ID: 928272358

View in Genome Browser
Species Human (GRCh38)
Location 2:29867888-29867910
Sequence CTACAGACACAGTTGGGGAT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 188
Summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 168}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
928272352_928272358 18 Left 928272352 2:29867847-29867869 CCTTGCTTTGCTTGAGTGAGGGG 0: 1
1: 0
2: 0
3: 6
4: 124
Right 928272358 2:29867888-29867910 CTACAGACACAGTTGGGGATGGG 0: 1
1: 0
2: 1
3: 18
4: 168

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
928272358 Original CRISPR CTACAGACACAGTTGGGGAT GGG Intronic
900822383 1:4899545-4899567 ATACAGTCACATTTGGGGTTTGG + Intergenic
903047314 1:20574589-20574611 CTGCAGGCACAGTGGGGCATGGG + Intergenic
903846910 1:26284246-26284268 CTACAGGCAGAGTTGGGAACCGG + Intronic
904784237 1:32973409-32973431 CAGCAGACACAGCGGGGGATGGG + Intergenic
904881251 1:33698749-33698771 CTACCGACACAGGTGGGCAGAGG + Exonic
906521522 1:46469636-46469658 CTACACACACACTTGGAGACTGG - Intergenic
909399817 1:75214398-75214420 CTAAAGACACAGGTGGGTAATGG + Intronic
910683780 1:89894962-89894984 CTACAGACACACTTGGGTCATGG - Intronic
911152428 1:94608335-94608357 ATACAAACACAGATGGGGTTGGG - Intergenic
911802068 1:102154278-102154300 CTACAGATATAGTTAGAGATAGG - Intergenic
912471888 1:109911872-109911894 CTACCGCCACAGTTGGGGCAGGG - Intronic
918451129 1:184660643-184660665 TTACACACACAGGTGGGGAGTGG - Intergenic
919531781 1:198729986-198730008 CTAAAGACACATTTATGGATTGG + Intronic
921117414 1:212106804-212106826 CCACGGACACAGTTAGGGCTTGG - Intronic
921163802 1:212491491-212491513 CTACATACACAGATTGGAATGGG + Intergenic
923314206 1:232763879-232763901 CTACAGAAACAGCAGGGGTTTGG - Intergenic
924048047 1:240052506-240052528 GTGCTGACACTGTTGGGGATGGG + Intronic
1063208510 10:3857360-3857382 ATACAGTCACATTTGGGGTTAGG - Intergenic
1068533008 10:58210100-58210122 CTGCAGCCACTGTGGGGGATGGG + Intronic
1068875858 10:61996013-61996035 CTACAGGCACAGCTGGGGCTTGG - Intronic
1070039205 10:72758426-72758448 CCACAGATACAGTTGTGTATTGG + Intronic
1073121444 10:101124684-101124706 CTTCAGCCACAGTTCAGGATTGG + Intronic
1077153733 11:1082467-1082489 TTACAGACACTGTTGGGCAGCGG - Intergenic
1077466699 11:2736869-2736891 CCACAGTCACAGGTGGGGAGTGG + Intronic
1078308134 11:10211539-10211561 CTAAAGACACAGCTGATGATGGG - Intronic
1078409373 11:11099391-11099413 TTACAGAAAGAATTGGGGATTGG + Intergenic
1078617966 11:12882435-12882457 CTACACACACAGGTGGGGATGGG - Intronic
1079119515 11:17671995-17672017 CTGCAGAGACACATGGGGATGGG + Intergenic
1079345440 11:19647645-19647667 CTACAGACACAGCAAGGTATGGG - Intronic
1083291246 11:61691490-61691512 CTGCAGACACAGTTGGAGGCAGG - Intronic
1084360359 11:68665040-68665062 CACCAGACACAGCTGGGGACTGG + Intergenic
