ID: 928275258

View in Genome Browser
Species Human (GRCh38)
Location 2:29894775-29894797
Sequence TTGCTTTTCTAGGAGGATGA CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 303
Summary {0: 1, 1: 0, 2: 0, 3: 24, 4: 278}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
928275254_928275258 -2 Left 928275254 2:29894754-29894776 CCCTTTTAATTCTCAACTATTTT 0: 1
1: 0
2: 5
3: 94
4: 973
Right 928275258 2:29894775-29894797 TTGCTTTTCTAGGAGGATGACGG 0: 1
1: 0
2: 0
3: 24
4: 278
928275255_928275258 -3 Left 928275255 2:29894755-29894777 CCTTTTAATTCTCAACTATTTTG 0: 1
1: 0
2: 2
3: 49
4: 532
Right 928275258 2:29894775-29894797 TTGCTTTTCTAGGAGGATGACGG 0: 1
1: 0
2: 0
3: 24
4: 278

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
928275258 Original CRISPR TTGCTTTTCTAGGAGGATGA CGG Intronic
901684451 1:10935842-10935864 TTGGGTTTCTGTGAGGATGAAGG - Intergenic
901709754 1:11104499-11104521 TGGCTTCTCTGGGAGGCTGAGGG + Intergenic
903029576 1:20453281-20453303 TAGCTTTTCTGTGAGGATGATGG - Intergenic
903314090 1:22487314-22487336 TTGCTTTTGTTAGAGGATTATGG - Intronic
904094842 1:27968515-27968537 TTGCTGTTCTAGGAGGTCCATGG + Intergenic
904345590 1:29866735-29866757 TTTCTAGTCTGGGAGGATGAGGG - Intergenic
905116931 1:35649926-35649948 TTGATTTTCTTTGAAGATGAAGG - Intergenic
905281650 1:36853117-36853139 TTGCTTGTCTGGGAGACTGAAGG - Intronic
906518469 1:46453369-46453391 CTGCATTTGGAGGAGGATGAGGG - Intergenic
907663210 1:56412520-56412542 TTGTTTCCCTAGGAGGAAGAGGG + Intergenic
909031870 1:70550896-70550918 TTGCTTTTCTAGAAGTAAGCTGG - Intergenic
910018135 1:82552220-82552242 TTGCATTCTTAGGAGGCTGAGGG - Intergenic
910703995 1:90106939-90106961 TTGCTTTTTTATGTGGATGGCGG + Intergenic
911231038 1:95362073-95362095 TGGCTTTTATAGGAAGATGGAGG + Intergenic
911265899 1:95742885-95742907 TTACGTTTCCAGGAGGATTATGG + Intergenic
911717828 1:101155079-101155101 TTGTTTTTATATGTGGATGAGGG + Intergenic
912052900 1:105553079-105553101 TTGCTGCTCTAGAATGATGAGGG + Intergenic
912116798 1:106417540-106417562 TTGCTTTTTTAGGGGGAAGTGGG - Intergenic
913432717 1:118812976-118812998 TTTCTTTTCTAGCAGAAAGAGGG - Intergenic
913597474 1:120392889-120392911 TTGTTTTTCTAGGAGGGGGGAGG - Intergenic
914089856 1:144486425-144486447 TTGTTTTTCTAGGAGGGGGGAGG + Intergenic
914289426 1:146259298-146259320 TTGTTTTTCTAAGAGGAGGGTGG - Intergenic
914308754 1:146447791-146447813 TTGTTTTTCTAGGAGGGGGGAGG - Intergenic
914550462 1:148710051-148710073 TTGTTTTTCTAAGAGGAGGGTGG - Intergenic
914593354 1:149125340-149125362 TTGTTTTTCTAGGAGGGGGGAGG + Intergenic
914719839 1:150280823-150280845 CTGCTTTTTTAGGTGGAAGAAGG + Exonic
915577945 1:156793441-156793463 TTGCTTTTTTAGGAAGAGGAAGG + Intronic
915904019 1:159865139-159865161 TGGCTGTTCTAGGAGCATGTAGG - Intronic
