ID: 928268469

View in Genome Browser
Species Human (GRCh38)
Location 2:29832752-29832774
Sequence GCAGTGCCTCACTCAGAGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 384
Summary {0: 1, 1: 1, 2: 0, 3: 33, 4: 349}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
928268469_928268471 -10 Left 928268469 2:29832752-29832774 CCAGGCTCTGAGTGAGGCACTGC 0: 1
1: 1
2: 0
3: 33
4: 349
Right 928268471 2:29832765-29832787 GAGGCACTGCCCATCTTCATGGG 0: 1
1: 0
2: 1
3: 15
4: 127
928268469_928268474 6 Left 928268469 2:29832752-29832774 CCAGGCTCTGAGTGAGGCACTGC 0: 1
1: 1
2: 0
3: 33
4: 349
Right 928268474 2:29832781-29832803 TCATGGGTCTCAAAGTCTAGTGG 0: 1
1: 0
2: 2
3: 39
4: 389
928268469_928268475 7 Left 928268469 2:29832752-29832774 CCAGGCTCTGAGTGAGGCACTGC 0: 1
1: 1
2: 0
3: 33
4: 349
Right 928268475 2:29832782-29832804 CATGGGTCTCAAAGTCTAGTGGG 0: 1
1: 0
2: 4
3: 43
4: 329

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
928268469 Original CRISPR GCAGTGCCTCACTCAGAGCC TGG (reversed) Intronic
900651559 1:3732499-3732521 GCAGTTCCTCCCCCAGGGCCAGG + Intronic
900711775 1:4119062-4119084 GCAGTGGGGCCCTCAGAGCCAGG - Intergenic
900767844 1:4517465-4517487 GCAGTGCTTAACCCAGACCCTGG + Intergenic
900796398 1:4711243-4711265 GCTGCCCCTCACCCAGAGCCCGG - Intronic
900876856 1:5349070-5349092 GGACTGCCCCACCCAGAGCCTGG + Intergenic
901142336 1:7043199-7043221 TCGGGGCCTCACTCAGAGGCAGG + Intronic
901321028 1:8339916-8339938 ACAGAGCCTGACCCAGAGCCTGG - Intronic
901481823 1:9530434-9530456 GGAGTGCCTAACTCAGAGCTGGG - Intergenic
901888527 1:12241529-12241551 ACAGTGCCTCCCACAGAGCAGGG + Intronic
901965430 1:12862633-12862655 TCAGTGGATCACTCAAAGCCAGG - Intronic
902173203 1:14629730-14629752 TCAGTGCCTGACTCAGAGGTGGG - Intronic
902273749 1:15325027-15325049 GGAGTGGCTCACCCACAGCCGGG - Intronic
902449938 1:16490695-16490717 GTATGTCCTCACTCAGAGCCTGG + Intergenic
902472127 1:16656581-16656603 GTATCTCCTCACTCAGAGCCTGG + Intergenic
902486676 1:16750865-16750887 GTATCTCCTCACTCAGAGCCTGG - Intronic
902504521 1:16930495-16930517 GTATGTCCTCACTCAGAGCCTGG - Exonic
902605723 1:17568259-17568281 AAAGTGCTTCACTGAGAGCCTGG - Intronic
902664572 1:17928399-17928421 GCACAGCATCACTCAGAGGCTGG - Intergenic
902935915 1:19764463-19764485 TCAGTGCCTCACACGGGGCCGGG + Intronic
903360560 1:22774327-22774349 CCAGTGCCTGGCTCAGGGCCTGG + Intronic
903447670 1:23432612-23432634 CCAGTGCCTAGCGCAGAGCCTGG - Intronic
903454506 1:23477975-23477997 CCAGTGCCTCATACAGGGCCTGG + Intronic
903542483 1:24104853-24104875 CCAGTGCCTCAGTCAGGTCCTGG + Intronic
904062270 1:27721017-27721039 CCAGTGCCTAAGCCAGAGCCTGG + Intergenic
904360356 1:29967229-29967251 GAAGTGCCTACCACAGAGCCTGG + Intergenic
905479486 1:38251323-38251345 CCTGTCCCTCACACAGAGCCTGG - Intergenic
906686673 1:47767463-47767485 CCAGTGCTTCACACAGAGCCTGG - Intronic
906703483 1:47876920-47876942 GCAGTGCCTAGCACAGTGCCTGG - Intronic
906705497 1:47892051-47892073 GCTGTGCTTCTCACAGAGCCTGG - Intronic
906803637 1:48759086-48759108 GCAGCTCCTCATACAGAGCCCGG + Exonic
907618186 1:55946589-55946611 CCAGTGTCTAAGTCAGAGCCTGG + Intergenic
908265722 1:62377461-62377483 GCAGTCCCTCACTCTGTGTCTGG + Intergenic
908671373 1:66551941-66551963 ACAACCCCTCACTCAGAGCCTGG - Intronic
908857678 1:68448351-68448373 TCAGTGCCTAGCTCAGTGCCTGG - Intronic
909690668 1:78403971-78403993 ACAGTGCCTAACACAGTGCCTGG - Intronic
910970228 1:92848746-92848768 TCAGTGCCTCAAACAGTGCCTGG + Intronic