1084482183 11:69428410-69428432 ATACATACAAAGCTGGGGATTGG - Intergenic
1085603401 11:77875895-77875917 GTACAGAGACAGTTTGGGACAGG + Intronic
1085837936 11:79976225-79976247 CTGCAGACACAGATGGAGATGGG + Intergenic
1086430004 11:86727501-86727523 GTCCTGACACAGCTGGGGATGGG + Intergenic
1088187244 11:107184549-107184571 CTACAGACAAATATGGAGATTGG + Intergenic
1090509431 11:127358362-127358384 CCACACACACAGTTTGGGCTTGG - Intergenic
1091394258 12:143897-143919 GTACAGACCCAGGTGTGGATGGG + Intronic
1091623188 12:2105425-2105447 CTACAGACACAGTTCATGAGAGG - Intronic
1093270841 12:17058959-17058981 CTACGGACTAAGTTGGGGAGGGG + Intergenic
1093503215 12:19836068-19836090 CTACAGACCTAGTTGAGGACAGG + Intergenic
1093963753 12:25303495-25303517 CTACAGCTGCAGTGGGGGATCGG - Intergenic
1095225797 12:39675239-39675261 CTGCAGCCACTGTGGGGGATGGG - Intronic
1096382255 12:51168777-51168799 ATAAAAATACAGTTGGGGATAGG - Intronic
1098163721 12:67672373-67672395 ATACAGACACATTGGGGGTTAGG - Intergenic
1101558256 12:105831118-105831140 ATACAGACACACTGGGGGTTAGG - Intergenic
1103156732 12:118691773-118691795 ATACAGTCACAGTGGGGGTTAGG + Intergenic
1109747280 13:66641784-66641806 ATACAGACACAGTTTTGCATTGG - Intronic
1112563003 13:100530120-100530142 CTGGAGACACAGTTGGAGAAGGG + Exonic
1113978657 13:114252373-114252395 GTACAGGCACAGTAGGGGTTAGG + Intronic
1116706408 14:48307808-48307830 CTGCAGAAACATTTGGGGCTGGG + Intergenic
1117435748 14:55713865-55713887 CTACAGACACAGTAGTGACTGGG - Intergenic
1117581338 14:57154393-57154415 ATACAGTCACATTGGGGGATAGG - Intergenic
1118086874 14:62427758-62427780 ATAAAGACAAAGTTGGGGGTGGG + Intergenic
1118730882 14:68665496-68665518 TTATAGACACAGTTTGGGATGGG - Intronic
1119430577 14:74565682-74565704 CTGTAGACACAGTTGGGGCTGGG + Intronic
1121720823 14:96107522-96107544 ATACAGCCACACTTGGGGTTAGG - Intergenic
1124254112 15:28127229-28127251 CTGCAGACGCAGCTGGGCATAGG + Intronic
1126079485 15:44945567-44945589 CTACAGTCACATTGGGGGTTAGG - Intergenic
1126465991 15:48962450-48962472 CTACAGCACCTGTTGGGGATGGG - Exonic
1127016553 15:54695240-54695262 ATACAGAAACAGTTGGGAAAGGG - Intergenic
1127540337 15:59931540-59931562 CTAAAGACACAGTTAGGTCTAGG - Intergenic
1128694163 15:69747857-69747879 ATAAAGACAGAGTTGGGCATGGG - Intergenic
1128906973 15:71476000-71476022 CTAAAGACACAGTTAGTGAATGG - Intronic
1129654381 15:77514086-77514108 ATACAGACACATTAGGGGTTAGG + Intergenic
1130893465 15:88152335-88152357 ATACAGACACAATGGGGGTTAGG - Intronic
1134178295 16:12026494-12026516 CCACAGACCCAGTTGGGCAGAGG + Intronic
1138417381 16:56879249-56879271 CACCAGACACAGTGGGGGCTGGG + Intronic
1140710152 16:77670267-77670289 ATACAGTCACAGTGGGGGCTGGG - Intergenic
1141802302 16:86318333-86318355 CAGGAGACACAGTTGGAGATAGG - Intergenic
