453 AAGGACCCAGCACTGCGTCCTGG - Intronic
903767584 1:25744520-25744542 AGGCACCCAGCCCTGTGTCCTGG - Intronic
904347047 1:29879366-29879388 AAGCACCCGGCACTGGGCCTGGG - Intergenic
904447753 1:30588578-30588600 AAGCACCCGGCACTGGGCCTGGG + Intergenic
904512815 1:31027782-31027804 CAGAACCTAGCACAGTGCCTGGG + Intronic
904625221 1:31798567-31798589 CCTCACTCAGCACTGGGTCTGGG + Exonic
904627296 1:31814342-31814364 CAGAGCGCAGCACTGTGCCTGGG - Exonic
904991110 1:34593393-34593415 CAGCTCCCAGCCCTGTCCCTTGG - Intergenic
905105405 1:35560768-35560790 CTCCTTCCAGCACTGTGTCTCGG - Exonic
905335997 1:37244921-37244943 CTGCACCCAGCCCTGTGCCCTGG + Intergenic
906512442 1:46418163-46418185 CAGCACCCAGCACAGTGCCTTGG - Intergenic
907141972 1:52195453-52195475 TGGCACCCAGAACAGTGTCTGGG - Intronic
907163423 1:52388502-52388524 GAGCACCCAGAACTGTGTCCAGG - Exonic
907396026 1:54190509-54190531 AAGCACCCAGAACTGTGCCTTGG + Intronic
907881476 1:58552886-58552908 CAGCATCCAGCACTTTCTATAGG - Intergenic
908266272 1:62382226-62382248 CTGCACACTGCACTCTGTCTCGG + Intergenic
910602938 1:89050801-89050823 CAGGACACAGAACTGCGTCTGGG - Intergenic
910637782 1:89428449-89428471 CAGGACACAGAACAGTGTCTGGG + Intergenic
911201306 1:95047157-95047179 AAACACCCAACACTGTCTCTAGG + Intronic
911365136 1:96928876-96928898 CTTCACCTAGCACAGTGTCTAGG - Intergenic
911469012 1:98293242-98293264 CAGCATCCAGCACCATGACTAGG + Intergenic
912227780 1:107755042-107755064 CAGCCCCAAGCAAAGTGTCTGGG + Intronic
915525329 1:156472517-156472539 CAGAACCCAGCCCTCTGTGTAGG - Intronic
915656166 1:157362583-157362605 CAGAACCAAGTACTGTGACTAGG - Intergenic
916446436 1:164876587-164876609 GAGCACCGAGCACAGTGTCTGGG - Intronic
916882537 1:169033799-169033821 TAGCACCCACCACTGTGTGGTGG + Intergenic
918102571 1:181389218-181389240 CAGCACTCAGTACTATGTTTGGG + Intergenic
918127539 1:181597554-181597576 GAGTGCCCAGCACTGTGCCTGGG - Intronic
918219468 1:182423327-182423349 CAGCAGCCAGGACTGCCTCTGGG + Intergenic
918966828 1:191361877-191361899 CAGCAAGCAGCTCTGTGACTAGG - Intergenic
920117324 1:203629846-203629868 CAGCGCCCAGCACGGAGCCTGGG + Intronic
920117630 1:203631609-203631631 CAGCGCCCAGCACGGAGCCTGGG - Intronic
920403879 1:205694569-205694591 CAAAACCCAGCAGTGTGGCTGGG + Intergenic
920926732 1:210348537-210348559 CAGCCCCTAGCACAGTGCCTGGG - Intronic
921489227 1:215753864-215753886 CAACACCCAGCTCTGTTTCTTGG + Intronic
923355489 1:233151086-233151108 CAACGCCCAGAACAGTGTCTAGG + Intronic
923708969 1:236370010-236370032 CAGAAGCCATGACTGTGTCTTGG - Intronic
924459007 1:244241624-244241646 CACCACCTTGCATTGTGTCTTGG - Intergenic
924489224 1:244519134-244519156 AAGCACCTTGCCCTGTGTCTAGG - Intronic
924627950 1:245711382-245711404 CTGCAACCAGCACGGTGTCTGGG - Intergenic
1062799671 10:369748-369770 GGGCAGCCAGCACTGTGCCTGGG - Intronic
1063073213 10:2688244-2688266 CAGGAGGCAGCTCTGTGTCTGGG + Intergenic
1063785556 10:9379362-9379384 CAGCACCCTCCTCGGTGTCTGGG - Intergenic
1064049017 10:12043900-12043922 CAGAACCCAGTACTGTTTCGAGG - Intergenic
1066298949 10:34079983-34080005 CAACACCCAACACTGGGGCTTGG - Intergenic
1066370067 10:34813057-34813079 CAGCACCCAGAACAGTGCCATGG + Intronic
1067121868 10:43479789-43479811 AGGCACCCACCACTGTGTCCTGG + Intronic
1067844970 10:49712375-49712397 AAGGACCAAGCACTGTGTCGGGG + Intergenic
1069061320 10:63897576-63897598 AAGCTCCTAGCACAGTGTCTGGG + Intergenic
1069630016 10:69891949-69891971 CAGCAGCCAGCACTTTGTCCTGG + Intronic
1070045871 10:72835810-72835832 CAGCACTTAGCACTGTGTTGTGG + Intronic
1070715802 10:78720123-78720145 CAGCCCCCAGCCCTGAGCCTGGG - Intergenic
1071460145 10:85886053-85886075 CAGGACACAGCTCTGGGTCTGGG - Intronic
1072016861 10:91356529-91356551 CAGCTCCCTGCACCGTGGCTGGG + Intergenic
1072114083 10:92352132-92352154 CAGCACTCTGCACAGTGCCTGGG - Exonic
1072760780 10:98054842-98054864 CAGCACCCTGCACTGGGGGTTGG - Intergenic
1074966575 10:118496035-118496057 CAGCATCAAGCACTGCTTCTCGG + Intergenic