917032458 1:170708623-170708645 TGTCTTTTCTAGGAGCAAGATGG + Intronic
917985590 1:180314712-180314734 TTTCTTTTATAGGACAATGAAGG - Exonic
919439756 1:197617107-197617129 TTGCTTTTCATGGTGGATCAAGG + Intronic
921409822 1:214823599-214823621 TTGTGTATCTAGGAGGATTATGG + Intergenic
921555001 1:216587624-216587646 ATGCTTTTCTAAGAGGGGGAAGG - Intronic
922002198 1:221490869-221490891 TTGCTTTTCTAGGCTGATGGAGG + Intergenic
922124581 1:222710377-222710399 TTGAATTTCTAGGAACATGAAGG - Intronic
922818567 1:228469061-228469083 ATGCTTCTCTACTAGGATGAGGG + Intergenic
1063701212 10:8387046-8387068 TTTCTTTGTTAGGAGGATGGAGG + Intergenic
1063722482 10:8598351-8598373 TTGGATTTCCAGCAGGATGAAGG - Intergenic
1063884620 10:10564791-10564813 TTGCTTTTCTTGGTGGAGGTAGG - Intergenic
1065075263 10:22072419-22072441 TTTCTGTCCTAGGAGGATGTAGG - Intergenic
1065423368 10:25572637-25572659 TTGCTTTTCTAGGGTTTTGAAGG + Exonic
1065622997 10:27602274-27602296 TTGCTTTTCTAGGAACATATCGG + Intergenic
1067377520 10:45741502-45741524 TTTCTTTTGTAGGAGGATTTGGG + Intronic
1067885222 10:50082187-50082209 TTTCTTTTGTAGGAGGATTTGGG + Intronic
1069940765 10:71953793-71953815 TCGCTTTTGGAGGAGGATGGGGG + Intergenic
1071107235 10:82112383-82112405 TTCTTTTTTTAGGAAGATGAGGG + Intronic
1071864104 10:89706856-89706878 TTGCTTTTCTAGGAAAATTTTGG + Intronic
1072029214 10:91501714-91501736 TTTCTTTTCTAGGGGGTTGGGGG + Intronic
1073179556 10:101575439-101575461 TTGCTTCTCCAGGAGAATCATGG - Intronic
1074829081 10:117236082-117236104 TTGCTCTTCTAGGAGGAGGTTGG + Intergenic
1075946794 10:126440311-126440333 TTACTTACCTAGGAGGATTATGG - Intronic
1077829924 11:5856167-5856189 TTGCATCTCTAGGTGCATGAGGG + Intronic
1078444517 11:11394221-11394243 GGGCTTTCCTAGGAGGATAAAGG + Intronic
1078492072 11:11778811-11778833 TTTCCTTTCTATGAGGATGTGGG + Intergenic
1079960681 11:26919520-26919542 TTGCTTTTCTGGGAGCATGTGGG - Intergenic
1080411702 11:32031045-32031067 TTCCTTTCCAAGGAGGATAAGGG + Intronic
1082017186 11:47498855-47498877 TTGCTTTTTTTGGAGGGTAAAGG + Intronic
1082903895 11:58285368-58285390 TTGTGTTCCTAGGAGGATTATGG - Intergenic
1082938000 11:58674587-58674609 TTTCATAGCTAGGAGGATGAGGG + Intronic
1083072839 11:60003960-60003982 TTGTGTATCTAGGAGGATTATGG - Intergenic
1083389083 11:62334865-62334887 TGGATGTTCTAGGAGGAGGAGGG - Intergenic
1086077648 11:82871599-82871621 TTGCCTTTTTTGGAGGTTGAGGG - Intronic
1086493114 11:87375672-87375694 TTGCTTAAATAGGAGAATGAAGG + Intergenic
1087615925 11:100486683-100486705 TTATGTTTCCAGGAGGATGATGG - Intergenic
1088179458 11:107092658-107092680 TTATGTTTCTAGGAGGATTATGG - Intergenic
1088686377 11:112287545-112287567 TAGCTTTTCTAGGTGGATAATGG + Intergenic
1092146399 12:6217704-6217726 TTGCTTTTCCAGGAGGACAATGG + Intronic