1143382320 17:6504090-6504112 CCACAGACACATTTTGGGAGGGG - Intronic
1143565068 17:7716220-7716242 GCACAGCCACAGTTGGGGAGGGG + Intergenic
1144034057 17:11349595-11349617 GAGCAGCCACAGTTGGGGATGGG + Intronic
1144114853 17:12078046-12078068 GTACAGTCACATTTGGGGTTAGG + Intronic
1147875947 17:43620645-43620667 CTACAGAAACAGGTGTGGGTTGG + Intergenic
1148070852 17:44907717-44907739 TAGCAGACACAGTTGGGGATGGG - Intronic
1149520790 17:57316853-57316875 TTACAGACTCTGTTGGTGATGGG + Intronic
1151023436 17:70647259-70647281 GAACAGACACAGATGGGGATTGG - Intergenic
1151555028 17:74842524-74842546 CTACAGAGACAGTGGGGGACTGG - Exonic
1152759439 17:82100320-82100342 ATCCAGACGGAGTTGGGGATGGG - Intergenic
1154982180 18:21511939-21511961 CAACAAACACAGTTGGGGGCTGG - Intronic
1156260877 18:35444188-35444210 ATACAGTCACATTTGGGGTTAGG + Intronic
1156588068 18:38454884-38454906 CTCCAGAGACCTTTGGGGATTGG - Intergenic
1158806908 18:60984749-60984771 CTACAGATGCAGTTGGGTATAGG - Intergenic
1159677096 18:71298833-71298855 CTAAAGATAGAGTTTGGGATGGG - Intergenic
1160010809 18:75105984-75106006 CTAGAGTCCCAGTTGGGGATAGG - Intergenic
1161939027 19:7391110-7391132 CTCCTGACACAGGTGGGGAGGGG - Intronic
1163803467 19:19382279-19382301 GTGCAAACACAGTTGGGGCTGGG + Intergenic
1165205808 19:34184570-34184592 ATACAGAAACATTTGGGGAGAGG + Intronic
1166053852 19:40277097-40277119 CTTCACACACAGCTGGGGACAGG + Intronic
1167859371 19:52270491-52270513 CCTCAGACAAAGTTGGGGAGAGG + Intronic
1168121558 19:54254886-54254908 CTTTAGACACAGCGGGGGATGGG + Exonic
1168686178 19:58350867-58350889 CTACAGACACAGACGGGAAGCGG + Intronic
926283366 2:11468098-11468120 CTACAACCAGAGTTGGGGTTGGG + Intergenic
927397122 2:22665352-22665374 CTCGAGAGACAGTTGGGGGTAGG - Intergenic
927442943 2:23132235-23132257 CTACAGATAAAGTTGGAAATGGG + Intergenic
928272358 2:29867888-29867910 CTACAGACACAGTTGGGGATGGG + Intronic
929346222 2:40887758-40887780 CTACAGACAGAGTCGGGGGTGGG - Intergenic
934462520 2:94226196-94226218 CTTCCTACAGAGTTGGGGATAGG + Intergenic
937410432 2:121670124-121670146 CCACAGCCACTGTGGGGGATAGG - Intergenic
941142510 2:161802924-161802946 ATACAGTCACATTTGGGGTTGGG + Intronic
946580056 2:221118541-221118563 CAACATACATATTTGGGGATGGG + Intergenic
948076309 2:235167746-235167768 ACACAGAGACAGATGGGGATAGG - Intergenic
1171024747 20:21619706-21619728 CTACAGAAAGAGCTGAGGATAGG - Intergenic
1173480258 20:43393026-43393048 GTACAGACAAAGATGGGGATGGG + Intergenic
1174787231 20:53444363-53444385 ATAGAGACACAGTTGGGAAAGGG - Intronic
1175221993 20:57422508-57422530 CTAAAGGCACAGTGGGGGATGGG + Intergenic
1183736194 22:39646174-39646196 GCACAGACACAGATGGGGACAGG - Intronic
949806321 3:7959451-7959473 CCACAGACCCAGGTGAGGATGGG - Intergenic