1075094284 10:119460855-119460877 CAGGGCCCAGCTCTGTCTCTGGG + Intergenic
1075192584 10:120324315-120324337 AGGCACCCAACACTGTGCCTGGG + Intergenic
1076661225 10:132057165-132057187 CAGCAGCCAGCACAGCCTCTGGG - Intergenic
1078245328 11:9569345-9569367 CAGCAACCAGCACTGTGCCTTGG - Intergenic
1078643455 11:13116843-13116865 CAGTGCCCAGCACAGTGTCTGGG + Intergenic
1079141295 11:17811657-17811679 GAGCGCCCAGCACAGTGCCTGGG - Intronic
1079498948 11:21080086-21080108 AAGCACTTAGCACAGTGTCTAGG - Intronic
1080303518 11:30811837-30811859 TAGCAGCCAGGAATGTGTCTTGG + Intergenic
1080785581 11:35472390-35472412 CAGCACCTAGTACAGTGTCTGGG - Intronic
1081071718 11:38618128-38618150 CAGCATCCAGCTTTGTCTCTTGG + Intergenic
1083276329 11:61599101-61599123 CAGAGCCCAGGACTGTGCCTAGG + Intergenic
1083300731 11:61738496-61738518 CAGCTCCCAGCTCTGTGTGATGG - Intronic
1083633233 11:64106338-64106360 TACCACCCAGCCCTGGGTCTAGG + Intronic
1084874675 11:72122344-72122366 CAGCACCCAGCACAGTACCTGGG + Intronic
1085279263 11:75319654-75319676 TAGCACCTTGCACTGTGCCTGGG - Intronic
1085298712 11:75445804-75445826 GAGGCCCCAGCTCTGTGTCTGGG - Intronic
1085994441 11:81893697-81893719 CTGTACCCAGCAGTGTGTCCAGG - Intergenic
1086148569 11:83582455-83582477 CAGCATCAAGCACTATGCCTGGG - Intronic
1086894319 11:92294405-92294427 CAGCACCTAGCAGTGTTTGTTGG - Intergenic
1086926847 11:92649991-92650013 TAGCACCCAGCACTCTCTTTGGG - Intronic
1088732500 11:112695655-112695677 CAACACCAAGTACTGTCTCTGGG - Intergenic
1088779403 11:113119859-113119881 CACAACCCAGCACCCTGTCTGGG + Intronic
1089336223 11:117725698-117725720 CAGGGGCCAGCCCTGTGTCTAGG - Intronic
1089480803 11:118803463-118803485 CAGCATCCAGCATGGTGTCCTGG - Intergenic
1089659514 11:119976946-119976968 CAGCACCCTGTGCTGGGTCTAGG - Intergenic
1090284663 11:125489387-125489409 CAGAAACCAGCACTATGTCAAGG + Intronic
1091372765 11:135074460-135074482 CAGCAGTCAGCACAGTGCCTGGG + Intergenic
1091443405 12:528787-528809 CAGGAACCAGCACTGAGTCCTGG - Intronic
1091791739 12:3275838-3275860 CAGCTCCTTGCACTGTCTCTTGG + Intronic
1092012400 12:5125478-5125500 GAGCACCCAGCTTTGTGGCTTGG + Intergenic
1092024361 12:5228376-5228398 CATAGCCCACCACTGTGTCTGGG - Intergenic
1093369130 12:18344813-18344835 CACCACCAAGCCCTGTGTCTTGG + Intronic
1093790033 12:23238010-23238032 CATCTCCCAACTCTGTGTCTGGG - Intergenic
1093852353 12:24055956-24055978 GAGCCCACAGCACTGTGACTTGG + Intergenic
1093909358 12:24727969-24727991 CTGTACCCAGCACTGTGCCAAGG - Intergenic
1094054531 12:26255906-26255928 CAACAACCAGCACTGGGACTGGG + Intronic
1094450372 12:30577437-30577459 CAGCTTCTAGCACTGTGCCTGGG + Intergenic
1096688232 12:53303263-53303285 CAGCACTCAGCACTGGGCCTCGG + Intronic
1097521464 12:60676015-60676037 CTGCCCTCAGCCCTGTGTCTGGG + Intergenic
1098508572 12:71284321-71284343 CTGCACCCTGCTCTGTGCCTTGG + Intronic
1098677976 12:73315420-73315442 AAGCACCCAGAAGTGTGCCTAGG + Intergenic
1099554365 12:84092061-84092083 CAGCACACAGGACTGTGTGGTGG + Intergenic
1099968749 12:89478517-89478539 CAGTGCCAGGCACTGTGTCTGGG - Intronic
1100245013 12:92748894-92748916 CAGCATGTAGCACAGTGTCTAGG - Intronic
1100407731 12:94285764-94285786 CAGCACCTCTCCCTGTGTCTGGG + Intronic
1101071356 12:101079675-101079697 CAGCACCCAGGACCGTGCCCAGG + Intronic
1101194929 12:102372061-102372083 CAGCACCTAGCACAGTGCCTGGG - Intergenic
1101440812 12:104703152-104703174 CTGCACCTAGCACAGTGCCTGGG + Intronic
1102416788 12:112770034-112770056 CTTCACCCAACATTGTGTCTTGG + Intronic
1103726494 12:122999822-122999844 CAGAACCCAGCACTGATTCTGGG - Intronic
1103746041 12:123124507-123124529 TAGCAACCATCACTGTCTCTGGG + Intronic
1103903527 12:124315697-124315719 CAGAAGCCAGCACTGTGGCAGGG + Exonic
1103929142 12:124440030-124440052 CAGCACCCTGCTTTGTGTGTTGG - Intronic
1104060480 12:125263878-125263900 CAGTACCCAGGACTATGTCTGGG - Intronic
1104772383 12:131371611-131371633 CAGCACACTGCTCTTTGTCTTGG + Intergenic
1105330235 13:19409305-19409327 CAGCACCCTCCTCAGTGTCTGGG + Intergenic
