ID: 928272773

View in Genome Browser
Species Human (GRCh38)
Location 2:29871978-29872000
Sequence TCTAGGGCTTGGAGGACAAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 213
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 195}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
928272773_928272781 -1 Left 928272773 2:29871978-29872000 CCCATTGTCCTCCAAGCCCTAGA 0: 1
1: 0
2: 0
3: 17
4: 195
Right 928272781 2:29872000-29872022 ACTGGGTATCAGTAAGTACGTGG 0: 1
1: 0
2: 0
3: 4
4: 71
928272773_928272782 17 Left 928272773 2:29871978-29872000 CCCATTGTCCTCCAAGCCCTAGA 0: 1
1: 0
2: 0
3: 17
4: 195
Right 928272782 2:29872018-29872040 CGTGGCTGACATAGATCTCATGG 0: 1
1: 0
2: 1
3: 4
4: 76
928272773_928272783 25 Left 928272773 2:29871978-29872000 CCCATTGTCCTCCAAGCCCTAGA 0: 1
1: 0
2: 0
3: 17
4: 195
Right 928272783 2:29872026-29872048 ACATAGATCTCATGGCATGCTGG 0: 1
1: 0
2: 0
3: 5
4: 82

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
928272773 Original CRISPR TCTAGGGCTTGGAGGACAAT GGG (reversed) Intronic
910381775 1:86633944-86633966 ACTAGGGATTGTTGGACAATGGG - Intergenic
911597611 1:99814720-99814742 TGTAGGGCTTTGTAGACAATTGG - Intergenic
915274334 1:154777569-154777591 TCTAAGGCTTGGAGGTCACCTGG - Intronic
916032747 1:160892659-160892681 ACTAGGGCTTGTTGGACAGTGGG + Intergenic
916590792 1:166188225-166188247 TCTCGGGTTTGGAGGAAAAATGG - Intergenic
919152374 1:193717600-193717622 TCAAGGGATTGGAGGATACTTGG + Intergenic
923258408 1:232242704-232242726 TGGAGGGCTTGGGGGACAAGTGG + Intergenic
1065867560 10:29927143-29927165 TCTAGGGCAGAGTGGACAATGGG - Intergenic
1066162954 10:32754760-32754782 ACTGGGGCTTGTAGGACAGTGGG + Intronic
1066596011 10:37050516-37050538 ACCAGGGCTTGTCGGACAATGGG - Intergenic
1071034889 10:81233217-81233239 TCTAGGGTCTGGAGGATGATGGG - Intergenic
1071735464 10:88294048-88294070 TCTAAGGGTTGGAGGAAAATAGG + Intronic
1073301843 10:102475665-102475687 ACCAAGGCTTGGAGGACAGTGGG + Intronic
1073584431 10:104694874-104694896 TCTAGGTCTTGGAAAACAGTAGG + Intronic
1073655066 10:105405588-105405610 ACTAAGGTTTGGAGGACAAATGG + Intergenic
1074494571 10:113968521-113968543 TCTTGGGATTGGAGGATATTAGG + Intergenic
1076807922 10:132868345-132868367 TTTAGGGCTGTGAGGACAACCGG + Intronic
1077400285 11:2352257-2352279 TCTAGGGCTTTGAGGGCAGAAGG - Intergenic
1077507831 11:2940346-2940368 TGCAGGGCTGGGAGGACAAGAGG - Intergenic
1078654750 11:13227967-13227989 TCTGGTCCTTGGATGACAATGGG - Intergenic
1082754674 11:57062867-57062889 ACTGGGGCTTGTAGGACAGTGGG + Intergenic
1085368910 11:75979889-75979911 ACTGGGGCTTGTAGGACAGTGGG - Intronic
1085696174 11:78706669-78706691 TCAAAGGCTTGGAAGACAACTGG - Intronic