1092593258 12:9971089-9971111 TTCCTTTTGTATGATGATGAAGG - Intronic
1093488749 12:19681398-19681420 TTGTGTTCCTAGGAGGATTATGG + Intronic
1095318501 12:40796399-40796421 TTGCTTTTCTAGGAAGCTCTCGG - Intronic
1095611776 12:44137400-44137422 TTGATTTCCTAGTAGGAGGAGGG + Intronic
1096293579 12:50363542-50363564 TAGCATTGCTAGGATGATGAAGG - Intronic
1096455589 12:51782596-51782618 TTTCTTTTGTAGGGGGATGGGGG - Intronic
1099021727 12:77414135-77414157 TTGCTATTGTAAGTGGATGATGG + Intergenic
1100055248 12:90501230-90501252 CAGCTTTTCCAGGAGGAGGAAGG + Intergenic
1100106166 12:91175327-91175349 TTTTTTTTTTAAGAGGATGAGGG - Intronic
1101124327 12:101615359-101615381 ATCCTTTTCAAGGAGGAAGAGGG - Intronic
1101616440 12:106342489-106342511 ATGGTGTTCTAGGAGGAAGAGGG + Intronic
1101866404 12:108523624-108523646 TTGCTCTTTTAGGAGGGGGAAGG - Exonic
1102770227 12:115469749-115469771 TTGCTATTCGATGAAGATGATGG + Intergenic
1104717841 12:131028191-131028213 TTGCTTTTCTTGAATGATGTTGG + Intronic
1105314438 13:19244239-19244261 TTGTGTTCCTAGGAGGATTATGG - Intergenic
1105614969 13:22003390-22003412 TTGTTTTTCTAGAAGGGTAAAGG + Intergenic
1106856863 13:33863400-33863422 TTGCATTTATGGGAGGAGGAAGG + Intronic
1106885873 13:34183580-34183602 TGGCATTTCGTGGAGGATGAAGG + Intergenic
1107468321 13:40667957-40667979 TTGCTTTTTTAGGAAGAATATGG + Intergenic
1107876191 13:44792523-44792545 TTGCTTTTCTGGGAGAAGTAAGG - Intergenic
1109508422 13:63336971-63336993 TTGTGTACCTAGGAGGATGATGG + Intergenic
1110232069 13:73177519-73177541 TTGTTTTTCTAGTAGAGTGATGG - Intergenic
1111855724 13:93634665-93634687 TTGAGTTTCTAGAAGCATGAAGG + Intronic
1112825014 13:103382127-103382149 TGGCTTTTCCAGGTGCATGATGG + Intergenic
1113936158 13:113996203-113996225 CTGCTTCTCTAGGAGGAGGCTGG - Intronic
1114052522 14:18933034-18933056 TTGCATTTCTCTGATGATGAGGG + Intergenic
1114110035 14:19468891-19468913 TTGCATTTCTCTGATGATGAGGG - Intergenic
1114544453 14:23488307-23488329 TTGCTTCTCTGGGAGGTTTAGGG + Intronic
1114808422 14:25865011-25865033 TTGTATTTCTAGGAGGTTGAGGG - Intergenic
1114895715 14:26988520-26988542 GTCCTTATCTAGGAGGCTGAAGG + Intergenic
1115348522 14:32368160-32368182 TTGCTTTTCTCTGAGGAGGCAGG + Intronic
1121645546 14:95515502-95515524 CTGCTTCTCTTGGTGGATGAAGG + Intergenic
1122916757 14:104862940-104862962 TTGCATTTCCTGGAGGATGCTGG + Intergenic
1123976650 15:25560045-25560067 TTGCTTTTCAAGCAGGACGGTGG - Intergenic
1124102743 15:26711251-26711273 CTCCTTTTCTATGAGGATGTCGG + Intronic
1126481980 15:49134504-49134526 TTGCTTTCCTAGACTGATGATGG - Exonic
1127498141 15:59531515-59531537 CTTCCTTTCTAGGGGGATGAGGG + Intergenic
1127564027 15:60168935-60168957 TTTCTATTCCAGGAGGATGTTGG - Intergenic
1129153418 15:73703168-73703190 TTGCTGTTCTGGGAGATTGAAGG - Intronic