911774727 1:101793941-101793963 GCAGTGCCTAGCTTAGTGCCTGG - Intergenic
912522460 1:110255141-110255163 CCAGTGCCTGGCACAGAGCCTGG + Intronic
913207648 1:116555923-116555945 ACAGTGCCTGGCACAGAGCCAGG - Intronic
913237609 1:116798386-116798408 CCAGTGCCTAACACAGTGCCTGG - Intergenic
914286978 1:146236222-146236244 TCAGTCCCTGACTCAGACCCTGG + Intergenic
914462711 1:147899460-147899482 GAAGAGCCACACTCAAAGCCAGG + Intergenic
914917884 1:151829546-151829568 GCACTCCTTCCCTCAGAGCCTGG + Intronic
916080330 1:161228208-161228230 GCAGAGCCTCACTCATCGGCTGG + Exonic
916080718 1:161230325-161230347 GCGGTGCATACCTCAGAGCCTGG + Exonic
916514616 1:165504210-165504232 TCAGTGCCTAGCACAGAGCCTGG + Intergenic
916890681 1:169109403-169109425 GCAGTGGCTCACTCAGACACAGG - Intronic
917449833 1:175138288-175138310 CCAGTGCCTATCTCAGAGCCTGG + Intronic
917742574 1:177975261-177975283 GCAGTGCCTTGCACAGTGCCTGG + Intronic
920350910 1:205337425-205337447 CCACTGCGTCACTCAGACCCTGG + Exonic
920370811 1:205478083-205478105 ACAGTGCCTGGCTCAGAGCAAGG - Intergenic
921314170 1:213874965-213874987 CCCTTGCCTCACTCGGAGCCAGG + Intergenic
921447275 1:215261465-215261487 GCAGAGCCTAACATAGAGCCAGG + Intergenic
923540639 1:234885862-234885884 GGAGTCCCTCCCCCAGAGCCCGG - Intergenic
1062957955 10:1552506-1552528 GCAGCCCCTCACTGAGTGCCAGG - Intronic
1063717602 10:8544058-8544080 TCATTGCATCACCCAGAGCCCGG + Intergenic
1064252903 10:13720504-13720526 TCAGTGCCTGACACAGTGCCAGG - Intronic
1065360429 10:24884512-24884534 GCAGAGCCACCCGCAGAGCCAGG + Intronic
1067278329 10:44853437-44853459 TCAGCACCTCACCCAGAGCCAGG + Intergenic
1068514171 10:58005395-58005417 CCAGAGCCTGACACAGAGCCTGG + Intergenic
1069827960 10:71265803-71265825 GTGGTGCCTCACCAAGAGCCTGG - Intronic
1070657565 10:78281944-78281966 GCAGTGCCTGGCTCTGTGCCTGG - Intergenic
1071136791 10:82462722-82462744 GCAGTGCCATTCTCAGAGACAGG + Intronic
1071776486 10:88794196-88794218 GCTGTGCCACACTCACAGGCAGG - Intergenic
1072082465 10:92045692-92045714 GCTGAGCCTCGCGCAGAGCCAGG + Intergenic
1072631714 10:97151177-97151199 ACAGTACCTAACACAGAGCCTGG + Intronic
1072640189 10:97205781-97205803 CCAGAGCCACACACAGAGCCTGG - Intronic
1072688094 10:97550609-97550631 CCACTGCCTCACACAGTGCCTGG - Intronic
1074533267 10:114311248-114311270 GCATTGCCTCAGTCTGAGCCAGG + Intronic
1074863232 10:117529067-117529089 GCAGTGCCTCACTGTGAACGTGG + Intergenic
1075406510 10:122199175-122199197 GCAGTGCCACAATCAGTGCCTGG - Intronic
1075475097 10:122727591-122727613 ACAGTGCTTCTCTCAGAGCATGG - Intergenic
1076117611 10:127911396-127911418 GCAGTGCCTCACACCCAGCCTGG - Intronic
1077045940 11:545179-545201 GTAGCACCTCACTCAGAGCTGGG + Intronic
1077110583 11:860424-860446 GCAGTGCATCAGCCAGCGCCAGG - Intronic
1077715489 11:4575906-4575928 GAAGGGCCTCACTAAGAGGCTGG - Intronic
1078922690 11:15845259-15845281 GCAATGCCCAGCTCAGAGCCTGG - Intergenic
1079466751 11:20738283-20738305 GCAGTGCTTTACAGAGAGCCTGG + Intronic
1081874875 11:46401634-46401656 GCAGGGCCTCCCGCAGAGCCTGG - Intronic
1083166520 11:60891426-60891448 CCAGTGCCTCCCTCAGTGCCTGG + Intronic
1084035426 11:66506976-66506998 CCAGTGCCTCATGCACAGCCTGG + Intronic
1084941451 11:72615443-72615465 TCAGTCCCTCACCCAGAGTCTGG + Intronic
1085407372 11:76271311-76271333 TCGGTGCCTCGCTCAGTGCCTGG - Intergenic
1086329473 11:85739144-85739166 GCAGTGCCTTGCACAGTGCCTGG + Intronic
1086953458 11:92913529-92913551 TCGGTGCCTAGCTCAGAGCCAGG + Intergenic
1087056845 11:93945149-93945171 TCAGTCCCTGACTCAGACCCTGG - Intergenic