1086564670 11:88212057-88212079 TCTAGGGTCTGGAGGATGATGGG + Intergenic
1087268751 11:96089523-96089545 TCTAGGGCTTATAGCACATTTGG - Intronic
1087495898 11:98890542-98890564 TCTGGGGTCTGGAGGACAATGGG + Intergenic
1088396131 11:109371690-109371712 TCCAGGGCTAGGAAGACAATGGG + Intergenic
1089370659 11:117953801-117953823 TCTAGGGCTTCTCGGAGAATGGG - Intergenic
1091664551 12:2409905-2409927 AGTAGGGCTAGGAGGAAAATGGG + Intronic
1092287288 12:7136041-7136063 GCTAGGGCTTGGATGATATTGGG + Intronic
1093375951 12:18428498-18428520 TATAGGGCTTGGTGAATAATTGG - Intronic
1095306367 12:40643192-40643214 ACTGGGGCTTGTCGGACAATGGG - Intergenic
1098597657 12:72293429-72293451 CCTAGGGCTTGGAGCACTGTGGG + Intronic
1100787697 12:98096217-98096239 TCTGGGGTCTGGATGACAATGGG - Intergenic
1100974739 12:100110932-100110954 TCTTGGGCATGGAGGAATATGGG + Intronic
1102073956 12:110045205-110045227 TCTATGGTTTGGACTACAATTGG + Intronic
1104543118 12:129685661-129685683 TCTAGGGTCTGGGGGACAGTTGG - Intronic
1104721660 12:131047927-131047949 TCCTGGGCTTGGAGGAGAAGGGG - Intronic
1109702696 13:66047804-66047826 TCTGGGGTCTGGAGGACAGTGGG + Intergenic
1110377898 13:74814731-74814753 TCTAGGGTCTGGAAGACAGTGGG - Intergenic
1114394849 14:22349036-22349058 ACTGGGGCTTGTAGGACACTGGG + Intergenic
1114574440 14:23699621-23699643 TCTAGGGCTTCAGGGATAATGGG - Intergenic
1117358402 14:54948180-54948202 ACTAGGGCTTGTCGGACAGTGGG + Intronic
1117794461 14:59377793-59377815 TGTAATGCTTGTAGGACAATTGG + Intergenic
1117856823 14:60042748-60042770 ACTGGGGCTTGTCGGACAATAGG - Intronic
1117903486 14:60560297-60560319 TCTAGAGCATGGAGCACATTAGG + Intergenic
1120359194 14:83475414-83475436 TCTATGGCTTGAAGGAAAAGTGG + Intergenic
1120809355 14:88787159-88787181 GCTAAGTCTTTGAGGACAATAGG - Intronic
1122523980 14:102367057-102367079 GCTAGAACTTGGAGGACAAGTGG + Intronic
1124445012 15:29722670-29722692 TCTAAGGTCTGGAGGACAATGGG - Intronic
1124493493 15:30172618-30172640 TCTAGGGTGTGGGGGACAGTGGG + Intergenic
1124750041 15:32365707-32365729 TCTAGGGTGTGGGGGACAGTGGG - Intergenic
1125190476 15:36986727-36986749 TCTAGGGCTGAGAGGACAAAAGG - Intronic
1126894238 15:53241228-53241250 TTGAGGGCTTGGAAGACGATCGG + Intergenic
1126996517 15:54450783-54450805 ACTAGGGCTTGTCGGACAGTGGG - Intronic
1129669107 15:77597320-77597342 TCCAGGGCTTGGCGCACAGTAGG - Intergenic
1129796569 15:78381977-78381999 ACTAGGGCTTGTCGGACAGTGGG - Intergenic
1130737558 15:86566141-86566163 ACTGGGGCTTGTAGGACAGTGGG - Intronic
1130741668 15:86607265-86607287 TCTGGGGATTGGAAGCCAATTGG + Intronic
1131080242 15:89528666-89528688 TCTGGGGCCTGGAGGACCATTGG - Intergenic
1131310743 15:91287857-91287879 TCTATGGCTGTGAGGACAAGGGG + Intronic