1129899379 15:79134369-79134391 TTGCTTTTTTATGGGCATGAGGG - Intergenic
1130917972 15:88320949-88320971 TTGGTTCTGTTGGAGGATGAAGG - Intergenic
1134050733 16:11135491-11135513 ATGCTTTTCTGGGAGGTGGAGGG + Intronic
1136748200 16:32610854-32610876 TTGCCTTCCTAGGAGGATAGAGG + Intergenic
1137332375 16:47511740-47511762 TTGCTTTCCTATGAGGAATATGG + Exonic
1137581567 16:49636677-49636699 GTGCTTCTCCAGCAGGATGATGG + Exonic
1138268413 16:55677327-55677349 TTTCCTTTATGGGAGGATGAGGG - Intronic
1203050335 16_KI270728v1_random:870061-870083 TTGCCTTCCTAGGAGGATAGAGG + Intergenic
1144259537 17:13504683-13504705 ATGCTTTTCTTGGAGCATTATGG - Intronic
1144583055 17:16470760-16470782 TTGCTTCTCTAGGAAGACAATGG + Intronic
1146572082 17:33961610-33961632 TTGCTGTTCTGGGAAGATCACGG + Intronic
1147362849 17:39942577-39942599 TTGCTTCTCTAGGAGTTGGAAGG - Intronic
1150978284 17:70113169-70113191 TTGATTTTCTAGGCGAATGAAGG - Intronic
1153168987 18:2293537-2293559 TTGCGTACCTAGGAGGATTATGG + Intergenic
1153757227 18:8296559-8296581 CAGCTGTTCTAGAAGGATGAAGG - Intronic
1153772980 18:8430157-8430179 TTGCATTTCTAGGTGTATGATGG - Intergenic
1153879535 18:9408309-9408331 TTGCTTTCCAAGAAGGAAGAAGG + Intergenic
1157109714 18:44809207-44809229 TTGCCTTTATAGGAGAGTGAAGG - Intronic
1157130530 18:45003170-45003192 TTTGTTTTCTCAGAGGATGAGGG - Intronic
1158427937 18:57355175-57355197 TTGTTTTTTTAGGTGGAAGAAGG + Intronic
1159624016 18:70670490-70670512 TTGCTTCTGTAGGGGGATGATGG + Intergenic
1159644451 18:70900847-70900869 GTGCTTTTCAAGGAGGTAGATGG - Intergenic
1160356251 18:78230243-78230265 TTGGTTCGCTAGGAGGAAGAGGG - Intergenic
1163378559 19:16949254-16949276 TAGCTTTTCCAGCAGGAAGAAGG - Intronic
1165232269 19:34394558-34394580 TTGCTTTTCTGGAGGGATAAAGG - Intronic
1168299900 19:55398493-55398515 TTGTTTTTCTAGGAGTATAATGG + Intronic
925248692 2:2410086-2410108 TTGTTTTGCTTGGAGGATGTGGG + Intergenic
925293453 2:2763200-2763222 GAGCTTTTCTGGGAGGAGGAGGG - Intergenic
926882321 2:17559781-17559803 TTTCTTTTCTATGATGAGGAAGG - Intronic
927065007 2:19462521-19462543 TTTTTTTTCTAAGAGGAGGAGGG + Intergenic
928275258 2:29894775-29894797 TTGCTTTTCTAGGAGGATGACGG + Intronic
928643113 2:33321030-33321052 TTTCTTCTCTTGGATGATGATGG + Intronic
928724327 2:34153693-34153715 TGGCTTTCCTGGGAGGATCAAGG - Intergenic
929762542 2:44817919-44817941 TTACTTTTCTAGGATCATGCAGG - Intergenic
931988001 2:67759515-67759537 TTGATTTTCTAGGAGAATTTGGG - Intergenic
933690597 2:85176590-85176612 TTATTTTTCTAGGATAATGAAGG - Intronic
933873067 2:86588963-86588985 TTCCTTTTTTAGGAGGAAGAAGG - Intronic
933902911 2:86862041-86862063 TTGCAATGCTAGGAGGATGAGGG - Intergenic
935777634 2:106487228-106487250 TTGCAATGCTAGGAGGATGAGGG + Intergenic
938059643 2:128242265-128242287 TTGTGTTTCTAGCAGGAGGAGGG + Intronic