1105861570 13:24419749-24419771 CAGCACCCTCCTCAGTGTCTGGG - Intergenic
1105910759 13:24863946-24863968 CAGCCCCCAGCTGTGTGTCCAGG - Intronic
1106465530 13:30011059-30011081 CAGCACTTAGCACTGTGCTTGGG + Intergenic
1107964957 13:45589714-45589736 CAGGCCCCTTCACTGTGTCTGGG + Intronic
1108179880 13:47830077-47830099 CAGCACCCAGCTCTGCCTCTTGG - Intergenic
1110323628 13:74188271-74188293 CAACACCTAGAACAGTGTCTGGG - Intergenic
1110732671 13:78897247-78897269 TATCATCAAGCACTGTGTCTAGG + Intergenic
1112780091 13:102890908-102890930 CATCACCCAGCACTGTGCCTGGG + Intergenic
1112961174 13:105128318-105128340 AAGCACCCAACACACTGTCTGGG - Intergenic
1114223975 14:20722228-20722250 CAGCAGCCAGAACTGTGTCTCGG - Intergenic
1115385148 14:32788706-32788728 CGCCACACAGCTCTGTGTCTCGG - Intronic
1116195719 14:41722962-41722984 AAGCACCCAGAAGTGTGCCTAGG + Intronic
1116454519 14:45103944-45103966 AAGCACTCAGCACAGTGTCTGGG - Intronic
1116683538 14:48009045-48009067 CTGAAACCAGCACAGTGTCTTGG + Intergenic
1117003167 14:51392501-51392523 TAGCACTTAGCACAGTGTCTTGG + Intergenic
1119849932 14:77860057-77860079 CAGCACCTAGCACCCTGCCTGGG - Intronic
1121006215 14:90492132-90492154 ACCCACCCACCACTGTGTCTGGG - Intergenic
1121041491 14:90752632-90752654 CAGCACCCAGCACTATGCCTGGG + Intronic
1121521904 14:94591877-94591899 CACCCCCCAGCACAGTGCCTGGG + Intronic
1121867554 14:97377121-97377143 CCCCACACAGCACTCTGTCTGGG - Intergenic
1122141251 14:99664252-99664274 GAGCCCCCAGGGCTGTGTCTGGG + Intronic
1122166437 14:99827879-99827901 GAGCACCCAGCAGGGTGTCTGGG + Intronic
1122269112 14:100560462-100560484 CAGGCCCCAGCCATGTGTCTGGG - Intronic
1122846661 14:104503991-104504013 CTGGGCCCAGCACTGTGGCTCGG - Intronic
1123164695 14:106315173-106315195 CAACACCCAGCATTGTTGCTGGG + Intergenic
1123397957 15:19955829-19955851 CAACACCCAGCATTGTTGCTGGG + Intergenic
1124103093 15:26713473-26713495 CTGAACCCAGCATTGTGTTTCGG - Intronic
1124364484 15:29062335-29062357 CTGCTCCCAGCACTGTGACAGGG + Intronic
1124663162 15:31567815-31567837 CAGCAGCCTGAACTGTATCTGGG - Intronic
1124685702 15:31779985-31780007 CAGATCCCAGCACTTTGTCCTGG - Intronic
1125729549 15:41885450-41885472 CAGCACCTAGCACAGTGTGTGGG + Intronic
1125840721 15:42798959-42798981 CAGCACCCAAAATTGTGTTTTGG - Intronic
1126911079 15:53417753-53417775 CAGTACCTAGCACTGTGCTTGGG - Intergenic
1127187460 15:56494127-56494149 CAGCACCCAGCACAGTGGCTTGG + Intergenic
1127575846 15:60291211-60291233 CAGCAGGCAGCATTGTGTATTGG - Intergenic
1127621144 15:60736070-60736092 CAGAAGCCAGGACTGAGTCTAGG + Intronic
1127836679 15:62796185-62796207 CAGCCGCCACCGCTGTGTCTGGG + Exonic
1129110667 15:73335303-73335325 CAGCACTCAGCCATGTGCCTCGG - Intronic
1129163027 15:73757869-73757891 AAGCACCAAGCACAGTGCCTGGG + Intergenic
1129384468 15:75188336-75188358 CAGCTCCCAGTGCTGTGGCTGGG - Intergenic
1129670773 15:77606566-77606588 CAGCACCCAGAGCTGGGGCTGGG - Intergenic
1129741542 15:77991990-77992012 CAGCAGCCAGCCCTGGGCCTGGG - Intronic
1129844117 15:78760414-78760436 CAGCAGCCAGCCCTGGGCCTGGG + Intronic
1129942505 15:79510511-79510533 CAGCACCCATCGCTGTCCCTAGG + Intergenic
1130257687 15:82333386-82333408 CAGCAGCCAGCCCTGTGCCAGGG - Intergenic
1130559736 15:84948544-84948566 CAGCTCCCAGCTCTGTTTCTGGG - Intergenic
1130597251 15:85256577-85256599 CAGCAGCCAGCCCTGTGCCAGGG + Intergenic
1133261933 16:4556530-4556552 CAGCACCCCGCACTGTGGGATGG - Exonic
1133411788 16:5574899-5574921 CAACTCACAGCACAGTGTCTGGG - Intergenic
1133808687 16:9144807-9144829 TAACACCCAGCACAGTGCCTGGG - Intergenic
1133858351 16:9570985-9571007 CAGCACCCAGCAGGGAGCCTGGG - Intergenic
1134389986 16:13810701-13810723 AAGCACCAGGCACTGTGTCAGGG - Intergenic
1134657191 16:15955867-15955889 CAGCACCTAGAACTGTGCCTGGG + Intronic
1134819763 16:17237410-17237432 CCACACTCAGCAATGTGTCTTGG + Intronic
1135481552 16:22824857-22824879 CAGCAGCAAGCACTGAGGCTAGG - Intronic
1136123313 16:28156267-28156289 CAGCAGCCAGAACTGTGTCTCGG - Exonic