1132246891 15:100304238-100304260 TCCAGTGCTTGGAGGAGAAGGGG - Intronic
1132558512 16:583180-583202 CCTTGGGCTTGGAGGTCATTGGG + Exonic
1135346012 16:21689094-21689116 TCTAGGACTTGAAGGGCCATAGG + Intronic
1135528076 16:23229185-23229207 TATAGGGGTTGGAGGCCAAAAGG + Intergenic
1136777827 16:32881121-32881143 GCTATGGCTCGGAGGAGAATGGG - Intergenic
1136892796 16:33980393-33980415 GCTATGGCTCGGAGGAGAATGGG + Intergenic
1140551638 16:75872079-75872101 TCTAAGGCTTGGAGAAGAAGAGG + Intergenic
1141743818 16:85912817-85912839 TCCAGGGCGTTGAGGGCAATTGG + Intronic
1141793592 16:86253121-86253143 TCCAGGGCTAGGACGACAAAGGG - Intergenic
1203080242 16_KI270728v1_random:1143230-1143252 GCTATGGCTCGGAGGAGAATGGG - Intergenic
1142774466 17:2125413-2125435 TCTTGGGCTTGCTGGCCAATAGG + Intronic
1142902783 17:3023491-3023513 AGTAGGGCTTGCAGGACAAGAGG + Intronic
1143518660 17:7432930-7432952 TCTAGGGCCTTGAGGATAATGGG - Intergenic
1143872006 17:9963926-9963948 TCTAGGGGGTGGAGGGCAAGGGG + Intronic
1144686506 17:17229487-17229509 TCTATGGCTTTGAGGACTCTAGG - Intronic
1145942248 17:28748694-28748716 TCTAGGGCTTCAAGGGCAAAAGG - Intronic
1146721083 17:35124025-35124047 GCTAGCGCTTGGTGGACATTTGG - Intronic
1149353643 17:55817198-55817220 GCCAGGGCTTGGAGGGAAATTGG + Intronic
1154509401 18:15079618-15079640 ACTATTGCTTGGAGGAAAATGGG - Intergenic
1155434907 18:25802153-25802175 TCTAGAGTTCAGAGGACAATTGG + Intergenic
1164559989 19:29284091-29284113 TCTAGGAATGGGAGGTCAATGGG + Intergenic
1165121488 19:33561695-33561717 TCTAGGGGTTGGGGGGCAAGGGG - Intergenic
1165308691 19:35017915-35017937 TGCAGGGCTTGGAGGCCAGTGGG - Intronic
1165927479 19:39335905-39335927 GCTGGGGCTTGGAGGACACCTGG - Intronic
1167942454 19:52958614-52958636 TCTGGCCCTTGGAGGACTATAGG + Intronic
927018105 2:18988853-18988875 TCTAGGCCTTGAATGACAACAGG + Intergenic
927810544 2:26178185-26178207 TCTTGGGCTTGGAGCCCACTGGG + Intronic
928272773 2:29871978-29872000 TCTAGGGCTTGGAGGACAATGGG - Intronic
929897682 2:45976103-45976125 TCAAGGGCTTGGGGGTCAAAAGG - Intronic
929966511 2:46541494-46541516 TCAAGGACTTGGAGCACACTTGG - Intronic
930480635 2:51944059-51944081 TCTAGGGTCTGGAGGACTGTGGG - Intergenic
930481394 2:51952539-51952561 TCTGGGGTCTGGAGGACATTGGG + Intergenic
930705137 2:54497664-54497686 TCTATGGCTTGGAGGACTGAGGG - Intronic
932649322 2:73538513-73538535 ACTAGGGATTGTAGGACAGTGGG + Intronic
932872871 2:75420875-75420897 TCTAGGGCCAGAAGGACAAAAGG - Intergenic
935209816 2:100929539-100929561 TCTAGGGGTGGGACCACAATGGG + Intronic
938685101 2:133730473-133730495 TCAAGGGCTTGGAGCAAAGTGGG - Intergenic
939074943 2:137588346-137588368 ACTGGGGCTTGTTGGACAATGGG - Intronic