938697295 2:133845695-133845717 TCGCATTTCTAGCAGGAGGAAGG - Intergenic
942658252 2:178237294-178237316 TTACTTTTCTAGTAAGATCAAGG + Intronic
943830224 2:192451574-192451596 TTGCTTTACTCGTAGTATGAGGG + Intergenic
946025982 2:216671936-216671958 GTGCTTGTCTTGGGGGATGAGGG + Intergenic
946290597 2:218741660-218741682 CTGCTTTTCTGGAAGGAGGATGG - Intronic
946454518 2:219813384-219813406 TTTTTTTTTTAGGAGGATTAGGG + Intergenic
1169401309 20:5282910-5282932 TTGTGTTCCTAGGAGGATTATGG - Intergenic
1170129725 20:13006219-13006241 TTTCTTTTCTTGGTGGTTGATGG + Intergenic
1170245778 20:14220249-14220271 TTGTTTACCTAGGAGGATTATGG + Intronic
1170974196 20:21146720-21146742 TTGTTTTTATAGTAGGAGGAAGG + Intronic
1175974752 20:62705029-62705051 TTGGTTTCCTATGAGGACGAAGG - Intergenic
1179039437 21:37789163-37789185 TTGCATCTCTAGTAGGAAGAAGG - Intronic
1179452835 21:41477452-41477474 TTTTTTTTCTAGGAGGAGGTTGG - Intronic
1180470997 22:15655409-15655431 TTGCATTTCTCTGATGATGAGGG + Intergenic
1182522116 22:30890646-30890668 TTGCTTTTCTCGGATGTTCAGGG - Intronic
1184241832 22:43215110-43215132 TTCCTTTGAGAGGAGGATGATGG - Intronic
1184413037 22:44336881-44336903 CTGCTTTTCCAGGAGGCCGAGGG + Intergenic
951237935 3:20256635-20256657 TTACCTTTCTAGGAAGATTAGGG + Intergenic
952822265 3:37495609-37495631 TGGCCTTTCTAGAAGCATGATGG - Intronic
953562007 3:43999065-43999087 CGGCTTTTCCAGGAGGAAGATGG + Intergenic
953841835 3:46395673-46395695 GTGCTTTTCTAGGCGGAAGGAGG - Intergenic
955298260 3:57753794-57753816 TTGATCTTCTAGGAGGAAGATGG + Intergenic
955587371 3:60495203-60495225 TTGCATTTCTTTGATGATGAAGG + Intronic
955960090 3:64331648-64331670 TTGCAGCTCTAGGAGGAGGAAGG + Intronic
959263242 3:104106404-104106426 TTGCATTTCTCTGATGATGAGGG - Intergenic
959279767 3:104323400-104323422 TTGTGTATCTAGGAGGATTATGG - Intergenic
959579785 3:107971616-107971638 TTCCTCTTCTGGAAGGATGATGG + Intergenic
959999115 3:112712398-112712420 GAGCTTTTCAATGAGGATGAAGG + Intergenic
961089803 3:124101164-124101186 TTGCTTTTCTGGGAATATGAAGG - Intronic
961799638 3:129436988-129437010 TTGCTTTTGAAAGAAGATGAGGG - Exonic
963856043 3:150255012-150255034 TTGTTTTACAAAGAGGATGAGGG - Intergenic
965970590 3:174550557-174550579 TTTGTTTTTTAGGAGGCTGAGGG + Intronic
966413147 3:179663860-179663882 GGGCTTTTCCAGGAGGATGAGGG - Intronic
966705042 3:182904269-182904291 TTGCTCTTCTATGATGCTGATGG - Intronic
967257527 3:187609052-187609074 TTGCGTACCTAGGAGGATTATGG + Intergenic
967651336 3:191990265-191990287 TTACGTTCCTAGGAGGATTATGG - Intergenic
967953178 3:194856578-194856600 TTGCTTCTCTTGTAGGATAATGG + Intergenic
970132348 4:12885558-12885580 TCGTTTTTCAAGGAGGATGTTGG - Intergenic
970506724 4:16738350-16738372 TTTCTTTTATAGGAAGAAGAAGG + Intronic