1137562575 16:49512347-49512369 AAGCTCCCAGCATTGGGTCTGGG - Intronic
1137612836 16:49830385-49830407 GAGCACCCAGCACTGTCTGGGGG - Intronic
1139447536 16:67007078-67007100 CAGCTCCCAGTACTGGGGCTGGG - Intronic
1139700591 16:68705722-68705744 TAGCACCAAGAACAGTGTCTTGG - Intronic
1140440368 16:74983512-74983534 CAGCACCTAGGACAGTGTCTTGG - Intronic
1141752806 16:85970396-85970418 CAGCACCCAGCACTCTCTGGAGG + Intergenic
1141860703 16:86714276-86714298 CAGGACCCAGCTTTGTGTCTGGG + Intergenic
1142189627 16:88711963-88711985 CAGCCCCCATCACGGGGTCTGGG + Intronic
1143634574 17:8156967-8156989 CAGATCTCAGCACGGTGTCTTGG + Intronic
1143866516 17:9927647-9927669 AAGCACTCAGCACAGTGACTGGG + Intronic
1144002079 17:11064541-11064563 CAGAACCCAGCACTGAGCCTGGG + Intergenic
1146626399 17:34438603-34438625 AAGCATCCAGAAATGTGTCTGGG + Intergenic
1147054857 17:37826265-37826287 CAGGACCCAGCATAGTGTCTGGG - Intergenic
1148163429 17:45465137-45465159 CAGCACCAAGCACTGTACCTGGG - Intronic
1148308123 17:46609430-46609452 CTGCACCTAGCACAGTGCCTGGG + Intronic
1148881576 17:50731986-50732008 CAGAAGCCAGGTCTGTGTCTTGG + Intronic
1149794597 17:59507710-59507732 CAAAACCCATCACTGTGGCTGGG - Intergenic
1150101461 17:62427384-62427406 TACCACGCAGCACTGTGTTTAGG + Intronic
1150394657 17:64811789-64811811 CAGCACCAAGCACTGTACCTGGG - Intergenic
1151261204 17:72917295-72917317 AGGCGCCAAGCACTGTGTCTGGG + Intronic
1151272403 17:73007130-73007152 CTGCGCCCGGCCCTGTGTCTTGG - Intronic
1151584012 17:74997548-74997570 CAGGACCCAGGACAGTATCTAGG - Intronic
1151810879 17:76440948-76440970 CAGCACCCAGCACAGTGCAGGGG + Intronic
1152448449 17:80360690-80360712 CAGAGCTCAGCACTGTGTCTGGG - Intronic
1152937091 17:83145509-83145531 CAGCACCTGGCACAGTGTCCAGG - Intergenic
1152974354 18:199598-199620 CAGCACTCAGCCCTGTGCTTGGG - Intronic
1153010589 18:535391-535413 CTGCACCCAGCCCTGTAACTAGG - Intergenic
1153970101 18:10218235-10218257 CAGCACCAAGCACGCTGCCTGGG + Intergenic
1154025845 18:10706390-10706412 CAGCTCCCTGCACTGTGCCCAGG + Intronic
1154026660 18:10714198-10714220 CAGCACTAAGCACTGTACCTGGG - Intronic
1154166284 18:12016853-12016875 AAGCACCCAGCATAGTGCCTGGG + Intronic
1154199750 18:12291133-12291155 CAGCACCTAGCACAGTGTCTGGG + Intergenic
1155315555 18:24567408-24567430 GAGAACCCAGCTCTGTTTCTTGG + Intergenic
1156376501 18:36519576-36519598 CAGCCCCCAGCACTGTGTGCAGG + Intronic
1157381212 18:47219633-47219655 CATAGCCCAGCACTGTGTTTGGG + Intronic
1157740946 18:50092299-50092321 CTGCTCCCATCACTGTTTCTTGG - Intronic
1157807133 18:50666493-50666515 CAGCTCCCAGCACTGAGCTTGGG - Intronic
1158268554 18:55687176-55687198 CAGCACCTAGCAGAGTATCTGGG - Intergenic
1158503871 18:58028729-58028751 CTGAACCCATCACTGTGGCTGGG + Intergenic
1159964157 18:74579491-74579513 CAGCACCTAGAACAGTCTCTGGG + Intronic
1160963935 19:1737368-1737390 CAGCATCCAGCACAGAGCCTGGG - Intergenic
1161274430 19:3407755-3407777 CAGCACCCTGGACTGTGTCTGGG - Intronic
1161293986 19:3510427-3510449 CAGAACCCAGCAGTGTGGCCGGG - Intronic
1161657942 19:5527226-5527248 CAACACCCAGAACGGTGCCTGGG - Intergenic
1162550970 19:11357923-11357945 CAGCACCCTGCAGTGTGGATGGG - Intronic
1163250236 19:16122491-16122513 CGGAGCACAGCACTGTGTCTCGG + Intronic
1165227835 19:34366700-34366722 CAGCACCAAGCCTTGTGTTTGGG + Intronic
1165475575 19:36028485-36028507 CAGCACCCAGCACAGGGCCCTGG + Intronic
1165734582 19:38167970-38167992 CAGCTCCCAGCACAGTGTCTGGG - Intronic
1165899232 19:39161080-39161102 CAGCACCCAGCACTGTTTAGAGG + Intronic
1166100080 19:40566440-40566462 CAGGACCAAGCACCATGTCTCGG - Intronic
1167373263 19:49097358-49097380 CAGTGTCCAGCACTGTGTCTGGG + Intronic
1168316271 19:55486038-55486060 CAACAGCCAGCTCTGTGCCTCGG + Intronic
925040630 2:731128-731150 CAACACCCACCTCTGTGGCTGGG - Intergenic
925937023 2:8773971-8773993 CAGTACCCAGAACAATGTCTAGG - Intronic
926068883 2:9868094-9868116 CAGCTCCCAGCAGTGCTTCTTGG - Intronic
926298580 2:11586225-11586247 CGGCACTCAGCACCGGGTCTGGG - Intronic