945614892 2:212054929-212054951 ACTGGGGCTTGTAGGACAGTGGG + Intronic
945857820 2:215089799-215089821 TCTAGTGTTTGGAGGAAAAAAGG - Intronic
945985384 2:216349605-216349627 GCTAGGGCTTGGAGGAGGCTGGG + Intronic
946421695 2:219568636-219568658 TCTAGGGCCTGGAGGACCCCAGG - Intronic
947196238 2:227570798-227570820 TCTAGGGCTTGCAGGAAATGAGG + Intergenic
947672947 2:231951834-231951856 TCTAGGGCTGGGAGGACAGGAGG + Intergenic
1168996814 20:2139353-2139375 TCTAGTGCTCGGGGGACAAAAGG - Intronic
1169747875 20:8961726-8961748 TCTAGGGCTTAAAGAATAATTGG + Intronic
1171343107 20:24445833-24445855 TCGAGGGCAGGGAGGACAAGTGG - Intergenic
1171950330 20:31415740-31415762 TCCAAGGCTTGAAGGAGAATAGG + Intergenic
1173194458 20:40902904-40902926 TCTAGGGCTTGGCACAGAATAGG - Intergenic
1173256919 20:41400304-41400326 CCCAAGCCTTGGAGGACAATGGG - Intergenic
1173693780 20:44988791-44988813 TCAAGGGCTGGGAAGAGAATGGG - Intronic
1174923904 20:54735573-54735595 TCTGGTGGCTGGAGGACAATGGG - Intergenic
1175795796 20:61769932-61769954 GCTAGGTCTTGGAGGACAGGTGG + Intronic
1176788679 21:13292208-13292230 ACTATTGCTTGGAGGAAAATGGG + Intergenic
1177987839 21:28000354-28000376 ACTATTGCTTGGAGGAAAATGGG + Intergenic
1178816493 21:35934864-35934886 TTGGGGGCTTGGAGGATAATTGG - Intronic
1184672842 22:46024519-46024541 TCTAGGGTCTGGAGGACACCTGG - Intergenic
1185074043 22:48673636-48673658 TGTAGGGCTTGGATGTCAAATGG + Intronic
1185186148 22:49401688-49401710 ACTGGGGCTTGGTGGACAGTGGG - Intergenic
949922064 3:9010603-9010625 TCCAGGGCTAGGAGGGCACTGGG - Intronic
956448024 3:69344965-69344987 ACTGGGGCTTGTAGGACAGTGGG + Intronic
957465112 3:80579904-80579926 TGTAGGGCCTGGAGCACAAATGG + Intergenic
957547037 3:81652224-81652246 TATGGGGCTTGGAGGACAAGGGG + Intronic
958836146 3:99147609-99147631 TGGAGGGCTTGGAAGAAAATAGG + Intergenic
962183620 3:133234851-133234873 TTTTGGGCTGAGAGGACAATGGG - Intronic
963387991 3:144620643-144620665 ACTAGGGCTTGTCGGACAGTGGG - Intergenic
964189889 3:153989404-153989426 ACTAGGGCTTGTTGGACAGTGGG - Intergenic
964792607 3:160467127-160467149 TCCAGGACTTGGAGGAGGATTGG - Intronic
966322292 3:178714465-178714487 ACTAGGTCTTGGAGGACCAGTGG + Intronic
967935362 3:194723412-194723434 TCTCTGGCTTAGAGGACAAAGGG - Intergenic
968622586 4:1610545-1610567 ACTAGGGCCTGGAGGACAACAGG + Intergenic
970818974 4:20190937-20190959 TTTAGGGTTTGGAGGACGGTGGG - Intergenic
973648936 4:52978202-52978224 TCTGGAGCTTGGAGGACAGCAGG + Intronic
975795793 4:78006124-78006146 TCTAGGGCTTGGGGGAAAGAAGG + Intergenic
976515637 4:85962108-85962130 CCTAGGGCTTGAAGCACAATGGG - Intronic
976636007 4:87287037-87287059 TCTGGGGTCTGGAGGACAATGGG - Intergenic