952970458 3:38647664-38647686 CACCAGAGACAGCTGGGGATGGG - Intronic
955873646 3:63466867-63466889 ATACAGACACACTGGGGGTTGGG + Intronic
956385846 3:68718454-68718476 GCACTGACACAGCTGGGGATGGG + Intergenic
956842120 3:73150306-73150328 CTAAAGAAACAGGTGGGGCTGGG - Intergenic
957987131 3:87586895-87586917 CTACAGAAATAGTTTGGGCTGGG - Intergenic
958767942 3:98393525-98393547 CTATATACACATTTGGTGATAGG - Intergenic
959727535 3:109560990-109561012 CTGCAGCCACTGTGGGGGATGGG + Intergenic
962040302 3:131700348-131700370 CTCCAGGCAAAGTGGGGGATGGG + Intronic
963773958 3:149419954-149419976 TTACAGTCACAGTGGGGGTTAGG - Intergenic
963906230 3:150775185-150775207 CTACCAACTCAGTAGGGGATGGG + Intergenic
969210474 4:5683527-5683549 CTGGAGACACAGTTGTGAATAGG + Intronic
973711553 4:53634618-53634640 CTACAATCACAGTGGGGAATTGG + Intronic
975464714 4:74696346-74696368 CTACATAAACAGATGGGTATGGG + Intergenic
977241255 4:94572715-94572737 ATACAGACACAGATGGGGCATGG + Intronic
979434605 4:120673703-120673725 CTGCAGCCACTGTGGGGGATGGG - Intergenic
980975204 4:139604566-139604588 CTACAGTCACACTAGGGGTTAGG - Intronic
980998432 4:139804007-139804029 TTACAGAAAAAGCTGGGGATCGG + Intronic
983386313 4:167067070-167067092 ATACAGAATCAGTTGGGAATAGG + Intronic
983751738 4:171282343-171282365 TTACAGACAAAATTGGGGATGGG + Intergenic
984864930 4:184273253-184273275 CGACAGCCACAGATAGGGATGGG - Intergenic
986306919 5:6522963-6522985 CTACAGTCACACTGGGGGTTGGG + Intergenic
986859292 5:11906463-11906485 CTACAGATACTGTTGGGGCTGGG + Intergenic
987238860 5:15972066-15972088 CTACACAGAAAGATGGGGATGGG - Intergenic
988329029 5:29810990-29811012 ATACAGACACATTGGGGGTTAGG - Intergenic
990229401 5:53695361-53695383 CAAGAGAGACAGTTGGGGAGAGG - Intergenic
991106728 5:62851873-62851895 CTACTGACACAATGGGGGATGGG + Intergenic
991455261 5:66796835-66796857 CTACAGATACAGTAAGGAATAGG - Intronic
992947113 5:81821947-81821969 CTCCAGACTCAGTTGTGGAAGGG + Intergenic
994364604 5:98898825-98898847 CTACAAATAGTGTTGGGGATGGG - Intronic
995225190 5:109692780-109692802 CCACAGACAGGGGTGGGGATGGG + Intronic
998013942 5:138717479-138717501 CTACAGACACAATAAAGGATGGG - Intronic
998209161 5:140181053-140181075 CTACAAAGACATTTGGGGAGAGG + Intronic
999130107 5:149275905-149275927 ATACAGTCACACTTGGGGTTAGG + Intronic
1000734722 5:164884909-164884931 GTGCAGAGACATTTGGGGATTGG - Intergenic
1001477343 5:172059983-172060005 CAACATACACATTTGGGGAGGGG - Intronic
1002560268 5:180076917-180076939 CTGCAGCCACAGCTGGGGGTGGG - Intergenic
1007549606 6:42718958-42718980 CTAAAGACACAATTAGGGCTGGG - Intronic
1008067642 6:47066959-47066981 CTACAGACAAGGTTGGGGAGTGG - Intergenic
1008827921 6:55720762-55720784 CCAAAGACATATTTGGGGATGGG + Intergenic
1014102139 6:117523112-117523134 CTACAGTCCCAGTTGGTGATAGG + Intronic