1087949806 11:104207075-104207097 TCAGGGCCTGACTCAGTGCCAGG - Intergenic
1089336179 11:117725442-117725464 TCAGAGCCTCAATCAGAGTCTGG - Intronic
1089661013 11:119985263-119985285 TCAGTTTCCCACTCAGAGCCAGG - Intergenic
1090171693 11:124611371-124611393 GCAGGGCCTGGCTCAGGGCCTGG + Intergenic
1090972555 11:131655778-131655800 TCATTGCCTCACACAGAGCTTGG - Intronic
1091264345 11:134258884-134258906 GCAGTGACACACTCTGAGCAGGG + Intronic
1091716906 12:2784073-2784095 CCAGTGCCTGGCACAGAGCCTGG + Intergenic
1092534934 12:9378846-9378868 CCAGTGCCTAGCACAGAGCCTGG - Intergenic
1093296802 12:17401040-17401062 GCAGTGCCCCACCCCCAGCCTGG - Intergenic
1094062183 12:26326119-26326141 CCAGTGCCTTGCTCAGTGCCTGG + Intergenic
1095630206 12:44367531-44367553 GGAGTGCCTCAGTCAGTCCCTGG + Intronic
1095938049 12:47705995-47706017 GCAGCGACTCACGCCGAGCCCGG + Exonic
1096478160 12:51921218-51921240 CCAGTCCCAGACTCAGAGCCCGG + Intronic
1098979119 12:76936018-76936040 CCAGTGCCTAGCACAGAGCCTGG - Intergenic
1101969133 12:109300515-109300537 CCAGGGACGCACTCAGAGCCTGG + Intronic
1102011989 12:109624458-109624480 GCTGTGCCTCACCCTGAGGCTGG + Intergenic
1102347308 12:112168340-112168362 GCACTGCCTCCCCCAGTGCCCGG + Intronic
1102485108 12:113250239-113250261 GCAGTGCCACAATCTGAGCAGGG - Intronic
1103331134 12:120154848-120154870 GCAGGACCTCCCTCAGAGTCGGG - Intronic
1105039292 12:132949136-132949158 GGAGCAACTCACTCAGAGCCTGG - Intronic
1105069453 12:133225862-133225884 GCAGAGCCTCCCTCAGGGCAGGG + Intronic
1105707543 13:22977442-22977464 GCCCTGCCTCTCCCAGAGCCGGG + Intergenic
1108935371 13:55875241-55875263 GTATTGCATCACACAGAGCCTGG + Intergenic
1113065987 13:106374832-106374854 GCTGTGCCTCGCACAGTGCCCGG + Intergenic
1113859959 13:113475528-113475550 GCCATGCGTCACTCAGAGACAGG - Intronic
1114194561 14:20465771-20465793 TCTGTGCCTCACTCAGTGGCAGG - Intergenic
1115845191 14:37523675-37523697 TCAGTGCCTAACACAGTGCCTGG - Intronic
1117912829 14:60650516-60650538 GCAGTGTCCCTCTCAGAGCAGGG - Intronic
1118347062 14:64948193-64948215 GCAGAGCCGCTCTCAGGGCCAGG + Exonic
1118924215 14:70177146-70177168 CCAGTGCCTAAATCAGTGCCTGG + Intronic
1119643261 14:76330156-76330178 CCAGAGCCTCCCTCAGAACCAGG - Intronic
1121175317 14:91886682-91886704 TCAGTGCCTCACTCCAGGCCTGG - Intronic
1121331550 14:93052779-93052801 TCAGTCCCTCACTCAGAACTGGG + Intronic
1122424275 14:101596646-101596668 GCACTGGCTCACTCACTGCCAGG - Intergenic
1123000680 14:105292628-105292650 GCAGTGCATCCCTGAGAGCTGGG + Intronic
1123997639 15:25729878-25729900 CCAGTGCCTACCTCAGAGCCTGG + Intronic
1125539804 15:40463806-40463828 GCAGAGCCACACTCAGAGTAAGG - Intronic
1127713122 15:61621019-61621041 GCAGTACCTGAATCAGTGCCTGG + Intergenic
1128315046 15:66654928-66654950 GATGCGCCCCACTCAGAGCCGGG - Intronic
1128510608 15:68311855-68311877 GCAGTGCCACATTCAGTGCCAGG + Intronic
1129246529 15:74282337-74282359 GCAGTGCCGGACTCACATCCCGG + Intronic
1129846770 15:78771451-78771473 GGAGGGCCTGGCTCAGAGCCAGG + Intronic
1130960699 15:88657032-88657054 GCAGTGCTTCTCTCATAGCATGG - Intergenic
1132320868 15:100924180-100924202 ACTGAGCCTCACACAGAGCCTGG + Intronic
1133117749 16:3587845-3587867 GCAGGTGCTCACTCACAGCCTGG + Intronic
1133965714 16:10530256-10530278 TCAGAGCCTCACACAGTGCCTGG + Exonic
1135423696 16:22321959-22321981 GCAGTGTCTGAATGAGAGCCCGG - Intronic
1135562891 16:23489993-23490015 GCAGTGCCTGCCTAAGAACCAGG + Intronic
1135826614 16:25734399-25734421 GCAATGCCTCTCTGGGAGCCTGG - Intronic