926813976 2:16782066-16782088 AAGCTCCCAGCACTGTGCCAGGG + Intergenic
926884448 2:17584546-17584568 CAGCACCCAGCCCAGAGTCAGGG + Intronic
926958968 2:18332802-18332824 CAGCTCCAAGCCCTGGGTCTGGG + Intronic
927131791 2:20066362-20066384 CAGCACCCAGCCCTGGACCTGGG + Intergenic
927208159 2:20623036-20623058 CAGGACACAGGACTGTGCCTGGG - Intronic
927250468 2:20991420-20991442 CAGTGCCCAGCACAGAGTCTTGG - Intergenic
927848998 2:26487192-26487214 CAGCACCCAGGAGTGTCTCTGGG + Intronic
928263309 2:29787285-29787307 CAGCACCCAGCACTGTGTCTCGG - Intronic
930224631 2:48779647-48779669 CAGTACCCAGCACCGTGCCTAGG + Intergenic
931187037 2:59963128-59963150 CAGCACCTACCACTGGCTCTTGG - Intergenic
934574727 2:95392687-95392709 GTGCACCCAGCACTGTGCCAGGG + Intergenic
935598186 2:104896270-104896292 CTGCCCTCAGCCCTGTGTCTTGG + Intergenic
937609362 2:123841188-123841210 AAGCACCCAGAGCTGTGCCTAGG - Intergenic
937712137 2:124990226-124990248 CAGCCCCAAGGACTGTGGCTTGG - Intergenic
937969264 2:127536737-127536759 CAGAACCCTGCACTTTGTTTAGG + Intronic
938108231 2:128547537-128547559 CAGCACCTAGTACAGTGCCTGGG - Intergenic
938133735 2:128737213-128737235 CAGCACCCTGGCCTGGGTCTCGG - Intergenic
938206953 2:129432059-129432081 CAGCAGCCAGCTCCGTGCCTGGG - Intergenic
938397324 2:130961208-130961230 CATTACCCATCACTGTGTCCAGG - Intronic
938404021 2:131017414-131017436 CAGCTCCCAGCACAGGGTGTGGG - Intronic
938953614 2:136279198-136279220 CAGCACCGAGAACAGTGCCTGGG + Intergenic
939620481 2:144412904-144412926 CAGCACCTAGCATAGTGCCTGGG + Intronic
940240942 2:151562555-151562577 CAGCTTCCATGACTGTGTCTTGG - Intronic
940293135 2:152097717-152097739 CAGCACTCAGCTCCGGGTCTGGG - Intronic
940789462 2:158016627-158016649 CTGCACCCAGCCCTGGGTCTAGG + Intronic
940800071 2:158123463-158123485 CAGCAGCCAGCACTGTGCCCAGG - Intronic
940851474 2:158691435-158691457 CAACTCCCTGCACTGTGACTGGG + Intergenic
941701700 2:168610410-168610432 CAGCACCTAGTAGTATGTCTTGG + Intronic
943069599 2:183124812-183124834 CAGCAACCAGCATCGCGTCTCGG - Intronic
944143369 2:196480504-196480526 AAGAACCCATCACTGTGGCTGGG - Intronic
947827421 2:233115763-233115785 CAGCCCCCACCACTGTGTTGAGG - Intronic
948838547 2:240637768-240637790 CAGCACCCCTCTCTGTGCCTTGG - Intergenic
1168866077 20:1087763-1087785 CAGTATCCTACACTGTGTCTGGG + Intergenic
1169934749 20:10871339-10871361 CAGCATGCAGCACTAGGTCTGGG + Intergenic
1170111491 20:12808708-12808730 CTGAACCCAGCAGTGTGGCTGGG + Intergenic
1170160784 20:13308156-13308178 CAGCACGCAGCACAGTGAATGGG - Intergenic
1170698955 20:18685913-18685935 CAGCACACAGGACTTTCTCTGGG - Intronic
1172196689 20:33096761-33096783 CTGGACCCAGCAATGTGTCCTGG + Intronic
1172626746 20:36351807-36351829 CAGCCCCCAGCACAGTGTCTGGG - Intronic
1172700630 20:36851784-36851806 CAGAGCCCAGCACAGTGCCTGGG + Intronic
1172919890 20:38472710-38472732 CAGCTTCCGGCTCTGTGTCTCGG + Intergenic
1174371582 20:50092433-50092455 CAGCAACCATAAATGTGTCTAGG - Intronic
1174981000 20:55394697-55394719 CTGCATCCAGCACAGTGCCTGGG - Intergenic
1175264233 20:57692823-57692845 CAGCACTCAGCAATGTCTCAGGG + Intronic
1175846668 20:62063428-62063450 CAGCACCCACCACGGCGGCTGGG + Intronic
1176041886 20:63070006-63070028 CAGGACTCAGCTCTGTGCCTGGG + Intergenic
1176240495 20:64073703-64073725 CAGCACTCCCCACTGGGTCTAGG + Exonic
1176744639 21:10640551-10640573 CAACACCCAGCATTGTTGCTGGG + Intergenic
1180003920 21:45011063-45011085 CACCTCCCAGCACTGTGACCTGG + Intergenic
1180074226 21:45454683-45454705 CAGCACCCACTGCTGTGCCTGGG + Intronic
1180906857 22:19419668-19419690 CAGGACCCAGAGCTGTGGCTTGG + Intronic
1181770120 22:25119122-25119144 CAGTACCCAGAACAGTGGCTAGG + Intronic
1182301432 22:29339415-29339437 CTCCACCCAGCCGTGTGTCTTGG - Intronic
1182393639 22:30019879-30019901 CATCACCCAGTTCTGGGTCTTGG - Exonic
1182412258 22:30197123-30197145 CATCACCCAGCACTCCCTCTAGG - Intergenic
1183228742 22:36567763-36567785 CAGGACCCAGCTCCGTGTCCTGG + Intronic