979274923 4:118804618-118804640 TTTAGGGCTTGGTAGATAATAGG - Intronic
982088559 4:151861056-151861078 GCTAGGGCTGGGAGTACCATGGG + Intergenic
984968525 4:185164954-185164976 TCAAGGGCTTGTAGGCCACTGGG + Intronic
985666072 5:1182025-1182047 TCCAGGGTTTGGTGGACACTTGG - Intergenic
986137800 5:4999100-4999122 TCTGGGGTCTGGAGGACAGTGGG + Intergenic
988177066 5:27742538-27742560 TCCAGGGCTTGGAGGAAATAGGG - Intergenic
989350001 5:40475176-40475198 TCTAGGGCTTGGGACAAAATGGG + Intergenic
991733537 5:69611414-69611436 CCTAGGGCTAGGAGGGTAATGGG + Intergenic
991809971 5:70466560-70466582 CCTAGGGCTAGGAGGGTAATGGG + Intergenic
991861417 5:71016436-71016458 CCTAGGGCTAGGAGGGTAATGGG - Intronic
992502597 5:77357139-77357161 TCTAGAGCTTGGTGGACAGTGGG + Intronic
995080232 5:108042405-108042427 TGTAGGGGTGGGAGGAAAATGGG - Intronic
996334298 5:122366207-122366229 CCTAGGGCTTAAAGGACAAAGGG + Intronic
998868981 5:146533979-146534001 TATAGGGCTGGGAAGACCATAGG - Intergenic
999611606 5:153376037-153376059 TGTATGGCTAGGAGGAGAATGGG - Intergenic
1000526813 5:162368910-162368932 TCTGGGGTCTGGAGGACAGTTGG + Intergenic
1003088695 6:3082712-3082734 TCTAGGGCTTGGGGGGAAAATGG - Intronic
1003271659 6:4613153-4613175 GCCAGGGCTGGGAGAACAATGGG - Intergenic
1003986355 6:11439227-11439249 TCTAATGCATGAAGGACAATGGG - Intergenic
1005035006 6:21547516-21547538 TCTAGGGTGGGGAGGAGAATTGG - Intergenic
1006606813 6:35263386-35263408 CCCAGGGCTTGGAAAACAATGGG - Intronic
1009627901 6:66160577-66160599 TCTAGGACTTTGAGGATCATGGG - Intergenic
1012595254 6:101031329-101031351 ACTAGGGCTTGTTGGACAGTGGG - Intergenic
1012619650 6:101326598-101326620 TCCAGGACTTGAATGACAATAGG - Intergenic
1014947208 6:127513662-127513684 TCTAGGGTTTGGAAGAAAAGTGG + Intronic
1014953554 6:127588377-127588399 TGTAGGGATTGGAGAACAACTGG + Intronic
1017205351 6:151799395-151799417 ACCAGAGCTTGGAGGACAATTGG - Intronic
1018484769 6:164229790-164229812 ACGAGGCCTTAGAGGACAATGGG - Intergenic
1023236891 7:38099358-38099380 TCTGGGGTCTGGAGGACAGTGGG - Intergenic
1024014380 7:45297676-45297698 TCTGGGACGTGGAGGACGATAGG - Intergenic
1024175442 7:46835849-46835871 TCTGGGGAGTGGAGGAAAATTGG + Intergenic
1025043858 7:55673916-55673938 CCTAGGGCCTGGAAGGCAATTGG - Intergenic
1025136786 7:56422442-56422464 CCTAGGGCCTGGAAGGCAATTGG - Intergenic
1025337633 7:58427274-58427296 TCAAGCGATTTGAGGACAATTGG + Intergenic
1028950856 7:96632828-96632850 TGCAGGGGTTGGGGGACAATCGG + Intronic
1030373391 7:108726564-108726586 CATAGGACTTGGAGGACAAGAGG - Intergenic
1031275199 7:119712520-119712542 TCTAGGGTCTGGAGGACAGATGG + Intergenic
1032899970 7:136295938-136295960 TCTGGGGCTAGGTTGACAATTGG + Intergenic