1136116083 16:28095667-28095689 GCAGTGCCTCACATAGGGCCTGG - Intergenic
1137268156 16:46885136-46885158 GCAAGGCCTCACTGAGTGCCCGG - Intronic
1137768011 16:50992690-50992712 CCTGTTCCACACTCAGAGCCAGG - Intergenic
1139101302 16:63770748-63770770 GCAGTGCCTGGCACAGAGCAGGG + Intergenic
1139945542 16:70638992-70639014 GCATTTCCTAACTAAGAGCCAGG - Intronic
1140792295 16:78403666-78403688 GCAGTGCCTCATCCAGGGCCTGG - Intronic
1143008566 17:3853090-3853112 TTAGTGTCTAACTCAGAGCCTGG + Intergenic
1143029453 17:3959776-3959798 GCAGTGGCTCCCGCAGAGCAAGG - Intronic
1143238895 17:5427088-5427110 GCAGGGCCCCACTCAAAGGCTGG - Intronic
1143532783 17:7514752-7514774 GCAGTGCCTGGCACAGAGCAGGG - Intergenic
1144778755 17:17797559-17797581 GAAGCGCCTCACTCGGGGCCGGG + Exonic
1145908250 17:28528068-28528090 GCAGGGCCTGTCTCAGTGCCAGG - Intronic
1146274829 17:31509994-31510016 GCAAGGCCTGACCCAGAGCCAGG + Intronic
1146455540 17:33006683-33006705 CCAGTACCTAACTCAGTGCCTGG + Intergenic
1147967813 17:44202991-44203013 CCAGGGCCTCACCCAGAGTCAGG - Intergenic
1148397221 17:47318792-47318814 GCAGTTCTACACTCAAAGCCTGG + Intronic
1149453790 17:56770860-56770882 CCAGTGCCTCACATAGTGCCTGG - Intergenic
1150236134 17:63594344-63594366 GCAGTGCCCCAGCCCGAGCCGGG + Intergenic
1151431079 17:74063672-74063694 GCAGTGGCTCCCACTGAGCCAGG + Intergenic
1151519387 17:74617423-74617445 GCAGTGCCAGTCACAGAGCCGGG + Exonic
1152533060 17:80931768-80931790 GCCCTGCCTCAGTCAGAGTCTGG + Intronic
1153757529 18:8299309-8299331 GCAGTGCCTCCCACAGAGTCTGG - Intronic
1156070532 18:33201819-33201841 GCAAAGCCTAACTTAGAGCCCGG + Intronic
1157305925 18:46517623-46517645 TCAGTGCCTGAGTCAGTGCCTGG + Intronic
1158315512 18:56208035-56208057 GGAGTTGCTCACTCAGAGGCTGG - Intergenic
1158574921 18:58628822-58628844 TCAATGCCTCACACACAGCCTGG - Exonic
1160390456 18:78527524-78527546 GCACTGCCCCACTGAGGGCCAGG - Intergenic
1161069647 19:2253704-2253726 GCAGCTCCTCGCTCAGGGCCGGG + Exonic
1161363321 19:3863782-3863804 CCAGTGCCTCACTCACAGTCAGG - Intronic
1161698150 19:5781865-5781887 ACAGTGCCCTACACAGAGCCGGG + Intergenic
1162765861 19:12919056-12919078 TCAGTGCGTCAGTCAGGGCCGGG + Intronic
1162968870 19:14168246-14168268 CCAGCGCCTCACCCAGGGCCTGG + Intronic
1163160868 19:15463492-15463514 TCAGTGCCTAAATCAGGGCCTGG + Intronic
1163375541 19:16928020-16928042 GCGGTGGCTCGCTCAGACCCAGG + Exonic
1163991434 19:21002487-21002509 CCAGTGCCACACCCTGAGCCTGG + Intergenic
1164514651 19:28923349-28923371 GTAGTCCCTCCCTCAGTGCCAGG - Intergenic
1164625197 19:29723258-29723280 GCAGTTCCAGACTCTGAGCCTGG - Intergenic
1164868452 19:31624454-31624476 GCAGTGCCTGGCACAGGGCCTGG - Intergenic
1165881282 19:39045775-39045797 CCAGTGCCTAACCCAAAGCCTGG - Intergenic
1166561269 19:43733875-43733897 GCATTGCCCTACACAGAGCCTGG - Intronic
1166888675 19:45976467-45976489 GCAGGGCCCCAATCAGAGGCTGG + Intergenic
1167194683 19:48019964-48019986 TCAGTGCCCAACTCAGTGCCTGG - Intronic
1167315026 19:48757834-48757856 GCCCTGCCTCCCTCAGACCCAGG - Intronic
1168067849 19:53929315-53929337 GCAGTGCCTAACTCAGATGCAGG - Intronic
1168684778 19:58341913-58341935 GTAGTGCCTGACCCAAAGCCTGG + Exonic
1202704524 1_KI270713v1_random:13375-13397 GTATCTCCTCACTCAGAGCCTGG + Intergenic
925428127 2:3768386-3768408 AATGTGCCTCACTCAGAGCTGGG - Intronic
925742894 2:7020876-7020898 CCAGGGCCTCACACAGTGCCTGG - Intronic
926205682 2:10833141-10833163 GCTGTCCCTGACACAGAGCCTGG - Intronic
926702447 2:15812647-15812669 GCAGAGCCTAAATCTGAGCCAGG - Intergenic