971035019 4:22683553-22683575 TTTCTTTTCTAGAATAATGAGGG - Intergenic
971710374 4:30103840-30103862 TTGCTTTTTCAGGAGGATTTTGG - Intergenic
971926073 4:33011054-33011076 TTGATTTGCCAGGAGAATGAGGG - Intergenic
974768312 4:66377619-66377641 TTGCTTGTCTAGAATGATGGAGG + Intergenic
975188606 4:71433110-71433132 GTGGTTTTCTTGGAGAATGAAGG - Intronic
975517247 4:75260261-75260283 TTGTGTCTCTAGGAGGATTATGG - Intergenic
975618748 4:76274687-76274709 TAGGTTTTCCAGGAGGAAGAAGG + Intronic
977009072 4:91612901-91612923 TTTTTTTTCTAGGAAGATGAAGG - Intergenic
977020003 4:91746926-91746948 TTGTGTATCTAGGAGGATTATGG + Intergenic
977395718 4:96468539-96468561 TGGCTTTTCCAGGAGCATGATGG + Intergenic
977796609 4:101173188-101173210 TTGCCTTTATTGGGGGATGAGGG + Intronic
978016292 4:103750449-103750471 TTGCTGTTCTGGCAGAATGAGGG - Intergenic
979545332 4:121933526-121933548 GTGCTTTTGTAGGGGGCTGAGGG - Intronic
980318594 4:131238571-131238593 TTGGTTTTCTCAGAGGGTGAGGG - Intergenic
982342055 4:154310590-154310612 CTGCTTTTCAAGGATGCTGATGG - Intronic
982417613 4:155155572-155155594 TTGCTTTTCTAGGTGTTGGAAGG - Intergenic
982833432 4:160091774-160091796 TTGATGTTCTAGGAAGAAGAGGG - Intergenic
983157046 4:164361349-164361371 TTGCAGTTGTAGGAGGATGGTGG - Intronic
983449775 4:167895401-167895423 TTGTGTATCTAGGAGGATTATGG - Intergenic
983533038 4:168831491-168831513 TTTCTTTTCTAAGAAGAGGAAGG - Intronic
985480489 5:107436-107458 TGGCCTTCCTAGGAGGAAGAAGG + Intergenic
986418522 5:7552908-7552930 TTTCTTTACTAGTAGGATGGAGG - Intronic
986698417 5:10379335-10379357 TTATTTTTCTAGGTGGATAATGG - Intronic
987145085 5:14984000-14984022 TGGTTTTTCTAGGGGGCTGAGGG + Intergenic
990614531 5:57494004-57494026 TTGCAATTCTATGTGGATGATGG + Intergenic
990749105 5:58993299-58993321 TTGTTTTTGTAGGAGGATTGGGG - Intronic
991933980 5:71783859-71783881 TTGCTGTTCTAGTAGGGTGCCGG - Intergenic
995020279 5:107359649-107359671 TTGCTTATCTAAGAAGATGAAGG - Intergenic
995526349 5:113053462-113053484 TGGCTTCTCTTAGAGGATGAAGG + Intronic
996186588 5:120484810-120484832 TTTCTTTCCTAGTAAGATGATGG + Intronic
997203977 5:132030647-132030669 TTGAGTTTCTGGGTGGATGATGG + Intergenic
998497323 5:142602042-142602064 TTAGTTCCCTAGGAGGATGAGGG + Intronic
1001172859 5:169437687-169437709 TTGCTTTGCTAGCAGGAAAATGG + Intergenic
1003116494 6:3287045-3287067 CTGCTTTGCCAGGAGCATGATGG - Exonic
1005262751 6:24079341-24079363 ACGCTTTTCTTAGAGGATGAAGG - Intergenic
1007028052 6:38598312-38598334 TTGCTTTGCTAGTGTGATGAAGG - Intronic
1007204992 6:40142185-40142207 TTGCTTTTCTGGTAGGAATAGGG + Intergenic
1007361631 6:41360763-41360785 TTCCTTTTCTGGGGGGAGGATGG + Intergenic
1009059190 6:58376794-58376816 TTGCATTTCTCTGATGATGAGGG - Intergenic
1009231654 6:61070334-61070356 TTGCATTTCTCTGATGATGAGGG + Intergenic