1034044405 7:147912729-147912751 TCTGGGGCTTGGAGGAGGTTTGG - Intronic
1034285700 7:149881866-149881888 TCTTGGGGGTAGAGGACAATGGG - Intergenic
1037272756 8:17147392-17147414 TCTAGGGCTGGAAGGACAAAGGG - Intergenic
1039146400 8:34451751-34451773 ACTGGGGCTTGTAGGACAGTGGG - Intergenic
1042171790 8:65998792-65998814 ACTGGGGCTTGTTGGACAATGGG - Intergenic
1042394453 8:68276417-68276439 ACTGGGGCTTGTAGGACAGTGGG + Intergenic
1044546525 8:93466428-93466450 ACTGGGGCTTGTAGGACAGTGGG + Intergenic
1046705980 8:117452234-117452256 TTTAGGGCTTCCAGGACACTTGG + Intergenic
1047116000 8:121842504-121842526 TCTGGGGTCTGGAGGACAATGGG - Intergenic
1048146422 8:131848964-131848986 TCTAGGGCTTGGAGGAAATGGGG + Intergenic
1048231271 8:132644475-132644497 ACTGGGGCTTGTTGGACAATGGG + Intronic
1048235304 8:132683839-132683861 TCCAGGGGTGGGAGGAAAATAGG - Intergenic
1050652983 9:7793000-7793022 TCTGGGCCTTGAAGGACAAGTGG + Intergenic
1052872946 9:33524847-33524869 TGTAGCGCTTGGTGGATAATTGG + Intronic
1053041605 9:34878357-34878379 ACTAGGGCTTGTCGGACAGTGGG + Intergenic
1054753657 9:68934521-68934543 TCTAGTGCTGGGAGGAGGATGGG - Intronic
1057121055 9:92574085-92574107 ACTAGGGCTTGTCGGACAGTGGG - Intronic
1057817209 9:98304399-98304421 CCTAGAGCCAGGAGGACAATGGG + Intronic
1058564035 9:106261371-106261393 ACTAGGGCTTGTGGGACAGTGGG - Intergenic
1058735348 9:107889009-107889031 TCTTTGCCTTGGAGGACATTGGG - Intergenic
1058959536 9:109979626-109979648 CATAGTGCTTGGAGCACAATAGG + Intronic
1059343959 9:113615835-113615857 TCTAGATCTTGGAGGATATTTGG + Intergenic
1186520729 X:10204552-10204574 ATTAGGCCTTGGAGGCCAATGGG + Intronic
1186826037 X:13340950-13340972 TCTGTGGCTTGGAGGAAAAGCGG - Intergenic
1188671054 X:32882271-32882293 CCTAGGGCTGGGAAGACAAAAGG - Intronic
1189294306 X:39908105-39908127 TCAAGGGCCTGGAAGACAAGGGG + Intergenic
1191726100 X:64282955-64282977 ACTAGGGCTTGTTGGACAGTGGG + Intronic
1193590568 X:83384255-83384277 TCTAGGGGTGGGAGGAGAACAGG + Intergenic
1194147619 X:90282234-90282256 TCTTAGCCTTGGAGCACAATAGG + Intergenic
1194639987 X:96392023-96392045 TCTAGGACTAGGGGGACAAAAGG - Intergenic
1194929441 X:99868138-99868160 TCTGGGGCCTGGAGGACGGTGGG - Intergenic
1198166499 X:134062651-134062673 ACTGGGGCTTGGTGGACAGTGGG - Intergenic
1199349859 X:146787877-146787899 TCTGGGGTTTAGAGGACAGTGGG - Intergenic
1199852607 X:151736363-151736385 CCTTGGGGTTGGAGGGCAATGGG + Intergenic
1199921874 X:152414999-152415021 CCAAGGGCTTGGAGGAAAAGAGG + Intronic
1200102009 X:153692916-153692938 GCCATGGCTCGGAGGACAATGGG + Intronic
1200494012 Y:3858991-3859013 TCTTAGCCTTGGAGCACAATAGG + Intergenic
1200663656 Y:5992536-5992558 ACTTGGACTTGGAGGACACTAGG - Intergenic