928268469 2:29832752-29832774 GCAGTGCCTCACTCAGAGCCTGG - Intronic
929297857 2:40268741-40268763 GCTGTCACTCACTGAGAGCCAGG - Intronic
929975309 2:46628151-46628173 GCACAGCTGCACTCAGAGCCTGG - Intergenic
931257119 2:60583437-60583459 CCAGTGCCTCCATCAGTGCCTGG + Intergenic
931582230 2:63789379-63789401 CCAGTGCCTGGCTCAGAACCTGG + Intronic
935373163 2:102368516-102368538 GCAGGGGCTCACTGGGAGCCAGG + Intronic
935589610 2:104834590-104834612 GCAGGGCCTGGCTCAGAGTCCGG + Intergenic
938339447 2:130525876-130525898 GCAGAGCATCAGTCAGAGCAAGG - Intronic
938350391 2:130594876-130594898 GCAGAGCATCAGTCAGAGCAAGG + Intronic
940735188 2:157443154-157443176 GCAGTGCCTAACACAGTGACTGG - Intronic
940771373 2:157842430-157842452 CCAGTGCCTAAATCAGTGCCTGG - Intronic
941914858 2:170804901-170804923 GCAGTGGCGCAATCAGATCCTGG - Intergenic
943049133 2:182894358-182894380 TCAGGGCCTCACTCGGCGCCTGG - Intergenic
943453925 2:188079199-188079221 GCAGGGACTCTCTCAGAGCTTGG - Intergenic
943613577 2:190065279-190065301 TCAGTGCCTCACCCAGTCCCTGG - Intronic
943953421 2:194158237-194158259 GTATTGCATCACACAGAGCCTGG + Intergenic
944489663 2:200245262-200245284 GCTGTGCTTCACGCAGGGCCTGG - Intergenic
945724081 2:213453697-213453719 TCAGTGCCACACTCACTGCCTGG - Intronic
946180766 2:217947609-217947631 GAAGTGCCTAACTCAGCACCTGG - Intronic
1168868106 20:1106092-1106114 GAAGTGCCTCACACAGTGCAGGG + Intergenic
1170875819 20:20249068-20249090 GCAGGGCCTGACTCATGGCCTGG - Intronic
1170922563 20:20692504-20692526 GCAGTGCCCCTCTCGGAACCTGG + Intronic
1172184550 20:33023251-33023273 GCAGAGCAGAACTCAGAGCCAGG + Intronic
1172333051 20:34089327-34089349 TCAGTTTCTCAGTCAGAGCCCGG + Exonic
1172529730 20:35621609-35621631 GCTGTGCCTCACACAGAGTTGGG - Intergenic
1172627843 20:36358450-36358472 GCAGTGCCTGGCCCAGAGCAGGG + Intronic
1173452269 20:43175540-43175562 GCAGTGGCACAGTCAGAGCCCGG - Intronic
1173452278 20:43175590-43175612 GCAGTGGCACAGTCAGAGCCCGG - Intronic
1173452285 20:43175640-43175662 GCAGTGGCACAGTCAGAGCCCGG - Intronic
1173452294 20:43175690-43175712 GCAGTGGCACAGTCAGAGCCCGG - Intronic
1173926054 20:46782168-46782190 CCAGTGCCTGGGTCAGAGCCTGG - Intergenic
1175173666 20:57096584-57096606 CCAGAGCGTCACTCAGAGCCTGG + Intergenic
1175379470 20:58552870-58552892 GCAGAGCCTCACCCAGAGGGAGG + Intergenic
1176379855 21:6106821-6106843 GCAGTGCCTGACACACAGCAGGG + Intergenic
1178415411 21:32400894-32400916 GGAGTGGCTCATGCAGAGCCTGG + Intergenic
1178938973 21:36889082-36889104 CCAGTGCCTAACACAGTGCCTGG + Intronic
1179743619 21:43431416-43431438 GCAGTGCCTGACACACAGCAGGG - Intergenic
1179810993 21:43869657-43869679 GCTGTGCCTAACTCAGGGCTGGG - Intronic
1180839060 22:18950290-18950312 CCAGTGGCACAGTCAGAGCCGGG + Intergenic
1181042334 22:20198052-20198074 GCAGTGCCTCACCCTGACCCTGG + Intergenic
1181417610 22:22771819-22771841 GCAGTGCCTCAGCCATGGCCTGG + Intronic
1182517644 22:30868124-30868146 GCAGCGCCTCACCCACAGCCTGG + Intronic
1184432533 22:44449867-44449889 CCAGTGCCTGGCCCAGAGCCTGG + Intergenic
1184437773 22:44489999-44490021 GTAGCACCTCACCCAGAGCCTGG - Intergenic
1184962802 22:47943875-47943897 ACAGTGCCTCAAACACAGCCTGG + Intergenic
1185419454 22:50727415-50727437 TCATTGCCACACACAGAGCCTGG - Intergenic
951725820 3:25757837-25757859 ACAGTGCCTCCCTCACAGACTGG + Intronic
952903449 3:38124831-38124853 GAACTGTCTCTCTCAGAGCCGGG - Intronic
953070113 3:39511745-39511767 CCAGGGCCTCACTCAGGGCCTGG + Intronic
953737764 3:45510901-45510923 CCAGTGCCTAGCTCAGTGCCAGG + Intronic