1009934952 6:70223214-70223236 TTGCTTTTTAAGGTGGATCAAGG - Intronic
1009950493 6:70389959-70389981 TTTGTTTTCTAGGAAGACGAGGG - Intergenic
1011166107 6:84448350-84448372 TTCATTTTTGAGGAGGATGATGG + Intergenic
1012700479 6:102451148-102451170 TGGCTTTTCCAGGTGCATGATGG + Intergenic
1013134114 6:107263016-107263038 TTGGTTTAATAAGAGGATGAGGG - Intronic
1013280445 6:108631468-108631490 TTTATTTTCTAGGAGGTGGAGGG + Intronic
1013746904 6:113356675-113356697 TTTATTTTCTAGGAGGAAAAAGG - Intergenic
1013781402 6:113732599-113732621 CTGCTTTTGTTGGAGGGTGAGGG - Intergenic
1013918871 6:115375672-115375694 TTACTGTTCTGGGTGGATGATGG + Intergenic
1014122296 6:117739510-117739532 TTTTTTTTGTGGGAGGATGAAGG - Intergenic
1015644230 6:135368616-135368638 TTACTTTCCCAGGAGGATTATGG + Intronic
1015866973 6:137736946-137736968 TTCCAATTCTAGGAGGAGGAAGG + Intergenic
1016142225 6:140626741-140626763 TGGCTTTTCCAGGAGCATGTTGG + Intergenic
1016615369 6:146041780-146041802 TTGGTTTTCTGTGAGGAAGATGG + Intronic
1017453847 6:154579903-154579925 TTGCTTTTCCAAGAGCATGTGGG + Intergenic
1018437236 6:163773281-163773303 TTGATTTTCTCAGGGGATGAGGG - Intergenic
1018804291 6:167246934-167246956 TTGCCTTGCTAGTGGGATGAGGG + Intergenic
1018874822 6:167812531-167812553 TGGCTTTTCTTGGGGGACGATGG - Intergenic
1020822920 7:12992561-12992583 TTTACTTTCTAGGAGGGTGATGG + Intergenic
1020840264 7:13208847-13208869 TTGGTTCTGTAGGGGGATGAGGG + Intergenic
1022490860 7:30816564-30816586 TGGCTTTTCCAGGAGGATGCGGG + Intronic
1024629043 7:51232246-51232268 TTCCTTTTTTGGGGGGATGAGGG - Intronic
1026124499 7:67567696-67567718 TTCCTTTTTTAGGAAGATCAGGG + Intergenic
1026476091 7:70736912-70736934 GTGATTTACAAGGAGGATGAAGG - Intronic
1028964116 7:96782532-96782554 TTGTTTTTCTAAGAGAATAAAGG - Intergenic
1030301416 7:107977897-107977919 TTGGTTGTCTAGGAGTATCAGGG + Intronic
1032526398 7:132581236-132581258 CTGCCTTTCAAGGAAGATGAGGG + Intronic
1032759464 7:134925823-134925845 TTGCTTGTCTTGGAAGAAGAAGG + Intronic
1033718044 7:144023521-144023543 TGGCTTTTGTAGGAGGAGGCTGG + Intergenic
1034209256 7:149348757-149348779 TGGCTTTTCCAGGTGCATGATGG + Intergenic
1034330389 7:150277655-150277677 CTGCTTATCTAGGAGGGTGGGGG - Intronic
1034667654 7:152832193-152832215 CTGCTTATCTAGGAGGGTGGGGG + Intronic
1037063277 8:14543462-14543484 TTACTTTTCCAGGATAATGATGG - Intronic
1037989122 8:23308116-23308138 GTCCTTTTCTAGGAGAACGAAGG + Intronic
1038053229 8:23833092-23833114 TTGCTCTTCCAGGAGAATGCGGG + Intergenic
1038237074 8:25769471-25769493 TTGTGTTCCTAGGAGGATTATGG - Intergenic
1039332757 8:36557381-36557403 ATGCTTTTCTAGAAGGATATGGG - Intergenic
1040024311 8:42767782-42767804 TTGCTTTTCAAGGCTGATGGAGG - Intronic
1040490921 8:47921535-47921557 TTGCTTTTATAGGCCGTTGAAGG + Intronic