1015481281 6:133713180-133713202 CCACAGACACATTTGGACATTGG - Intergenic
1016622169 6:146123613-146123635 CTGGAGGCACAGTTGGGTATTGG - Intronic
1017755588 6:157526514-157526536 CTCCAGACAAAGCTAGGGATAGG + Intronic
1019306450 7:337590-337612 TTGCAGACACAGGTGGGCATGGG - Intergenic
1022041799 7:26588319-26588341 CTGCACACACAGGCGGGGATGGG + Intergenic
1022400351 7:30030270-30030292 CAACAAAAAAAGTTGGGGATGGG - Intronic
1022535848 7:31097801-31097823 CAACAGATACAGTTGGGGGGGGG + Intronic
1022638979 7:32163590-32163612 CTACAGAGTCAGTGGGGGCTTGG - Intronic
1023048043 7:36228596-36228618 CTGCAGACACAGCTGGGGCCAGG + Intronic
1027468105 7:78540253-78540275 CTGTAGCCACTGTTGGGGATGGG + Intronic
1029067963 7:97871768-97871790 CTACAGAGACAGGTGGGGACTGG + Exonic
1030942277 7:115667848-115667870 CCACAGACACATTGGGGGTTGGG + Intergenic
1032246468 7:130217876-130217898 ATCCAGGCACAGTTGGGGCTAGG + Intergenic
1032268499 7:130384353-130384375 CTGCAGGCACAGCTTGGGATGGG - Intronic
1032491976 7:132330598-132330620 ATGCAGACACAGTTGGGGCCTGG - Intronic
1032754074 7:134871645-134871667 CTGCAGACAGTGTGGGGGATGGG + Intronic
1037855527 8:22368171-22368193 CTCCGGACACAATTGGGGAGTGG + Intronic
1041442356 8:57911127-57911149 CTACAGCCACAGATCAGGATAGG + Intergenic
1041763710 8:61394503-61394525 CTGCAGCCACTGTGGGGGATTGG + Intronic
1041952005 8:63514002-63514024 CTACAGAAAAAGTGGGGGCTTGG + Intergenic
1042607978 8:70565581-70565603 CCACGGCCACTGTTGGGGATGGG - Intergenic
1043404416 8:79916062-79916084 CTATAGAAACAATTGGGGGTGGG - Intergenic
1045422884 8:102034145-102034167 TAACAGACACACTTGGGGAAAGG - Intronic
1046181246 8:110651622-110651644 TTAAAAACATAGTTGGGGATGGG - Intergenic
1048411793 8:134182641-134182663 ATAAAAACAGAGTTGGGGATGGG + Intergenic
1048951277 8:139498909-139498931 CTACACACACAGATGGGGCAAGG - Intergenic
1053398493 9:37797559-37797581 CTACACACACATTTGTAGATTGG - Intronic
1056425516 9:86471883-86471905 CTACAGACAAAGTTGAGTGTTGG + Intergenic
1057745689 9:97749096-97749118 CCACAAACACAGTTTGGGAAGGG - Intergenic
1060273272 9:122163171-122163193 CTACAGACACAGGGGAGGAAGGG + Intronic
1062599821 9:137314711-137314733 CCACAGACAGTGTGGGGGATGGG + Intronic
1187156919 X:16728740-16728762 ATAAAGACACAGTTGAGGCTGGG + Intronic
1188418620 X:29969701-29969723 CTACTGAGACAATTGGGGGTGGG - Intergenic
1193690402 X:84634622-84634644 CTGCAGCCTCTGTTGGGGATAGG - Intergenic
1193734169 X:85136935-85136957 CGACAGACAGAGATGGGGAGAGG - Intergenic
1196889443 X:120277937-120277959 ATACAGTCACATTGGGGGATAGG - Intronic
1196971184 X:121110132-121110154 CTGCAGCCACTGTGGGGGATGGG - Intergenic
1198478163 X:137015950-137015972 GTTCAGACACATTTGAGGATTGG - Intergenic
1201241867 Y:11965125-11965147 CCACAGACAGGGTTGGGGAGGGG + Intergenic