953877804 3:46676384-46676406 GCAGTGAGTTGCTCAGAGCCTGG + Exonic
954129784 3:48554546-48554568 TCAGTTCCACACTTAGAGCCTGG + Intronic
954213639 3:49112145-49112167 GCCCTGCCTCCCCCAGAGCCTGG + Intronic
954334848 3:49910207-49910229 GCAGTGCCTCTCGCAGGGCCAGG + Exonic
954543227 3:51410171-51410193 GCAGAGCCTTCCTCAGGGCCTGG - Intronic
954698071 3:52437974-52437996 GCAGTGCCTGGGCCAGAGCCAGG - Exonic
954743402 3:52772558-52772580 GCAGGGGCTCACTTAGAGTCTGG + Intergenic
956778788 3:72588197-72588219 GCAGTGCCTAGCACAGTGCCTGG - Intergenic
958113316 3:89179904-89179926 TCAGTGTCTCACTGAGAGCAGGG + Intronic
958170413 3:89932997-89933019 CCAGGGCCTCACTCAGTTCCAGG + Intergenic
959108492 3:102093744-102093766 CCAGTGCCTAGCTCAGAGCCTGG + Intergenic
959545935 3:107596487-107596509 TCAGTGCCTCTCTCAGGGGCTGG + Intronic
959581547 3:107988058-107988080 CCAGTGCCTAACACAGTGCCTGG + Intergenic
960008783 3:112810739-112810761 GCAATGCCTAAGTCAGAACCAGG + Intronic
960994601 3:123332544-123332566 GCAGTGAGTCACCCTGAGCCGGG - Exonic
961203627 3:125063469-125063491 CCAGTGACTCCATCAGAGCCTGG - Intergenic
961312877 3:126014974-126014996 GCAGTGCCTGAGACAGATCCAGG - Intronic
961402947 3:126659953-126659975 TCAGTGCTTCACACAGAGCTGGG + Intergenic
961781859 3:129325159-129325181 GCAGTGTCTCCCACAGACCCAGG + Intergenic
962428934 3:135301656-135301678 GCACTGCTCCACTCAGAGCCTGG - Intergenic
963035260 3:141020221-141020243 GCAGAGGCTAACTCAGATCCGGG + Intergenic
963133178 3:141876819-141876841 GAAGTCCCTCAACCAGAGCCTGG + Exonic
964478900 3:157122655-157122677 GGAGTGCCTAGCACAGAGCCGGG - Intergenic
964767404 3:160192124-160192146 TCAGTGCCTCATTCAAACCCAGG - Intergenic
966327184 3:178770226-178770248 GCATAGCCTCTCTCAGAGCCTGG - Intronic
966643903 3:182221030-182221052 GCAGGGCCGCACACAGAGACAGG + Intergenic
966718537 3:183038077-183038099 CCAGTGCCTGGATCAGAGCCTGG - Intronic
967807262 3:193727159-193727181 GAATTGCCTCACTCAGAAGCTGG - Intergenic
968124078 3:196145618-196145640 GAAGTGAATCAATCAGAGCCAGG - Intergenic
968454099 4:688578-688600 GCCGCCCCTCACTCAGAGTCAGG + Intronic
968655350 4:1776173-1776195 ACACTGACTCACGCAGAGCCTGG - Intergenic
968764516 4:2461295-2461317 GTAGAGCCTCGTTCAGAGCCTGG + Intronic
968877444 4:3280435-3280457 GCTGTGGCTCACACACAGCCAGG - Intergenic
970039592 4:11780956-11780978 CAAGTGCCTCCCTCAGAGCTGGG + Intergenic
975125279 4:70775358-70775380 CTAGTGCCTAACTCAGTGCCTGG - Intronic
975452491 4:74545658-74545680 GCAGTGACTGGCTCAGGGCCAGG - Intergenic
975556424 4:75670194-75670216 GGAGTCCCTCACTCATAGCTGGG + Intronic
977376369 4:96209769-96209791 GAAGACCCTCACTCAGATCCTGG + Intergenic
977874860 4:102137312-102137334 ACAGTGCCTGGCACAGAGCCTGG + Intergenic
978534646 4:109748300-109748322 TCAGTGCCTAACACAGTGCCTGG - Intronic
978744249 4:112174159-112174181 GCTGTGCCTCGCTTAGAGACTGG - Intronic
979590366 4:122472166-122472188 CCAGTGCCTAAGTCAGAGCAAGG + Intergenic
983914327 4:173275348-173275370 TCAGTTCCCCACTCAGAGCTCGG - Intronic
984518410 4:180770554-180770576 TTGGTGTCTCACTCAGAGCCTGG - Intergenic
985017411 4:185651038-185651060 GCAGTGCCAGCCTCCGAGCCTGG + Intronic
986375259 5:7124572-7124594 GCAGAGCCTGACACACAGCCAGG + Intergenic
987348170 5:16997247-16997269 GCAGTTCCACACCCAGAGGCAGG - Intergenic
987613775 5:20245603-20245625 GCAGTGCCTGGCACAGAGCTTGG + Intronic
989625105 5:43421869-43421891 CCAGTGCCTCGCTCAGTGCTTGG + Intergenic
991561529 5:67958618-67958640 CCAGTGCCTAACACAGTGCCTGG - Intergenic