1183432075 22:37772005-37772027 CAGCACCTAGCACAGTGCCCAGG - Intronic
1183936398 22:41264881-41264903 CAGCACCCAGCACAGAAGCTGGG - Intronic
1184031718 22:41899008-41899030 CAGCTGTCAGCACTGTGTCCGGG + Intronic
1184665934 22:45989080-45989102 CAGCACCCAGGGCTGAGGCTGGG + Intergenic
1185026254 22:48414883-48414905 CAGCACCCAGCACCCAGTCCAGG + Intergenic
1185050744 22:48552848-48552870 CAGCACCCAGGGCTGGCTCTGGG - Intronic
1185420991 22:50734340-50734362 CAGGACCCAGCACTGAGGCCAGG + Intergenic
949843927 3:8351579-8351601 CAGAACCCAGACCTGGGTCTGGG - Intergenic
949909156 3:8886597-8886619 TAGCACCTAGCACTGTGCCTGGG - Intronic
949922701 3:9015322-9015344 CTGCTCCCAGCACTCTCTCTTGG + Intronic
949945602 3:9187415-9187437 GAGCACTCAGCACAGCGTCTGGG - Intronic
950018008 3:9767812-9767834 CAGAGCCCAGCCCTCTGTCTGGG + Intronic
951712055 3:25593184-25593206 CAGCACCTGGCACAGTGCCTGGG + Intronic
952341418 3:32450703-32450725 CAGTACCCTGCACTGTAGCTGGG - Intronic
952525817 3:34209300-34209322 CAGCATCTAGCACAGTGCCTGGG + Intergenic
952924669 3:38312511-38312533 CAGTGCCCAGCACTCTGCCTGGG - Intronic
953802012 3:46031577-46031599 CACCACCCACCACTGTTTATGGG - Intergenic
954855143 3:53637761-53637783 CAGCAGGCAGAACTGAGTCTCGG - Intronic
955073473 3:55591333-55591355 TGGGACCCAGCACTGTGACTGGG + Intronic
955793640 3:62612866-62612888 CAGCGCCCAGAACAGTGCCTTGG - Intronic
958001398 3:87753831-87753853 CAGCTCTCAGCACTGTGTGCAGG + Intergenic
959934969 3:112019701-112019723 CAGAGTCCAGCACTGTGTCTAGG - Intergenic
961252660 3:125520085-125520107 CAGCCCCCAGCCCAGCGTCTGGG + Exonic
961575414 3:127831991-127832013 CAGCAGCCTGCACTGAGGCTGGG + Intergenic
962979513 3:140474915-140474937 CAGCACCCTGCACTTTCTCAGGG + Intronic
963461277 3:145617421-145617443 CAGCAGCCAGCACTGGAACTCGG - Intergenic
964422718 3:156521163-156521185 CAGCACCCAGCACAAAGTCTGGG - Intronic
965058547 3:163753378-163753400 CAACAGCCAGCACTGGGTCTTGG + Intergenic
965294599 3:166927402-166927424 CAGGACCTAGCACAGTGTCTTGG + Intergenic
967865647 3:194187786-194187808 TAGCACCTAGCACAGAGTCTGGG + Intergenic
968962062 4:3750670-3750692 CAGCTGACAGCTCTGTGTCTTGG - Intergenic
969213326 4:5704597-5704619 GAGAACCCAGCACTGAGTCCTGG + Intronic
970360211 4:15301821-15301843 GAGCACCCAGGACTGAGTGTAGG - Intergenic
971253108 4:24989573-24989595 CAGGACCCATCACTGGATCTTGG - Intergenic
971953193 4:33381469-33381491 CAGTCCTCAGCACAGTGTCTAGG + Intergenic
972341323 4:38154989-38155011 CAGCACCCAGCCCTTTGCCATGG + Intergenic
973200202 4:47491963-47491985 AAGCACTCAGCACCGTGCCTAGG + Intronic
973927811 4:55757482-55757504 CAGCACCCAGCACACTGTAAGGG + Intergenic
976690510 4:87863513-87863535 CACCAATCAGCACTGTGTCTAGG - Intergenic
977690103 4:99896139-99896161 CAGCACCCAGCTCACTGCCTGGG + Intergenic
978284902 4:107064984-107065006 CAGGACTCAGCACCGTGGCTTGG - Intronic
979378266 4:119975796-119975818 AAGCACACACCACTGTGCCTGGG - Intergenic
979813113 4:125064638-125064660 CTGGACCCAGCAATGTGGCTGGG + Intergenic
981821345 4:148890566-148890588 CAGCACCTGGCACTGTGCCTGGG + Intergenic
984508895 4:180654976-180654998 CAGCACCTAGCACAATGCCTGGG + Intergenic
985084245 4:186296708-186296730 CAGCTGCCAGCACAGCGTCTAGG + Intergenic
985513138 5:323074-323096 CAGCACCCAGGAGTCTGTCGAGG + Intronic
986146816 5:5085523-5085545 CCCCACCCAGCACCCTGTCTGGG - Intergenic
986264685 5:6181597-6181619 CTGCACCCAGCATTGTCTTTGGG + Intergenic
987323335 5:16790292-16790314 TGGTACCCAGCACAGTGTCTGGG - Intronic
989099157 5:37808529-37808551 CAGCACCCCAGGCTGTGTCTGGG + Intergenic
989362680 5:40621511-40621533 CAGCTCCTAGAACAGTGTCTGGG - Intergenic
990482767 5:56228015-56228037 AAGCACGCAACACTGTGACTCGG - Intronic
993009140 5:82459594-82459616 AAGCTCCCAGTACTGTGCCTAGG - Intergenic
993779679 5:92051003-92051025 AAGCACCCAGAAGTGTGCCTAGG + Intergenic
994073755 5:95628980-95629002 CAGCAGCCTGAGCTGTGTCTGGG + Intergenic
997236515 5:132275124-132275146 TCCTACCCAGCACTGTGTCTAGG + Intronic