1041264113 8:56047237-56047259 TTGATTCTCTAGGAGGAAGAAGG - Intergenic
1041509472 8:58639364-58639386 TTGCTTTTCTCTGATGATTAAGG - Intronic
1041977187 8:63813427-63813449 TTAGTTTTCTAGGAGGAGAAGGG + Intergenic
1042304151 8:67313985-67314007 TTGTGTATCTAGGAGGATTATGG + Intronic
1042412319 8:68479648-68479670 TGGCTTTTTGAGGGGGATGAAGG + Intronic
1047033181 8:120906052-120906074 TTGCTTTTCAAGCAAGAGGAAGG - Intergenic
1049774681 8:144398861-144398883 ATGCTCTTCTAGAATGATGATGG + Exonic
1049963417 9:757447-757469 GTGCTTCTCCAGGAGGAAGAGGG + Intergenic
1051417504 9:16857773-16857795 TTGCTTTTCTAGTATTCTGATGG - Intronic
1051789687 9:20786898-20786920 TTGCTTTTAGAGGAGGAAGTAGG - Intronic
1052751176 9:32492514-32492536 TTGCTCTACTAAGGGGATGATGG - Exonic
1052904628 9:33822809-33822831 TTGTTTTTTTAGGGGGAAGAGGG - Intronic
1057097382 9:92324649-92324671 TGGGTCTTCTAGGAGGAAGAAGG - Intronic
1057757081 9:97847491-97847513 TTGATCTTGCAGGAGGATGATGG + Intergenic
1058452568 9:105110904-105110926 TTGCTTTGCAAGGAGGTGGAGGG - Intergenic
1058606161 9:106725883-106725905 TAGCTTTTTTAAGAGAATGAAGG + Intergenic
1059251253 9:112889853-112889875 TTGCTTTTCCAGGAGATGGAGGG + Exonic
1189413585 X:40794508-40794530 TTGTGTTCCTAGGAGGATTATGG - Intergenic
1190409863 X:50125797-50125819 TTGTTTTTCAAGGGGGAGGATGG + Intergenic
1191067631 X:56367208-56367230 TTGTGTACCTAGGAGGATGATGG + Intergenic
1192627507 X:72745576-72745598 GGGCTTTTCTAAGAGGGTGAGGG - Intergenic
1192654201 X:72975237-72975259 GGGCTTTTCTAAGAGGGTGAGGG + Intergenic
1192907675 X:75568429-75568451 TTGTTTTTGTTAGAGGATGAGGG + Intergenic
1193478407 X:81996262-81996284 TTGCTTTTTTAGGTGGAAGCTGG + Intergenic
1193791632 X:85821791-85821813 TTATATTTCTAGGAGGATTATGG - Intergenic
1194025828 X:88749242-88749264 ATGCTTTTCTTGGGGGAAGAAGG + Intronic
1195302465 X:103544221-103544243 TTGTTTTTGTTGGGGGATGAAGG - Intergenic
1195443493 X:104923259-104923281 TTGCATCTCTAGGAAGATCAGGG - Intronic
1195471855 X:105239392-105239414 ATGCCTTTCTAGAAGAATGAAGG + Intronic
1196438688 X:115697205-115697227 TGGATTTTCTAGGGGGAAGATGG + Intergenic
1196509791 X:116495613-116495635 TTCCTTTTTTGGGAGGAGGAGGG + Intergenic
1196931966 X:120690688-120690710 TTGCTTTTGCACAAGGATGATGG - Intergenic
1197363563 X:125536421-125536443 TTATGTTTCTAGGAGGATTATGG - Intergenic
1197463411 X:126771593-126771615 TTACTTTCCTAGGAGGATTAGGG - Intergenic
1198201037 X:134419021-134419043 TTGTTTTTTGAGGAGGAGGAAGG + Intronic
1198843232 X:140880969-140880991 TTGCGTACCTAGGAGGATTATGG - Intergenic
1199316476 X:146384632-146384654 CAGCTTTTCTGGAAGGATGAGGG - Intergenic
1199738007 X:150703285-150703307 TTCCTTTTCTGGAAGGATAAAGG + Intronic
1200344942 X:155438962-155438984 TTGTTTTTGTGAGAGGATGAAGG - Intergenic