992555981 5:77903962-77903984 GCTGTGCTGCACACAGAGCCAGG - Intergenic
994256946 5:97608318-97608340 AAAGTGCCTTAATCAGAGCCAGG - Intergenic
995282831 5:110355070-110355092 TCACTGCCTGGCTCAGAGCCTGG + Intronic
996655071 5:125925686-125925708 GTATTGCATCACACAGAGCCAGG - Intergenic
997064436 5:130545151-130545173 GTATTGCATCACACAGAGCCTGG + Intergenic
997807665 5:136935063-136935085 GCAGGGACACACCCAGAGCCTGG - Intergenic
997893231 5:137693736-137693758 TCAGTCACTCTCTCAGAGCCAGG - Intronic
998372252 5:141669555-141669577 GCAGTGCTTAACACAGGGCCTGG + Intronic
999480047 5:151939934-151939956 CCAGTGCCTATCTCAGTGCCTGG + Intergenic
999701752 5:154234701-154234723 GCAGGGCCTCTCTCAGTGCAGGG - Intronic
1000385186 5:160668608-160668630 TCAGTGATTGACTCAGAGCCTGG + Intronic
1001310805 5:170608939-170608961 ACAGAGCCCGACTCAGAGCCAGG - Intronic
1002071443 5:176680795-176680817 GCTGTGCCCCACGCAGAGCAGGG - Intergenic
1002436791 5:179236389-179236411 TTAGTGCCTCAGTCAGGGCCTGG - Intronic
1002461913 5:179378112-179378134 CGAGTGCCTGACGCAGAGCCAGG + Intergenic
1004270261 6:14188915-14188937 GCAGAGCCTCACTGAGACTCAGG + Intergenic
1004890852 6:20099004-20099026 GCAGTGCCTCACAGAGTACCAGG + Intergenic
1006364989 6:33610048-33610070 GCAGTGCTGCACTCAGAGACAGG + Intergenic
1006379615 6:33689944-33689966 CCAGTGCCCAGCTCAGAGCCTGG - Intronic
1006391826 6:33763145-33763167 TGAGGTCCTCACTCAGAGCCTGG + Intergenic
1006440908 6:34053230-34053252 GCAGAGCCAGACTCAGACCCAGG + Intronic
1006510899 6:34520481-34520503 GCAGAGCCAGACTCAGACCCAGG - Intronic
1006851348 6:37101085-37101107 CCAGTGCCTAGCTCAGTGCCTGG + Intergenic
1006931724 6:37692732-37692754 GCAAAGCCTCATTTAGAGCCTGG - Intronic
1007391877 6:41554038-41554060 ACAGTTCCTCAGTCAGGGCCTGG - Intronic
1010742547 6:79525944-79525966 GTATTGCATCACACAGAGCCTGG - Intronic
1011021009 6:82812400-82812422 GCAGTGTCTAACACAGTGCCTGG + Intergenic
1011069293 6:83363074-83363096 GCACTGTCTCACCCACAGCCAGG + Intronic
1011293343 6:85800428-85800450 GCTGGGCCACACACAGAGCCAGG - Intergenic
1013164000 6:107573432-107573454 GCAGTGCCCCACACAATGCCTGG - Intronic
1013515000 6:110876385-110876407 CCTGGGCCGCACTCAGAGCCTGG + Intronic
1015203942 6:130614009-130614031 GCAGTGCCTAATTCAATGCCTGG - Intergenic
1015987149 6:138895822-138895844 GCAGTGGCTCACACATGGCCAGG - Intronic
1017125279 6:151059023-151059045 GCAGTGCCTCAGTGAGGGGCAGG + Intronic
1017622054 6:156309188-156309210 GCAGAGCCTGAGTCAGAGCTTGG - Intergenic
1018397965 6:163394906-163394928 GCAATGCCTACCCCAGAGCCAGG + Intergenic
1019927050 7:4200148-4200170 GTAGTGCCCCACCCAGAGCCAGG + Intronic
1021161360 7:17277017-17277039 TCAGTGCCTGACACAGAGTCTGG - Intergenic
1021522408 7:21551048-21551070 GTATTGCATCACACAGAGCCTGG + Intronic
1022821835 7:33969807-33969829 ACTCTGCCTCACACAGAGCCTGG - Intronic
1026971953 7:74473838-74473860 GCAGTGGCTCACGCCGAGCTGGG + Intronic
1030869788 7:114741127-114741149 GCAGTTCTTCACAAAGAGCCCGG + Intergenic
1031740920 7:125429687-125429709 GCCCTGCATCTCTCAGAGCCTGG + Intergenic
1032539730 7:132693155-132693177 TCAGGGCCTCACTCACAGTCAGG - Intronic
1032790573 7:135239523-135239545 TCAGTGCGTAACACAGAGCCTGG - Intronic
1033036347 7:137879465-137879487 ACAATGCCTCACTCAGGCCCCGG - Exonic
1033894556 7:146054787-146054809 GTATTGCCTCACCCATAGCCTGG + Intergenic
1034788107 7:153943846-153943868 GCAGAGCATCACTCAGACTCGGG - Intronic
1034837341 7:154364615-154364637 GCAGTACCTTAGTCACAGCCAGG + Intronic
1035707020 8:1683581-1683603 ACAGTGCCTCACACATCGCCTGG + Intronic