997783719 5:136686190-136686212 AAGCACCCAGAAGTGTGCCTAGG - Intergenic
999178281 5:149647543-149647565 CAGCCCCCAGAATTGTGTCAAGG + Intergenic
999831394 5:155323564-155323586 GAGCACTCAGCACAGTGCCTGGG + Intergenic
999916213 5:156264828-156264850 CAGCACCTAGAACAGTGCCTGGG + Intronic
1000272223 5:159696983-159697005 CAGCACTCAGCACAGAGTCTTGG + Intergenic
1001082415 5:168677025-168677047 CAGAACCCAGCACTTTGTCTAGG - Intronic
1001116154 5:168941923-168941945 TAGCACCCAGCACTGGGTCTGGG + Intronic
1001276800 5:170357201-170357223 CCGGACCCTGCACTGTGGCTCGG + Intronic
1002288335 5:178180505-178180527 CAGGACCCAGCACTATTTCAAGG + Intergenic
1002317109 5:178350422-178350444 CAGCACCCAGCACGGCATCTAGG + Intronic
1002851505 6:1000887-1000909 CTGCAGCCACCTCTGTGTCTTGG + Intergenic
1003453091 6:6255500-6255522 CAGCCCCCAACACTGTGCCTTGG + Intronic
1004034340 6:11908288-11908310 GAGGACTCAGCACTGTGACTTGG - Intergenic
1004131012 6:12919836-12919858 CGGAATCCAGCACTGTGCCTAGG + Intronic
1004265666 6:14146376-14146398 CAGAACTCAGGGCTGTGTCTGGG - Intergenic
1005486162 6:26301909-26301931 CAGTACCTAGCACAGTGGCTGGG - Intergenic
1005830354 6:29666084-29666106 CAACACTCAGCATGGTGTCTGGG - Intronic
1006459079 6:34147816-34147838 CAGCACCTAGTACTGTATTTAGG + Intronic
1006594024 6:35179534-35179556 CAGCATCCAGGAGGGTGTCTGGG + Intergenic
1006803053 6:36771616-36771638 CAGCACCCAACACAGTGCCTGGG + Intronic
1007075592 6:39064303-39064325 CAGCAGTCAGAACTGGGTCTCGG - Intronic
1008473668 6:51912505-51912527 CTAAAGCCAGCACTGTGTCTAGG + Exonic
1011557825 6:88588022-88588044 CAGCAGGCAGCACTGTGTTCTGG - Intergenic
1013564245 6:111341603-111341625 TGGCACACTGCACTGTGTCTAGG - Intronic
1013665026 6:112338939-112338961 CAGCATCCATATCTGTGTCTAGG + Intergenic
1014999950 6:128202383-128202405 CATCACACAGCTCTGTGTATTGG - Intronic
1017746732 6:157453664-157453686 CAGCACCTAGCGCTGTGTCTGGG - Intronic
1019746084 7:2701050-2701072 CAGCCCGCAGCACAGTGCCTGGG - Intronic
1021940706 7:25676265-25676287 CAGCTCTCAGCAGTGTGTCCAGG + Intergenic
1022845604 7:34206721-34206743 CAGAACCCAGCACAGTGCCTGGG + Intergenic
1023732641 7:43206649-43206671 CAGCACCCAGCACCCAGTATGGG - Intronic
1023752692 7:43387066-43387088 CAGCTTCCAGAACTGTGTTTTGG + Intronic
1023938177 7:44754455-44754477 CATCACCGAGCACTGGGACTGGG - Intronic
1024579179 7:50788037-50788059 CAGCACCAGGCACTGTCCCTGGG + Intronic
1025738929 7:64181249-64181271 CACCACCCAGAACTGTGACATGG + Intronic
1026504364 7:70969718-70969740 AAGCACCCAGCATGGTGTCAGGG + Intergenic
1028771385 7:94627361-94627383 CAGCACCTAGCATTGTAGCTGGG - Intronic
1028868457 7:95738852-95738874 AAGCACCCAGAAGTGTGCCTTGG - Intergenic
1029112690 7:98221899-98221921 GTCCACCCAGCACTGTGCCTGGG + Intronic
1029460604 7:100692021-100692043 CAACACAGAGCACTGTGCCTTGG + Intergenic
1029571247 7:101371082-101371104 CACCACCCACCACTGCCTCTTGG + Intronic
1031861969 7:126990257-126990279 CATCAGCCAGAACTGTGTCCAGG - Intronic
1032030612 7:128480243-128480265 TACCACGCAGCACTGTGTTTAGG + Intronic
1032332306 7:130991955-130991977 CAGAGCCCAGCTCTGTGGCTCGG - Intergenic
1032464126 7:132133261-132133283 ATGCTCCCAGCACCGTGTCTGGG + Intronic
1034073991 7:148214236-148214258 CAGCACCCAGCATCGTGCCCAGG + Intronic
1034089790 7:148353085-148353107 CAGGACCCAGGGCTGTCTCTAGG - Intronic
1034951661 7:155301094-155301116 CACCACCCAGTACTGGGGCTGGG - Intronic
1035049897 7:155992631-155992653 CAGGCCCCAGCCCTGTGTCAGGG - Intergenic
1035329448 7:158086553-158086575 CAGCACTCAGCACTGTGCTGGGG + Intronic
1035651499 8:1269245-1269267 CGGCACCCAGCATGGTGTCCTGG - Intergenic
1035682991 8:1502248-1502270 CAGCACTCAGGGCTGGGTCTCGG + Intronic
1035930547 8:3775778-3775800 CAGCACCCAGCAATGCTTCGTGG - Intronic
1036222050 8:6929328-6929350 CTGCCCCCAGCACAGTGTCCTGG + Intergenic
1037297280 8:17413941-17413963 GAGCACCCAACACTGTGCCAGGG - Intergenic
1037778133 8:21849115-21849137 TAGCTCCCTGCACTGTGTTTGGG - Intergenic
1038885677 8:31660022-31660044 CACCACTCAGCTGTGTGTCTTGG - Intronic
