ID: 928265792

View in Genome Browser
Species Human (GRCh38)
Location 2:29810600-29810622
Sequence CAGTCAACGTTGAAACTGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 56
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 54}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
928265792 Original CRISPR CAGTCAACGTTGAAACTGGG AGG (reversed) Intronic
900241863 1:1621110-1621132 CAGTCAAAGCTGAAGCTGGTGGG + Intronic
904913312 1:33951510-33951532 CAGTCAACGATGTAAATGGCTGG - Intronic
911870340 1:103089235-103089257 CAGCCAGGGTTGAAACTCGGTGG + Intronic
912375777 1:109208716-109208738 CAATCAAGCTTGAAACTGCGGGG + Intergenic
921820824 1:219615060-219615082 CAGTAAATTTTGAAATTGGGTGG - Intergenic
923456877 1:234172321-234172343 GAGTCAGCCTTGAACCTGGGAGG - Intronic
924078191 1:240363499-240363521 CATTCAAGCTTAAAACTGGGAGG - Intronic
1065699616 10:28412004-28412026 AAGTAAACGGGGAAACTGGGAGG - Intergenic
1068243456 10:54335827-54335849 GAGGCAACTTTGGAACTGGGTGG + Intronic
1069340210 10:67401260-67401282 CAGTATATGCTGAAACTGGGTGG - Intronic
1076635658 10:131880485-131880507 CAGGCAACGTTGAGGGTGGGGGG - Intergenic
1078377190 11:10806245-10806267 CAGTGAAAGCAGAAACTGGGTGG - Intronic
1080585114 11:33674747-33674769 CAGTAGATGTTGAAATTGGGTGG + Intergenic
1093132387 12:15407868-15407890 CAGTCAACTTTGAAATTGCTAGG - Intronic
1095401555 12:41820110-41820132 CAGGCACTGTTCAAACTGGGGGG - Intergenic
1116320892 14:43461035-43461057 CATTCAACATAGAAACTGTGTGG + Intergenic
1118907777 14:70035077-70035099 CAGTGAGCGTTGGCACTGGGAGG + Intergenic
1119899121 14:78244850-78244872 AAGTCACGGTTGAACCTGGGAGG - Intronic
1122080070 14:99260994-99261016 CTTTCAACGCTGAAAGTGGGAGG - Intronic
1127223240 15:56902531-56902553 CAATAAATGTTGAAGCTGGGTGG + Intronic
1134903784 16:17961863-17961885 CAGTCAACACTGAAGCTGAGAGG + Intergenic
1136608980 16:31354965-31354987 CAGTCAAGGGTGAGCCTGGGAGG + Intergenic
1137371041 16:47906034-47906056 CAGTCCACGTTCAAACAGGTTGG - Intergenic
1139170460 16:64625273-64625295 CAGTCAAGCCTGAAACTGGAAGG + Intergenic
1140830324 16:78744891-78744913 CAGAAAACGTTGAAGCTTGGAGG - Intronic
1141432683 16:83978910-83978932 CAGTTAATGTTGGGACTGGGAGG - Intronic
1141523932 16:84599182-84599204 CAGTCAATGTGGATCCTGGGTGG - Intronic
1143353103 17:6303821-6303843 CAGTCAAAGTTGATAGTGAGTGG + Intergenic
1145256851 17:21330056-21330078 CAGTCATTGCTGAGACTGGGAGG - Intergenic
1145319760 17:21757896-21757918 CAGTCATTGCTGAGACTGGGAGG + Intergenic
1152538766 17:80964420-80964442 CAGCCAACGTTCACACTGCGGGG - Exonic
1159438602 18:68449029-68449051 CAGTCACTGTGGAAACTGGATGG - Intergenic
928265792 2:29810600-29810622 CAGTCAACGTTGAAACTGGGAGG - Intronic
932487327 2:72092069-72092091 AAGTCAGTGTGGAAACTGGGAGG - Intergenic
934718514 2:96557030-96557052 CAGTCAAAGTTGATACCTGGGGG - Intergenic
1173421741 20:42907394-42907416 CAGTCAACGTTGAGGTTGGAGGG - Intronic
1173836958 20:46132221-46132243 CAGCCAAGGTTGAAAGTGGGAGG + Intergenic
1177818125 21:26000268-26000290 CAGTCCAGGTTGCCACTGGGAGG - Intronic
1183411631 22:37658475-37658497 TAGTCGGCGTTGAAACTCGGCGG + Intronic
952292362 3:32029999-32030021 GAGTCATGTTTGAAACTGGGTGG - Intronic
961843958 3:129744779-129744801 CACTCAAAGATGAAACTGAGAGG + Intronic
964090188 3:152866718-152866740 CAGCCAACGCTTGAACTGGGAGG - Intergenic
968827464 4:2909831-2909853 CAGTCAAAGTTGAACCAGCGAGG - Intronic
976029589 4:80736014-80736036 CAGGCAACCTTCAAAATGGGAGG - Intronic
977233276 4:94477528-94477550 CTTTAAACGTTGAAACTTGGAGG + Intronic
977314557 4:95429522-95429544 CATTTAACTTTGAAAGTGGGAGG - Intronic
980800095 4:137735862-137735884 CAGTCAGTGATGAAACTGGCAGG + Intergenic
981022271 4:140041529-140041551 CAGACCAGGTTGAAGCTGGGAGG + Intronic
984544314 4:181082064-181082086 CACCCAGCCTTGAAACTGGGTGG + Intergenic
988129519 5:27084883-27084905 CATTCAACCTTGAACCTAGGAGG + Intronic
1011460697 6:87600187-87600209 CAGTTAACATTAAAACTTGGTGG + Intronic
1023322895 7:39018789-39018811 GAGTAAAAGTTGAAAGTGGGAGG + Intronic
1027203778 7:76080926-76080948 GAGACACCCTTGAAACTGGGAGG - Intergenic
1044342922 8:91068812-91068834 CAGTTTACGTTTAAACTGGAAGG - Intergenic
1046864060 8:119126300-119126322 AAGTTAACTGTGAAACTGGGAGG - Intergenic
1194766880 X:97851982-97852004 CAGTTAAAGGTGAAAATGGGTGG + Intergenic