1035708653 8:1696023-1696045 GCGATTCCTCACCCAGAGCCAGG - Intronic
1037291068 8:17349867-17349889 GAAGTTGCTCAGTCAGAGCCAGG - Intronic
1037598202 8:20372312-20372334 GCAGTTCCACACTCTGAGCAGGG + Intergenic
1039466010 8:37786020-37786042 AAAGTGCCTCACACAAAGCCTGG + Intronic
1041415132 8:57599607-57599629 TCAGTGCCTACATCAGAGCCTGG - Intergenic
1041784401 8:61615521-61615543 CCAGTGCCTAAAACAGAGCCTGG + Intronic
1041903021 8:63002675-63002697 CCTGTGCCTAACTCAAAGCCTGG - Intergenic
1042706838 8:71672394-71672416 GAAGTGCCTCACATAGTGCCTGG + Intergenic
1042793034 8:72629757-72629779 TCAGTGCCTAGCACAGAGCCTGG - Intronic
1043583861 8:81744814-81744836 CCAGTGCCTAACACAGTGCCAGG + Intronic
1043868193 8:85399642-85399664 GCAGTGCCTGTCTCAGGCCCTGG + Intronic
1045351335 8:101343044-101343066 TAAGTGCCTCACACAGTGCCTGG - Intergenic
1046821851 8:118642574-118642596 GCAGTGCCTCAAACAGTGCCTGG - Intergenic
1048130046 8:131685891-131685913 TCAGTGCCTAGCACAGAGCCTGG - Intergenic
1048251013 8:132866873-132866895 GCACTGCCTCACTGAGGACCTGG + Intergenic
1048302152 8:133259733-133259755 CCATTGCCTCACCAAGAGCCCGG - Intronic
1048325732 8:133437424-133437446 TCAGTGCCTGACACAGTGCCTGG - Intergenic
1048496619 8:134940976-134940998 CCAGTGGCTCACACAGTGCCTGG + Intergenic
1048869956 8:138789162-138789184 GCAGGGCCTCAGGCAGAGCTGGG - Intronic
1049577746 8:143397455-143397477 CCAGTGTCCCACTCAGAGCTGGG + Intergenic
1049603289 8:143517953-143517975 GCCGTGCCTCACTCAGAGCCTGG - Intronic
1049680036 8:143914035-143914057 GCAGTGCCTTACTCTGTCCCAGG - Intergenic
1051552559 9:18346326-18346348 TCAGTGCCTTTCTCAGAGCAGGG + Intergenic
1055781461 9:79825721-79825743 GCACTGCCTCCCTCACAGCTAGG + Intergenic
1056424937 9:86466645-86466667 GCATTACCTATCTCAGAGCCAGG + Intergenic
1056813422 9:89782027-89782049 CCATTGCCTCTCTCTGAGCCAGG - Intergenic
1058194004 9:101952191-101952213 GCAGGGCCCTACTCAGAACCAGG - Intergenic
1058441061 9:105007657-105007679 GCAGTGCCTGGCACAGAGACTGG - Intergenic
1058677167 9:107410183-107410205 GGACTGCCTCACACAGAGCCAGG - Intergenic
1059021457 9:110580491-110580513 GCAGTGCCTCACATAGTTCCTGG - Intergenic
1059334972 9:113563326-113563348 CCAGGGCCTAACACAGAGCCTGG + Intronic
1059505697 9:114797906-114797928 CTAGTGCCTCAGTCAGTGCCTGG + Intronic
1060176050 9:121498495-121498517 GCATTTCCTTACTCAGAGACTGG + Intergenic
1061152290 9:128835778-128835800 CCACTGCCCCACGCAGAGCCAGG - Exonic
1061225862 9:129280715-129280737 GCAGTGGCTCAGGCAGGGCCTGG - Intergenic
1061527380 9:131177885-131177907 GCAGCCCCTAACACAGAGCCTGG + Intronic
1061614386 9:131770135-131770157 GCAGTGCCCTCTTCAGAGCCTGG + Intergenic
1061991149 9:134159387-134159409 GCTCTGCCTCTCTCAGGGCCTGG + Exonic
1062156245 9:135050292-135050314 GCCCTGCCTCACTCTGCGCCAGG - Intergenic
1062452336 9:136620934-136620956 CCAGTGCCTCCCTCCGCGCCGGG + Intergenic
1190770829 X:53512780-53512802 CCAGTGCCACACTCTGGGCCTGG + Intergenic
1191780270 X:64856913-64856935 TCAGCGCCTCACACAGAGCTTGG + Intergenic
1191851166 X:65587526-65587548 CCCGTTCCTCCCTCAGAGCCAGG - Intergenic
1192405890 X:70885863-70885885 GCAGTGTCTCACTCTTACCCAGG - Intronic
1192635234 X:72809309-72809331 GCAGAGCCTCATTCAGGGCACGG - Intronic
1192646480 X:72911494-72911516 GCAGAGCCTCATTCAGGGCACGG + Intronic
1199716829 X:150512617-150512639 CCAGAGCCTCAGGCAGAGCCCGG + Exonic
1199724680 X:150568685-150568707 GCAGTGCCCGGCTCCGAGCCAGG - Intronic
1201317651 Y:12663257-12663279 CCGGGGCCTCACTCAGAGCCAGG + Intergenic