1039377582 8:37051415-37051437 CAGCACCTAGCACAGTACCTGGG + Intergenic
1039680482 8:39730235-39730257 CAGCAGCCATCACTGTGGCGAGG + Intergenic
1039879783 8:41617852-41617874 CAGCACCAGGCACTTTGTCCAGG + Intronic
1041372798 8:57181441-57181463 CACTACGCAGCACTGTCTCTTGG - Intergenic
1041451427 8:58010551-58010573 CAGCACCTAGCACAGTGCCAGGG - Intronic
1041837575 8:62233591-62233613 CAACACCCTGCCATGTGTCTGGG - Intergenic
1042105899 8:65325983-65326005 CAGCAGCCAGTGCAGTGTCTGGG + Intergenic
1042583701 8:70311047-70311069 TAGCACCTAGCACAATGTCTCGG + Intronic
1043385533 8:79744142-79744164 GTGCACCCAGCACAGTCTCTGGG - Intergenic
1044354677 8:91207277-91207299 CATCACACAGAACTGTGGCTAGG + Intronic
1044806313 8:96011879-96011901 CTGCACCAAGCTCTGTGTGTGGG - Intergenic
1045568774 8:103348754-103348776 CAGAACCCAGCTCTGTTTTTAGG - Intergenic
1046691820 8:117294299-117294321 CAGCACCCTGCACTTTGCCCAGG - Intergenic
1046759775 8:118009249-118009271 AATCAACCAGCAATGTGTCTAGG + Intronic
1046773989 8:118144449-118144471 AAGCACCTAGCACAGTGCCTGGG + Intergenic
1048083393 8:131152653-131152675 CAGTGCCTAGCACTATGTCTAGG - Intergenic
1049422166 8:142521853-142521875 CAGCACCCAGCACCCTCACTGGG - Intronic
1049473891 8:142788104-142788126 CAGGCCCCGGCACTGTGTCAGGG - Intergenic
1050982313 9:12035943-12035965 CAGCAGCCAGCACTGGGAGTTGG + Intergenic
1052415233 9:28169567-28169589 CAGAACCCAGAACAGTGTCTGGG - Intronic
1052836407 9:33253278-33253300 AACCACCCAGCTTTGTGTCTTGG + Exonic
1052860991 9:33437580-33437602 CAGTGCCCAGCCTTGTGTCTGGG - Intergenic
1053061788 9:35037569-35037591 AAGCATCTAGCACTCTGTCTTGG - Intergenic
1054154341 9:61629553-61629575 CAGCACCCAGCACAGTGCCTGGG + Intergenic
1054809709 9:69425251-69425273 CAGCACCCAGTTCAGTGTGTGGG - Intergenic
1054881757 9:70151425-70151447 CAGCATCTAGCACTGTGCCCTGG + Intronic
1054906989 9:70420539-70420561 CAGGATCCAGCACTGGGCCTGGG - Intergenic
1056970234 9:91195410-91195432 GAGCACCCTGCTCTGTGGCTGGG + Intergenic
1058687809 9:107493039-107493061 CAGCACCCATAACTGGGTATGGG + Intergenic
1058702308 9:107611392-107611414 CAGCACCTAGCACTGGGGCAGGG - Intergenic
1058834992 9:108853007-108853029 CAGCCCCCAGCACTGGGCCCAGG + Intergenic
1059310740 9:113387577-113387599 CAGGACCCAGCACTGAACCTAGG + Exonic
1059932310 9:119273048-119273070 CAGCACCCAGAACTGTGTGCAGG - Intronic
1060849813 9:126865325-126865347 CAGAGCCCAGCAGTGTGTCTGGG - Intronic
1061262159 9:129486416-129486438 CAGCACCTAGCACGGTGGCTGGG - Intergenic
1061306359 9:129735452-129735474 CAGTACCCAGGATGGTGTCTGGG - Intergenic
1061459944 9:130729497-130729519 CATCTCCCTGCACTGTGTTTGGG + Intronic
1062463861 9:136672742-136672764 TGGCACCCAGCAGTGGGTCTGGG - Intergenic
1062518892 9:136949552-136949574 CAGCGCCCAGGACCGTGTCTGGG + Intronic
1186514152 X:10153803-10153825 CAGCATATAGCACTGTCTCTGGG - Intergenic
1187141992 X:16602517-16602539 AAGCACCCAGCACAGTGGCTGGG + Intronic
1189065969 X:37809456-37809478 CAGCATCCAGCAGGGTGCCTTGG + Intronic
1189959560 X:46311445-46311467 CAGCCCCCAGCACTGTTCCCAGG - Intergenic
1190106731 X:47566642-47566664 CCGCACCCAGCACTGTGACCCGG + Exonic
1190129057 X:47730311-47730333 CAGCTCCCTGCAGGGTGTCTAGG + Intergenic
1192588393 X:72339288-72339310 CAGCACCCAGCACAGGGCCTAGG - Intronic
1195594281 X:106670680-106670702 CTGTACCAAGCACTGTGCCTGGG + Intronic
1198624741 X:138558310-138558332 CTTCACCCAGCACAGTGCCTAGG + Intergenic
1198666867 X:139034145-139034167 CAGCACCTAGCACAGTGCCTGGG - Intronic
1199155770 X:144547259-144547281 CAGCACCTAGCACAGTACCTGGG + Intergenic
1199227410 X:145394121-145394143 AAGCACCCAGAAGTGTGTCTAGG + Intergenic
1200009720 X:153111947-153111969 CAGCACCGAGCACCGTGTTGGGG + Intergenic
1200029880 X:153287975-153287997 CAGCACCGAGCACCGTGTTGGGG - Intergenic
1200286601 X:154828733-154828755 CAGGATCAAGAACTGTGTCTAGG - Intronic
1201900707 Y:19044264-19044286 CAGCAGTGAGCACTGTGGCTGGG + Intergenic
1202601068 Y:26593498-26593520 CAGCACCCTCCTCAGTGTCTGGG - Intergenic